Structured Review

AP hydrolyzes [γ- 32 <t>P]ATP</t> and [α- 32 P]ATP bound to VEGF-A 165 . VEGF-A 165 (15 μM) was labeled with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 15 min. After labeling (t = 15 min), 300 ng of AP was added (lane 3 and 4). Incubation of all samples was continued for an additional period of 15 min followed by SDS-PAGE and autoradiography.
α 32 P Atp, supplied by HARTMANN ANALYTIC, used in various techniques. Bioz Stars score: 94/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and moreα 32 p atp/product/HARTMANN ANALYTIC
Average 94 stars, based on 8 article reviews
Price from $9.99 to $1999.99
α 32 p atp - by Bioz Stars, 2020-04
94/100 stars


1) Product Images from "Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells"

Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells

Journal: BMC Biochemistry

doi: 10.1186/1471-2091-12-28

AP hydrolyzes [γ- 32 P]ATP and [α- 32 P]ATP bound to VEGF-A 165 . VEGF-A 165 (15 μM) was labeled with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 15 min. After labeling (t = 15 min), 300 ng of AP was added (lane 3 and 4). Incubation of all samples was continued for an additional period of 15 min followed by SDS-PAGE and autoradiography.
Figure Legend Snippet: AP hydrolyzes [γ- 32 P]ATP and [α- 32 P]ATP bound to VEGF-A 165 . VEGF-A 165 (15 μM) was labeled with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 15 min. After labeling (t = 15 min), 300 ng of AP was added (lane 3 and 4). Incubation of all samples was continued for an additional period of 15 min followed by SDS-PAGE and autoradiography.

Techniques Used: Labeling, Incubation, SDS Page, Autoradiography

Effect of increased ionic strength on labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (3 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 30 min. NaCl (100 mM) was added at times (t) indicated.
Figure Legend Snippet: Effect of increased ionic strength on labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (3 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 30 min. NaCl (100 mM) was added at times (t) indicated.

Techniques Used: Labeling, Incubation

Labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (2 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C. MgCl 2 (0.1 mM) was added prior to ATP (+). After 15 min of incubation SDS-PAGE and autoradiography were performed.
Figure Legend Snippet: Labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (2 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C. MgCl 2 (0.1 mM) was added prior to ATP (+). After 15 min of incubation SDS-PAGE and autoradiography were performed.

Techniques Used: Labeling, Incubation, SDS Page, Autoradiography

2) Product Images from "Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells"

Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells

Journal: BMC Biochemistry

doi: 10.1186/1471-2091-12-28

AP hydrolyzes [γ- 32 P]ATP and [α- 32 P]ATP bound to VEGF-A 165 . VEGF-A 165 (15 μM) was labeled with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 15 min. After labeling (t = 15 min), 300 ng of AP was added (lane 3 and 4). Incubation of all samples was continued for an additional period of 15 min followed by SDS-PAGE and autoradiography.
Figure Legend Snippet: AP hydrolyzes [γ- 32 P]ATP and [α- 32 P]ATP bound to VEGF-A 165 . VEGF-A 165 (15 μM) was labeled with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 15 min. After labeling (t = 15 min), 300 ng of AP was added (lane 3 and 4). Incubation of all samples was continued for an additional period of 15 min followed by SDS-PAGE and autoradiography.

Techniques Used: Labeling, Incubation, SDS Page, Autoradiography

Effect of increased ionic strength on labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (3 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 30 min. NaCl (100 mM) was added at times (t) indicated.
Figure Legend Snippet: Effect of increased ionic strength on labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (3 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 30 min. NaCl (100 mM) was added at times (t) indicated.

Techniques Used: Labeling, Incubation

Labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (2 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C. MgCl 2 (0.1 mM) was added prior to ATP (+). After 15 min of incubation SDS-PAGE and autoradiography were performed.
Figure Legend Snippet: Labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (2 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C. MgCl 2 (0.1 mM) was added prior to ATP (+). After 15 min of incubation SDS-PAGE and autoradiography were performed.

Techniques Used: Labeling, Incubation, SDS Page, Autoradiography

3) Product Images from "2?-O-ribose methylation of cap2 in human: function and evolution in a horizontally mobile family"

Article Title: 2?-O-ribose methylation of cap2 in human: function and evolution in a horizontally mobile family

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkr038

hMTr2 activity and substrate requirements. Methyltransferase activity: In vitro transcribed RNA-GG molecules with the 32 P-labeled cap01 structure ( A ) were incubated with enzymes as indicated in the presence of SAM. Purified product RNA was digested with RNase T2. Digestion products were resolved on 21% polyacrylamide/8 M urea gel and visualized by autoradiography. BAP protein was used as negative control. RNA with 32 P-labeled cap structure created with the TbMTr2 enzyme was used as a reference. Specificity: autoradiography of two-dimensional chromatograms of 5′-phosphate nucleosides on thin layer cellulose plates. [α- 32 P] ATP-labeled in vitro transcribed cap01-RNA-GA was incubated with SAM in the absence, ( B ) or presence ( C ) of the hMTr2 protein. Product RNA was purified, cleaved by nuclease P1 and the resulting nucleotides were analyzed as described ( 44 ). 5′-monophosphate ribonucleosides of G, A, U, C, Am and m 6 A were used as standards. Substrate requirements: In vitro transcribed RNA-GG molecules with 32 P-labeled cap0 ( D ) or capG ( E) structure were incubated with one of the indicated enzymes, added in a given order, in the presence of SAM. After every modification step RNA molecules were purified by phenol/chloroform extraction and ethanol precipitation. Final products were digested and analyzed as described in legend for panel A. Asterisks indicate positions of 32 P-labeled phosphates.
Figure Legend Snippet: hMTr2 activity and substrate requirements. Methyltransferase activity: In vitro transcribed RNA-GG molecules with the 32 P-labeled cap01 structure ( A ) were incubated with enzymes as indicated in the presence of SAM. Purified product RNA was digested with RNase T2. Digestion products were resolved on 21% polyacrylamide/8 M urea gel and visualized by autoradiography. BAP protein was used as negative control. RNA with 32 P-labeled cap structure created with the TbMTr2 enzyme was used as a reference. Specificity: autoradiography of two-dimensional chromatograms of 5′-phosphate nucleosides on thin layer cellulose plates. [α- 32 P] ATP-labeled in vitro transcribed cap01-RNA-GA was incubated with SAM in the absence, ( B ) or presence ( C ) of the hMTr2 protein. Product RNA was purified, cleaved by nuclease P1 and the resulting nucleotides were analyzed as described ( 44 ). 5′-monophosphate ribonucleosides of G, A, U, C, Am and m 6 A were used as standards. Substrate requirements: In vitro transcribed RNA-GG molecules with 32 P-labeled cap0 ( D ) or capG ( E) structure were incubated with one of the indicated enzymes, added in a given order, in the presence of SAM. After every modification step RNA molecules were purified by phenol/chloroform extraction and ethanol precipitation. Final products were digested and analyzed as described in legend for panel A. Asterisks indicate positions of 32 P-labeled phosphates.

Techniques Used: Activity Assay, In Vitro, Labeling, Incubation, Purification, Autoradiography, Negative Control, Modification, Ethanol Precipitation

4) Product Images from "Intrinsic regulation of FIC-domain AMP-transferases by oligomerization and automodification"

Article Title: Intrinsic regulation of FIC-domain AMP-transferases by oligomerization and automodification

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.1516930113

NmFic E186G adenylylates GyrB. Autoradiographs obtained after incubation of NmFic wt ( Left ) and inhibition-relieved variant NmFic E186G ) ( Right ) with 40 nM α-[ 32 P]ATP, 15 mM MgCl 2 , and E. coli cell lysates overexpressing potential targets as indicated. Incubation was for 1 h at 30 °C.
Figure Legend Snippet: NmFic E186G adenylylates GyrB. Autoradiographs obtained after incubation of NmFic wt ( Left ) and inhibition-relieved variant NmFic E186G ) ( Right ) with 40 nM α-[ 32 P]ATP, 15 mM MgCl 2 , and E. coli cell lysates overexpressing potential targets as indicated. Incubation was for 1 h at 30 °C.

Techniques Used: Incubation, Inhibition, Variant Assay

5) Product Images from "Conserved Inhibitory Mechanism and Competent ATP Binding Mode for Adenylyltransferases with Fic Fold"

Article Title: Conserved Inhibitory Mechanism and Competent ATP Binding Mode for Adenylyltransferases with Fic Fold

Journal: PLoS ONE

doi: 10.1371/journal.pone.0064901

AMP transfer catalyzed by Fic proteins and their inhibition-relieved variants. Autoradiography of VbhA/VbhT(FIC), SoFic and NmFic (wt, wild type; E/G, E- > G mutant) after incubation with radioactively labeled α- 32 P-ATP.
Figure Legend Snippet: AMP transfer catalyzed by Fic proteins and their inhibition-relieved variants. Autoradiography of VbhA/VbhT(FIC), SoFic and NmFic (wt, wild type; E/G, E- > G mutant) after incubation with radioactively labeled α- 32 P-ATP.

Techniques Used: Inhibition, Autoradiography, Mutagenesis, Incubation, Labeling

Related Articles


Article Title: A bacterial toxin-antitoxin module is the origin of inter-bacterial and inter-kingdom effectors of Bartonella
Article Snippet: In short, cleared lysates of E . coli cultures from expression of TA module constructs and target candidates (or empty vectors) were mixed with α-32 P-ATP (Hartmann Analytic) to specifically label AMP transfer. .. Reactions were resolved by SDS-PAGE and protein AMPylation was visualized by autoradiography.


Article Title: Conserved Inhibitory Mechanism and Competent ATP Binding Mode for Adenylyltransferases with Fic Fold
Article Snippet: .. In vitro Adenylylation Assay Adenylylation activity of VbhA/VbhT(FIC), SoFic and NmFic constructs was assessed by incubating 125 ng, 1.25 µg and 2.5 µg of purified protein, respectively, with 10 µCi α-32 P-ATP (Hartmann Analytic) in a buffer containing 50 mM Tris pH 8.0, 150 mM NaCl, 0.1 mM EGTA, 15 mM MgCl2 , and protease inhibitor cocktail (Roche). ..

Article Title: A bacterial toxin-antitoxin module is the origin of inter-bacterial and inter-kingdom effectors of Bartonella
Article Snippet: .. In short, cleared lysates of E . coli cultures from expression of TA module constructs and target candidates (or empty vectors) were mixed with α-32 P-ATP (Hartmann Analytic) to specifically label AMP transfer. .. Reactions were resolved by SDS-PAGE and protein AMPylation was visualized by autoradiography.


Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells
Article Snippet: .. Labeling of VEGF-A165 with [γ-32 P]ATP and [α-32 P]ATP For labeling, 3 μg VEGF-A165 (unless otherwise noted) was incubated with 5 μCi each of [γ-32 P]ATP or [α-32 P]ATP (Hartmann Analytic, Braunschweig, Germany) and combined with 0.01 mM non-radioactive ATP (optionally containing 0.1 mM MgCl2 ). .. Incubation was performed in 25 mM Tris-HCl (pH 7.5, total volume 15 μL, 37°C, 15 min).

Activity Assay:

Article Title: Conserved Inhibitory Mechanism and Competent ATP Binding Mode for Adenylyltransferases with Fic Fold
Article Snippet: .. In vitro Adenylylation Assay Adenylylation activity of VbhA/VbhT(FIC), SoFic and NmFic constructs was assessed by incubating 125 ng, 1.25 µg and 2.5 µg of purified protein, respectively, with 10 µCi α-32 P-ATP (Hartmann Analytic) in a buffer containing 50 mM Tris pH 8.0, 150 mM NaCl, 0.1 mM EGTA, 15 mM MgCl2 , and protease inhibitor cocktail (Roche). ..

Article Title: A bacterial toxin-antitoxin module is the origin of inter-bacterial and inter-kingdom effectors of Bartonella
Article Snippet: AMPylation assays and protein expression The AMPylation activity of VbhTA and BtrFicTA was assayed using cleared lysates of ectopically expressing E . coli as described previously [ ]. .. In short, cleared lysates of E . coli cultures from expression of TA module constructs and target candidates (or empty vectors) were mixed with α-32 P-ATP (Hartmann Analytic) to specifically label AMP transfer.

Article Title: Depupylase Dop Requires Inorganic Phosphate in the Active Site for Catalysis *
Article Snippet: .. [α-32 P]ATP was obtained from Hartmann Analytic (Braunschweig, Germany) at a specific activity of 15 TBq (400 Ci)/mmol. .. Polyethyleneimine TLC plates were provided by VWR International.

Article Title: Intrinsic regulation of FIC-domain AMP-transferases by oligomerization and automodification
Article Snippet: .. Adenylylation activity of NmFic was assessed by incubating NmFic with 5 mM ATP, 10 μCi [α-32 P]-ATP (Hartmann Analytic), 25 mM MgCl2 ). .. NmFicE156R and NmFicE156R,Y183F (10 mg/mL and 8 mg/mL, respectively) crystallized in 500 μL of precipitant solution containing 10 mM Tris (pH 7.8) and 100 mM NaCl using the batch crystallization method at 4 °C.

Article Title: The Lid Domain of Caenorhabditis elegans Hsc70 Influences ATP Turnover, Cofactor Binding and Protein Folding Activity
Article Snippet: .. Single-turnover ATPase activity experiments Single-turnover ATPase assays were based on the separation of [α-32 P]-ADP from [α-32 P]-ATP (Hartmann Analytic, Braunschweig, Germany) by thin layer chromatography . .. 30 µl of a solution containing 20 µM CeHsc70 and 30 µM DNJ-13 or BAG-1 in assay buffer (40 mM HEPES/KOH pH 7.5, 150 mM KCl, 5 mM MgCl2 ) were mixed to a final concentration of 5 µM ATP containing 1.0 µCi [α-32 P]-ATP.


Article Title: A bacterial toxin-antitoxin module is the origin of inter-bacterial and inter-kingdom effectors of Bartonella
Article Snippet: .. In short, cleared lysates of E . coli cultures from expression of TA module constructs and target candidates (or empty vectors) were mixed with α-32 P-ATP (Hartmann Analytic) to specifically label AMP transfer. .. Reactions were resolved by SDS-PAGE and protein AMPylation was visualized by autoradiography.

Article Title: Intrinsic regulation of FIC-domain AMP-transferases by oligomerization and automodification
Article Snippet: Adenylylation assays were performed using cleared cell lysate of ectopically expressing E. coli as described previously ( ) [except using BL21 instead of BL21 (λDE3) cells for overexpression] or using purified proteins as described by Goepfert et al. ( ). .. Adenylylation activity of NmFic was assessed by incubating NmFic with 5 mM ATP, 10 μCi [α-32 P]-ATP (Hartmann Analytic), 25 mM MgCl2 ).

Over Expression:

Article Title: Intrinsic regulation of FIC-domain AMP-transferases by oligomerization and automodification
Article Snippet: Adenylylation assays were performed using cleared cell lysate of ectopically expressing E. coli as described previously ( ) [except using BL21 instead of BL21 (λDE3) cells for overexpression] or using purified proteins as described by Goepfert et al. ( ). .. Adenylylation activity of NmFic was assessed by incubating NmFic with 5 mM ATP, 10 μCi [α-32 P]-ATP (Hartmann Analytic), 25 mM MgCl2 ).


Article Title: RNase E cleavage shapes the transcriptome of Rhodobacter sphaeroides and strongly impacts phototrophic growth
Article Snippet: .. Oligodeoxynucleotides used for hybridization are listed in Table S1. α-32 [P]-ATP (SRP-301; Hartmann Analytic) and T4 polynucleotide kinase (#EK0031; Fermentas) were used for the end-labeling reaction. .. For detection of SorX, a PCR product (primers listed in Table S1) was labeled with α-[32 P]-dCTP (SRP-205; Hartmann Analytic) using the Prime-a-Gene Labeling System (U1100; Promega) as described in the manufacturer’s manual.

Protease Inhibitor:

Article Title: Conserved Inhibitory Mechanism and Competent ATP Binding Mode for Adenylyltransferases with Fic Fold
Article Snippet: .. In vitro Adenylylation Assay Adenylylation activity of VbhA/VbhT(FIC), SoFic and NmFic constructs was assessed by incubating 125 ng, 1.25 µg and 2.5 µg of purified protein, respectively, with 10 µCi α-32 P-ATP (Hartmann Analytic) in a buffer containing 50 mM Tris pH 8.0, 150 mM NaCl, 0.1 mM EGTA, 15 mM MgCl2 , and protease inhibitor cocktail (Roche). ..

Northern Blot:

Article Title: RNase E cleavage shapes the transcriptome of Rhodobacter sphaeroides and strongly impacts phototrophic growth
Article Snippet: Paragraph title: RNA isolation and Northern blot analysis ... Oligodeoxynucleotides used for hybridization are listed in Table S1. α-32 [P]-ATP (SRP-301; Hartmann Analytic) and T4 polynucleotide kinase (#EK0031; Fermentas) were used for the end-labeling reaction.


Article Title: 2?-O-ribose methylation of cap2 in human: function and evolution in a horizontally mobile family
Article Snippet: For generating internally, 32 P-labeled G-capped transcript RNA-GA [Gppp G p* A pGp(TpCp)12 ], transcription was carried out using pTZ19R-RNA-GA template, prepared as described above, with the addition of 10 μCi of [α-32 P] ATP (3000 Ci/mmol; Hartman Analytic GmbH) and the GpppG cap analog (Epicentre) following the manufacturer instructions. .. Templates for in vitro transcription of U1 and U2 snRNAs were prepared by a PCR-based method using the total DNA from human cells as a template, and primers that introduce the T7 bacteriophage class II ø2.5 promoter upstream of a desired sequence.


Article Title: Similarly Potent Inhibition of Adenylyl Cyclase by P-Site Inhibitors in Hearts from Wild Type and AC5 Knockout Mice
Article Snippet: [α-32 P]ATP (3000 Ci/mmol) was from Hartmann Analytic (Braunschweig, Germany).

Polymerase Chain Reaction:

Article Title: 2?-O-ribose methylation of cap2 in human: function and evolution in a horizontally mobile family
Article Snippet: For generating internally, 32 P-labeled G-capped transcript RNA-GA [Gppp G p* A pGp(TpCp)12 ], transcription was carried out using pTZ19R-RNA-GA template, prepared as described above, with the addition of 10 μCi of [α-32 P] ATP (3000 Ci/mmol; Hartman Analytic GmbH) and the GpppG cap analog (Epicentre) following the manufacturer instructions. .. Templates for in vitro transcription of U1 and U2 snRNAs were prepared by a PCR-based method using the total DNA from human cells as a template, and primers that introduce the T7 bacteriophage class II ø2.5 promoter upstream of a desired sequence.

Article Title: RNase E cleavage shapes the transcriptome of Rhodobacter sphaeroides and strongly impacts phototrophic growth
Article Snippet: Absence of DNA contamination was confirmed by PCR against the gloB gene (RSP_0799). .. Oligodeoxynucleotides used for hybridization are listed in Table S1. α-32 [P]-ATP (SRP-301; Hartmann Analytic) and T4 polynucleotide kinase (#EK0031; Fermentas) were used for the end-labeling reaction.

Molecular Weight:

Article Title: Type III restriction endonuclease EcoP15I is a heterotrimeric complex containing one Res subunit with several DNA-binding regions and ATPase activity
Article Snippet: Phusion Hot Start polymerase was purchased from Finnzyme, Prestained Protein Molecular Weight Marker from Fermentas and sinefungin from Sigma-Aldrich. .. [γ-32 P] ATP and [α-32 P] ATP were purchased from Hartmann Analytic GmbH.

Ion Exchange Chromatography:

Article Title: Depupylase Dop Requires Inorganic Phosphate in the Active Site for Catalysis *
Article Snippet: [α-32 P]ATP was obtained from Hartmann Analytic (Braunschweig, Germany) at a specific activity of 15 TBq (400 Ci)/mmol. .. [α-32 P]ATP was obtained from Hartmann Analytic (Braunschweig, Germany) at a specific activity of 15 TBq (400 Ci)/mmol.


Article Title: RNase E cleavage shapes the transcriptome of Rhodobacter sphaeroides and strongly impacts phototrophic growth
Article Snippet: Paragraph title: RNA isolation and Northern blot analysis ... Oligodeoxynucleotides used for hybridization are listed in Table S1. α-32 [P]-ATP (SRP-301; Hartmann Analytic) and T4 polynucleotide kinase (#EK0031; Fermentas) were used for the end-labeling reaction.

Size-exclusion Chromatography:

Article Title: Depupylase Dop Requires Inorganic Phosphate in the Active Site for Catalysis *
Article Snippet: [α-32 P]ATP was obtained from Hartmann Analytic (Braunschweig, Germany) at a specific activity of 15 TBq (400 Ci)/mmol. .. [α-32 P]ATP was obtained from Hartmann Analytic (Braunschweig, Germany) at a specific activity of 15 TBq (400 Ci)/mmol.


Article Title: RNase E cleavage shapes the transcriptome of Rhodobacter sphaeroides and strongly impacts phototrophic growth
Article Snippet: Oligodeoxynucleotides used for hybridization are listed in Table S1. α-32 [P]-ATP (SRP-301; Hartmann Analytic) and T4 polynucleotide kinase (#EK0031; Fermentas) were used for the end-labeling reaction. .. For detection of SorX, a PCR product (primers listed in Table S1) was labeled with α-[32 P]-dCTP (SRP-205; Hartmann Analytic) using the Prime-a-Gene Labeling System (U1100; Promega) as described in the manufacturer’s manual.

Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells
Article Snippet: .. Labeling of VEGF-A165 with [γ-32 P]ATP and [α-32 P]ATP For labeling, 3 μg VEGF-A165 (unless otherwise noted) was incubated with 5 μCi each of [γ-32 P]ATP or [α-32 P]ATP (Hartmann Analytic, Braunschweig, Germany) and combined with 0.01 mM non-radioactive ATP (optionally containing 0.1 mM MgCl2 ). .. Incubation was performed in 25 mM Tris-HCl (pH 7.5, total volume 15 μL, 37°C, 15 min).


Article Title: 2?-O-ribose methylation of cap2 in human: function and evolution in a horizontally mobile family
Article Snippet: Following the reaction, 32 P-labeled capped RNA molecules were purified by extraction with phenol/chloroform, passed through mini Quick Spin Oligo Columns (Roche) to remove free radionucleotides and precipitated with ethanol. .. For generating internally, 32 P-labeled G-capped transcript RNA-GA [Gppp G p* A pGp(TpCp)12 ], transcription was carried out using pTZ19R-RNA-GA template, prepared as described above, with the addition of 10 μCi of [α-32 P] ATP (3000 Ci/mmol; Hartman Analytic GmbH) and the GpppG cap analog (Epicentre) following the manufacturer instructions.

Article Title: Conserved Inhibitory Mechanism and Competent ATP Binding Mode for Adenylyltransferases with Fic Fold
Article Snippet: .. In vitro Adenylylation Assay Adenylylation activity of VbhA/VbhT(FIC), SoFic and NmFic constructs was assessed by incubating 125 ng, 1.25 µg and 2.5 µg of purified protein, respectively, with 10 µCi α-32 P-ATP (Hartmann Analytic) in a buffer containing 50 mM Tris pH 8.0, 150 mM NaCl, 0.1 mM EGTA, 15 mM MgCl2 , and protease inhibitor cocktail (Roche). ..

Article Title: Depupylase Dop Requires Inorganic Phosphate in the Active Site for Catalysis *
Article Snippet: [α-32 P]ATP was obtained from Hartmann Analytic (Braunschweig, Germany) at a specific activity of 15 TBq (400 Ci)/mmol. .. [α-32 P]ATP was obtained from Hartmann Analytic (Braunschweig, Germany) at a specific activity of 15 TBq (400 Ci)/mmol.

Article Title: Intrinsic regulation of FIC-domain AMP-transferases by oligomerization and automodification
Article Snippet: Adenylylation assays were performed using cleared cell lysate of ectopically expressing E. coli as described previously ( ) [except using BL21 instead of BL21 (λDE3) cells for overexpression] or using purified proteins as described by Goepfert et al. ( ). .. Adenylylation activity of NmFic was assessed by incubating NmFic with 5 mM ATP, 10 μCi [α-32 P]-ATP (Hartmann Analytic), 25 mM MgCl2 ).


Article Title: 2?-O-ribose methylation of cap2 in human: function and evolution in a horizontally mobile family
Article Snippet: For generating internally, 32 P-labeled G-capped transcript RNA-GA [Gppp G p* A pGp(TpCp)12 ], transcription was carried out using pTZ19R-RNA-GA template, prepared as described above, with the addition of 10 μCi of [α-32 P] ATP (3000 Ci/mmol; Hartman Analytic GmbH) and the GpppG cap analog (Epicentre) following the manufacturer instructions. .. Templates for in vitro transcription of U1 and U2 snRNAs were prepared by a PCR-based method using the total DNA from human cells as a template, and primers that introduce the T7 bacteriophage class II ø2.5 promoter upstream of a desired sequence.

Polyacrylamide Gel Electrophoresis:

Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells
Article Snippet: Labeling of VEGF-A165 with [γ-32 P]ATP and [α-32 P]ATP For labeling, 3 μg VEGF-A165 (unless otherwise noted) was incubated with 5 μCi each of [γ-32 P]ATP or [α-32 P]ATP (Hartmann Analytic, Braunschweig, Germany) and combined with 0.01 mM non-radioactive ATP (optionally containing 0.1 mM MgCl2 ). .. Proteins were separated by reducing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; 17.5%).

SDS Page:

Article Title: A bacterial toxin-antitoxin module is the origin of inter-bacterial and inter-kingdom effectors of Bartonella
Article Snippet: In short, cleared lysates of E . coli cultures from expression of TA module constructs and target candidates (or empty vectors) were mixed with α-32 P-ATP (Hartmann Analytic) to specifically label AMP transfer. .. Reactions were resolved by SDS-PAGE and protein AMPylation was visualized by autoradiography.

Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells
Article Snippet: Labeling of VEGF-A165 with [γ-32 P]ATP and [α-32 P]ATP For labeling, 3 μg VEGF-A165 (unless otherwise noted) was incubated with 5 μCi each of [γ-32 P]ATP or [α-32 P]ATP (Hartmann Analytic, Braunschweig, Germany) and combined with 0.01 mM non-radioactive ATP (optionally containing 0.1 mM MgCl2 ). .. Proteins were separated by reducing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; 17.5%).

In Vitro:

Article Title: 2?-O-ribose methylation of cap2 in human: function and evolution in a horizontally mobile family
Article Snippet: For generating internally, 32 P-labeled G-capped transcript RNA-GA [Gppp G p* A pGp(TpCp)12 ], transcription was carried out using pTZ19R-RNA-GA template, prepared as described above, with the addition of 10 μCi of [α-32 P] ATP (3000 Ci/mmol; Hartman Analytic GmbH) and the GpppG cap analog (Epicentre) following the manufacturer instructions. .. Templates for in vitro transcription of U1 and U2 snRNAs were prepared by a PCR-based method using the total DNA from human cells as a template, and primers that introduce the T7 bacteriophage class II ø2.5 promoter upstream of a desired sequence.

Article Title: Conserved Inhibitory Mechanism and Competent ATP Binding Mode for Adenylyltransferases with Fic Fold
Article Snippet: .. In vitro Adenylylation Assay Adenylylation activity of VbhA/VbhT(FIC), SoFic and NmFic constructs was assessed by incubating 125 ng, 1.25 µg and 2.5 µg of purified protein, respectively, with 10 µCi α-32 P-ATP (Hartmann Analytic) in a buffer containing 50 mM Tris pH 8.0, 150 mM NaCl, 0.1 mM EGTA, 15 mM MgCl2 , and protease inhibitor cocktail (Roche). ..

Article Title: Intrinsic regulation of FIC-domain AMP-transferases by oligomerization and automodification
Article Snippet: Paragraph title: In Vitro Adenylylation Assay. ... Adenylylation activity of NmFic was assessed by incubating NmFic with 5 mM ATP, 10 μCi [α-32 P]-ATP (Hartmann Analytic), 25 mM MgCl2 ).


Article Title: 2?-O-ribose methylation of cap2 in human: function and evolution in a horizontally mobile family
Article Snippet: Two variant RNA molecules of 63 nt were produced: RNA-GG that starts with guanosine (ppp G p G pGpX) and RNA-AG that starts with adenine (ppp A p G pGpX) were X=TAACGCTATTATTACAAAGCTCTTTTATGTAGTGTGCGTACCACGGTAGCAGGTACTGCG, based on the T. brucei spliced leader RNA gene (GenBank # Z50171.1), chosen for convenience. .. For generating internally, 32 P-labeled G-capped transcript RNA-GA [Gppp G p* A pGp(TpCp)12 ], transcription was carried out using pTZ19R-RNA-GA template, prepared as described above, with the addition of 10 μCi of [α-32 P] ATP (3000 Ci/mmol; Hartman Analytic GmbH) and the GpppG cap analog (Epicentre) following the manufacturer instructions.

Concentration Assay:

Article Title: The Lid Domain of Caenorhabditis elegans Hsc70 Influences ATP Turnover, Cofactor Binding and Protein Folding Activity
Article Snippet: Single-turnover ATPase activity experiments Single-turnover ATPase assays were based on the separation of [α-32 P]-ADP from [α-32 P]-ATP (Hartmann Analytic, Braunschweig, Germany) by thin layer chromatography . .. 30 µl of a solution containing 20 µM CeHsc70 and 30 µM DNJ-13 or BAG-1 in assay buffer (40 mM HEPES/KOH pH 7.5, 150 mM KCl, 5 mM MgCl2 ) were mixed to a final concentration of 5 µM ATP containing 1.0 µCi [α-32 P]-ATP.

Thin Layer Chromatography:

Article Title: Depupylase Dop Requires Inorganic Phosphate in the Active Site for Catalysis *
Article Snippet: [α-32 P]ATP was obtained from Hartmann Analytic (Braunschweig, Germany) at a specific activity of 15 TBq (400 Ci)/mmol. .. Polyethyleneimine TLC plates were provided by VWR International.

Article Title: The Lid Domain of Caenorhabditis elegans Hsc70 Influences ATP Turnover, Cofactor Binding and Protein Folding Activity
Article Snippet: .. Single-turnover ATPase activity experiments Single-turnover ATPase assays were based on the separation of [α-32 P]-ADP from [α-32 P]-ATP (Hartmann Analytic, Braunschweig, Germany) by thin layer chromatography . .. 30 µl of a solution containing 20 µM CeHsc70 and 30 µM DNJ-13 or BAG-1 in assay buffer (40 mM HEPES/KOH pH 7.5, 150 mM KCl, 5 mM MgCl2 ) were mixed to a final concentration of 5 µM ATP containing 1.0 µCi [α-32 P]-ATP.

End Labeling:

Article Title: RNase E cleavage shapes the transcriptome of Rhodobacter sphaeroides and strongly impacts phototrophic growth
Article Snippet: .. Oligodeoxynucleotides used for hybridization are listed in Table S1. α-32 [P]-ATP (SRP-301; Hartmann Analytic) and T4 polynucleotide kinase (#EK0031; Fermentas) were used for the end-labeling reaction. .. For detection of SorX, a PCR product (primers listed in Table S1) was labeled with α-[32 P]-dCTP (SRP-205; Hartmann Analytic) using the Prime-a-Gene Labeling System (U1100; Promega) as described in the manufacturer’s manual.


Article Title: Type III restriction endonuclease EcoP15I is a heterotrimeric complex containing one Res subunit with several DNA-binding regions and ATPase activity
Article Snippet: Phusion Hot Start polymerase was purchased from Finnzyme, Prestained Protein Molecular Weight Marker from Fermentas and sinefungin from Sigma-Aldrich. .. [γ-32 P] ATP and [α-32 P] ATP were purchased from Hartmann Analytic GmbH.

Variant Assay:

Article Title: 2?-O-ribose methylation of cap2 in human: function and evolution in a horizontally mobile family
Article Snippet: Two variant RNA molecules of 63 nt were produced: RNA-GG that starts with guanosine (ppp G p G pGpX) and RNA-AG that starts with adenine (ppp A p G pGpX) were X=TAACGCTATTATTACAAAGCTCTTTTATGTAGTGTGCGTACCACGGTAGCAGGTACTGCG, based on the T. brucei spliced leader RNA gene (GenBank # Z50171.1), chosen for convenience. .. For generating internally, 32 P-labeled G-capped transcript RNA-GA [Gppp G p* A pGp(TpCp)12 ], transcription was carried out using pTZ19R-RNA-GA template, prepared as described above, with the addition of 10 μCi of [α-32 P] ATP (3000 Ci/mmol; Hartman Analytic GmbH) and the GpppG cap analog (Epicentre) following the manufacturer instructions.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    HARTMANN ANALYTIC α 32 p atp
    AP hydrolyzes [γ- 32 <t>P]ATP</t> and [α- 32 P]ATP bound to VEGF-A 165 . VEGF-A 165 (15 μM) was labeled with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 15 min. After labeling (t = 15 min), 300 ng of AP was added (lane 3 and 4). Incubation of all samples was continued for an additional period of 15 min followed by SDS-PAGE and autoradiography.
    α 32 P Atp, supplied by HARTMANN ANALYTIC, used in various techniques. Bioz Stars score: 94/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and moreα 32 p atp/product/HARTMANN ANALYTIC
    Average 94 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results

    AP hydrolyzes [γ- 32 P]ATP and [α- 32 P]ATP bound to VEGF-A 165 . VEGF-A 165 (15 μM) was labeled with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 15 min. After labeling (t = 15 min), 300 ng of AP was added (lane 3 and 4). Incubation of all samples was continued for an additional period of 15 min followed by SDS-PAGE and autoradiography.

    Journal: BMC Biochemistry

    Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells

    doi: 10.1186/1471-2091-12-28

    Figure Lengend Snippet: AP hydrolyzes [γ- 32 P]ATP and [α- 32 P]ATP bound to VEGF-A 165 . VEGF-A 165 (15 μM) was labeled with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 15 min. After labeling (t = 15 min), 300 ng of AP was added (lane 3 and 4). Incubation of all samples was continued for an additional period of 15 min followed by SDS-PAGE and autoradiography.

    Article Snippet: Labeling of VEGF-A165 with [γ-32 P]ATP and [α-32 P]ATP For labeling, 3 μg VEGF-A165 (unless otherwise noted) was incubated with 5 μCi each of [γ-32 P]ATP or [α-32 P]ATP (Hartmann Analytic, Braunschweig, Germany) and combined with 0.01 mM non-radioactive ATP (optionally containing 0.1 mM MgCl2 ).

    Techniques: Labeling, Incubation, SDS Page, Autoradiography

    Effect of increased ionic strength on labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (3 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 30 min. NaCl (100 mM) was added at times (t) indicated.

    Journal: BMC Biochemistry

    Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells

    doi: 10.1186/1471-2091-12-28

    Figure Lengend Snippet: Effect of increased ionic strength on labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (3 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 30 min. NaCl (100 mM) was added at times (t) indicated.

    Article Snippet: Labeling of VEGF-A165 with [γ-32 P]ATP and [α-32 P]ATP For labeling, 3 μg VEGF-A165 (unless otherwise noted) was incubated with 5 μCi each of [γ-32 P]ATP or [α-32 P]ATP (Hartmann Analytic, Braunschweig, Germany) and combined with 0.01 mM non-radioactive ATP (optionally containing 0.1 mM MgCl2 ).

    Techniques: Labeling, Incubation

    Labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (2 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C. MgCl 2 (0.1 mM) was added prior to ATP (+). After 15 min of incubation SDS-PAGE and autoradiography were performed.

    Journal: BMC Biochemistry

    Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells

    doi: 10.1186/1471-2091-12-28

    Figure Lengend Snippet: Labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (2 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C. MgCl 2 (0.1 mM) was added prior to ATP (+). After 15 min of incubation SDS-PAGE and autoradiography were performed.

    Article Snippet: Labeling of VEGF-A165 with [γ-32 P]ATP and [α-32 P]ATP For labeling, 3 μg VEGF-A165 (unless otherwise noted) was incubated with 5 μCi each of [γ-32 P]ATP or [α-32 P]ATP (Hartmann Analytic, Braunschweig, Germany) and combined with 0.01 mM non-radioactive ATP (optionally containing 0.1 mM MgCl2 ).

    Techniques: Labeling, Incubation, SDS Page, Autoradiography

    hMTr2 activity and substrate requirements. Methyltransferase activity: In vitro transcribed RNA-GG molecules with the 32 P-labeled cap01 structure ( A ) were incubated with enzymes as indicated in the presence of SAM. Purified product RNA was digested with RNase T2. Digestion products were resolved on 21% polyacrylamide/8 M urea gel and visualized by autoradiography. BAP protein was used as negative control. RNA with 32 P-labeled cap structure created with the TbMTr2 enzyme was used as a reference. Specificity: autoradiography of two-dimensional chromatograms of 5′-phosphate nucleosides on thin layer cellulose plates. [α- 32 P] ATP-labeled in vitro transcribed cap01-RNA-GA was incubated with SAM in the absence, ( B ) or presence ( C ) of the hMTr2 protein. Product RNA was purified, cleaved by nuclease P1 and the resulting nucleotides were analyzed as described ( 44 ). 5′-monophosphate ribonucleosides of G, A, U, C, Am and m 6 A were used as standards. Substrate requirements: In vitro transcribed RNA-GG molecules with 32 P-labeled cap0 ( D ) or capG ( E) structure were incubated with one of the indicated enzymes, added in a given order, in the presence of SAM. After every modification step RNA molecules were purified by phenol/chloroform extraction and ethanol precipitation. Final products were digested and analyzed as described in legend for panel A. Asterisks indicate positions of 32 P-labeled phosphates.

    Journal: Nucleic Acids Research

    Article Title: 2?-O-ribose methylation of cap2 in human: function and evolution in a horizontally mobile family

    doi: 10.1093/nar/gkr038

    Figure Lengend Snippet: hMTr2 activity and substrate requirements. Methyltransferase activity: In vitro transcribed RNA-GG molecules with the 32 P-labeled cap01 structure ( A ) were incubated with enzymes as indicated in the presence of SAM. Purified product RNA was digested with RNase T2. Digestion products were resolved on 21% polyacrylamide/8 M urea gel and visualized by autoradiography. BAP protein was used as negative control. RNA with 32 P-labeled cap structure created with the TbMTr2 enzyme was used as a reference. Specificity: autoradiography of two-dimensional chromatograms of 5′-phosphate nucleosides on thin layer cellulose plates. [α- 32 P] ATP-labeled in vitro transcribed cap01-RNA-GA was incubated with SAM in the absence, ( B ) or presence ( C ) of the hMTr2 protein. Product RNA was purified, cleaved by nuclease P1 and the resulting nucleotides were analyzed as described ( 44 ). 5′-monophosphate ribonucleosides of G, A, U, C, Am and m 6 A were used as standards. Substrate requirements: In vitro transcribed RNA-GG molecules with 32 P-labeled cap0 ( D ) or capG ( E) structure were incubated with one of the indicated enzymes, added in a given order, in the presence of SAM. After every modification step RNA molecules were purified by phenol/chloroform extraction and ethanol precipitation. Final products were digested and analyzed as described in legend for panel A. Asterisks indicate positions of 32 P-labeled phosphates.

    Article Snippet: For generating internally, 32 P-labeled G-capped transcript RNA-GA [Gppp G p* A pGp(TpCp)12 ], transcription was carried out using pTZ19R-RNA-GA template, prepared as described above, with the addition of 10 μCi of [α-32 P] ATP (3000 Ci/mmol; Hartman Analytic GmbH) and the GpppG cap analog (Epicentre) following the manufacturer instructions.

    Techniques: Activity Assay, In Vitro, Labeling, Incubation, Purification, Autoradiography, Negative Control, Modification, Ethanol Precipitation

    NmFic E186G adenylylates GyrB. Autoradiographs obtained after incubation of NmFic wt ( Left ) and inhibition-relieved variant NmFic E186G ) ( Right ) with 40 nM α-[ 32 P]ATP, 15 mM MgCl 2 , and E. coli cell lysates overexpressing potential targets as indicated. Incubation was for 1 h at 30 °C.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Intrinsic regulation of FIC-domain AMP-transferases by oligomerization and automodification

    doi: 10.1073/pnas.1516930113

    Figure Lengend Snippet: NmFic E186G adenylylates GyrB. Autoradiographs obtained after incubation of NmFic wt ( Left ) and inhibition-relieved variant NmFic E186G ) ( Right ) with 40 nM α-[ 32 P]ATP, 15 mM MgCl 2 , and E. coli cell lysates overexpressing potential targets as indicated. Incubation was for 1 h at 30 °C.

    Article Snippet: Adenylylation activity of NmFic was assessed by incubating NmFic with 5 mM ATP, 10 μCi [α-32 P]-ATP (Hartmann Analytic), 25 mM MgCl2 ).

    Techniques: Incubation, Inhibition, Variant Assay