177 bp (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
98
Structured Review
New England Biolabs
177 bp
177 Bp, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 2814 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/statistical+program+stata+version+12/EcoRV/pm29959925-191-8-25
Average 98 stars, based on 2814 article reviews
177 Bp, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 2814 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/statistical+program+stata+version+12/EcoRV/pm29959925-191-8-25
Average 98 stars, based on 2814 article reviews
177 bp - by Bioz Stars,
2026-11
98/100 stars
Images
Related Articles
Recombinant:Article Title: Deciphering the functional roles of glutaredoxin 1 in chub mackerel (Scomber japonicus): implications for antioxidant defense and immune responses Article Snippet: .. Recombinant expression vector construction The Sjgrx1 coding sequence was amplified using PCR using primers with EcoRI and Expressing:Article Title: Deciphering the functional roles of glutaredoxin 1 in chub mackerel (Scomber japonicus): implications for antioxidant defense and immune responses Article Snippet: .. Recombinant expression vector construction The Sjgrx1 coding sequence was amplified using PCR using primers with EcoRI and Plasmid Preparation:Article Title: Deciphering the functional roles of glutaredoxin 1 in chub mackerel (Scomber japonicus): implications for antioxidant defense and immune responses Article Snippet: .. Recombinant expression vector construction The Sjgrx1 coding sequence was amplified using PCR using primers with EcoRI and Article Title: A two-tier architecture governs monomer incorporation and granule morphology in polyhydroxyalkanoate synthases: implications for bioplastic production Article Snippet: .. The pBBR1MCS2 vector was linearized using Article Title: Stable expression of Interleukin-18 in a live-attenuated PRRSV backbone confers safe and potent immune protection in pigs. Article Snippet: Porcine reproductive and respiratory syndrome virus (PRRSV) is a major swine pathogen responsible for substantial economic losses, and current live-attenuated vaccines provide suboptimal cross-protection.. Interleukin18 (IL-18), a multifunctional pro-inflammatory cytokine, has potent immunostimulatory effects that can enhance antiviral defense.. In this study, we employed a reverse genetics system to insert the swine IL-18 gene between open reading frame 1b (ORF1b) and open reading frame 2a (ORF2a) of the full-length cDNA clone of the attenuated PRRSV strain pHuN4-F112, generating the recombinant virus rPRRSV-IL18. Article Title: In vivo DNA damage protection during cell migration across confining embryonic tissue environments. Article Snippet: The cmlc2EGFP expression cassette was amplified from pDestTol2CG2 (refs. 101,102) using the primers 5′-CATCATGGTACCAAAGCTTAAATCAGTTGT-3′ and 5′-ATGATGGG TACCTTACTTGTACAGCTCGTC-3′, and inserted into the Kpn I site of 14xUAS-BGI-nucEmGFP-POUT using T4 DNA ligase (Promega). .. To generate the UAS-cGASa-EGFP plasmid, Danio Rerio cGASa was amplified by PCR from pEGFPN1-cGASa-EGFP (ref. 103) using the primers 5′-CTGGGCAACGTGGAATTCGATATCATGAGCAGCCACAG GAGACCAG-3′ and 5′- GGTGGCTGAGACTTAATTACTAGTTTACTTGTA CAGCTCGTCCATGCC-3′, then inserted into a pTol1-UAS-nls-emGFP plasmid backbone linearized with Article Title: Disruption of the LRRK2 substrate RAB12 facilitates neurotransmission and causes hyperactivity in mice. Article Snippet: Constructs were assembled using the NEBuilder® HiFi DNA Assembly Kit (NEB, #E2621L) to generate AAV-hSyn-mCherry-GSTIRES-tTA and AAV-hSyn-mCherry-Rab12-IRES-tTA. .. To generate AAV-TRE-vGLUT1pHluorin, DNA fragments encoding fDIO-GFP-IRES-tTA were excised from the AAV-TREfDIO-GFP-IRES-tTA plasmid (Addgene, #118026) using EcoRI and Article Title: Enzymatically controlled release of proteins and peptides: A promising, alternative secretion approach Article Snippet: .. Inserts were isolated by restriction from the gene synthesis vector with Sequencing:Article Title: Deciphering the functional roles of glutaredoxin 1 in chub mackerel (Scomber japonicus): implications for antioxidant defense and immune responses Article Snippet: .. Recombinant expression vector construction The Sjgrx1 coding sequence was amplified using PCR using primers with EcoRI and Amplification:Article Title: Deciphering the functional roles of glutaredoxin 1 in chub mackerel (Scomber japonicus): implications for antioxidant defense and immune responses Article Snippet: .. Recombinant expression vector construction The Sjgrx1 coding sequence was amplified using PCR using primers with EcoRI and Article Title: In vivo DNA damage protection during cell migration across confining embryonic tissue environments. Article Snippet: The cmlc2EGFP expression cassette was amplified from pDestTol2CG2 (refs. 101,102) using the primers 5′-CATCATGGTACCAAAGCTTAAATCAGTTGT-3′ and 5′-ATGATGGG TACCTTACTTGTACAGCTCGTC-3′, and inserted into the Kpn I site of 14xUAS-BGI-nucEmGFP-POUT using T4 DNA ligase (Promega). .. To generate the UAS-cGASa-EGFP plasmid, Danio Rerio cGASa was amplified by PCR from pEGFPN1-cGASa-EGFP (ref. 103) using the primers 5′-CTGGGCAACGTGGAATTCGATATCATGAGCAGCCACAG GAGACCAG-3′ and 5′- GGTGGCTGAGACTTAATTACTAGTTTACTTGTA CAGCTCGTCCATGCC-3′, then inserted into a pTol1-UAS-nls-emGFP plasmid backbone linearized with Article Title: Disruption of the LRRK2 substrate RAB12 facilitates neurotransmission and causes hyperactivity in mice. Article Snippet: Constructs were assembled using the NEBuilder® HiFi DNA Assembly Kit (NEB, #E2621L) to generate AAV-hSyn-mCherry-GSTIRES-tTA and AAV-hSyn-mCherry-Rab12-IRES-tTA. .. To generate AAV-TRE-vGLUT1pHluorin, DNA fragments encoding fDIO-GFP-IRES-tTA were excised from the AAV-TREfDIO-GFP-IRES-tTA plasmid (Addgene, #118026) using EcoRI and Polymerase Chain Reaction:Article Title: Deciphering the functional roles of glutaredoxin 1 in chub mackerel (Scomber japonicus): implications for antioxidant defense and immune responses Article Snippet: .. Recombinant expression vector construction The Sjgrx1 coding sequence was amplified using PCR using primers with EcoRI and Article Title: In vivo DNA damage protection during cell migration across confining embryonic tissue environments. Article Snippet: The cmlc2EGFP expression cassette was amplified from pDestTol2CG2 (refs. 101,102) using the primers 5′-CATCATGGTACCAAAGCTTAAATCAGTTGT-3′ and 5′-ATGATGGG TACCTTACTTGTACAGCTCGTC-3′, and inserted into the Kpn I site of 14xUAS-BGI-nucEmGFP-POUT using T4 DNA ligase (Promega). .. To generate the UAS-cGASa-EGFP plasmid, Danio Rerio cGASa was amplified by PCR from pEGFPN1-cGASa-EGFP (ref. 103) using the primers 5′-CTGGGCAACGTGGAATTCGATATCATGAGCAGCCACAG GAGACCAG-3′ and 5′- GGTGGCTGAGACTTAATTACTAGTTTACTTGTA CAGCTCGTCCATGCC-3′, then inserted into a pTol1-UAS-nls-emGFP plasmid backbone linearized with Article Title: WEE1 opposes APC/C CDH1 activity to promote S phase entry. Article Snippet: .. All PCR products were run on 0.8% TBE agarose gels, and bands were gel extracted and assembled into Activity Assay:Article Title: The interplay between supercoiling and DNA modifying enzymes at the single-molecule level. Article Snippet: The reaction product was then purified using anti-flag magnetic beads (Sigma-Aldrich). .. Enzyme purity was confirmed by SDSPAGE and activity tests confirmed that the fluorescently labelled Construct:Article Title: Stable expression of Interleukin-18 in a live-attenuated PRRSV backbone confers safe and potent immune protection in pigs. Article Snippet: Porcine reproductive and respiratory syndrome virus (PRRSV) is a major swine pathogen responsible for substantial economic losses, and current live-attenuated vaccines provide suboptimal cross-protection.. Interleukin18 (IL-18), a multifunctional pro-inflammatory cytokine, has potent immunostimulatory effects that can enhance antiviral defense.. In this study, we employed a reverse genetics system to insert the swine IL-18 gene between open reading frame 1b (ORF1b) and open reading frame 2a (ORF2a) of the full-length cDNA clone of the attenuated PRRSV strain pHuN4-F112, generating the recombinant virus rPRRSV-IL18. Molecular Cloning:Article Title: In vivo DNA damage protection during cell migration across confining embryonic tissue environments. Article Snippet: The cmlc2EGFP expression cassette was amplified from pDestTol2CG2 (refs. 101,102) using the primers 5′-CATCATGGTACCAAAGCTTAAATCAGTTGT-3′ and 5′-ATGATGGG TACCTTACTTGTACAGCTCGTC-3′, and inserted into the Kpn I site of 14xUAS-BGI-nucEmGFP-POUT using T4 DNA ligase (Promega). .. To generate the UAS-cGASa-EGFP plasmid, Danio Rerio cGASa was amplified by PCR from pEGFPN1-cGASa-EGFP (ref. 103) using the primers 5′-CTGGGCAACGTGGAATTCGATATCATGAGCAGCCACAG GAGACCAG-3′ and 5′- GGTGGCTGAGACTTAATTACTAGTTTACTTGTA CAGCTCGTCCATGCC-3′, then inserted into a pTol1-UAS-nls-emGFP plasmid backbone linearized with Cloning:Article Title: In vivo DNA damage protection during cell migration across confining embryonic tissue environments. Article Snippet: The cmlc2EGFP expression cassette was amplified from pDestTol2CG2 (refs. 101,102) using the primers 5′-CATCATGGTACCAAAGCTTAAATCAGTTGT-3′ and 5′-ATGATGGG TACCTTACTTGTACAGCTCGTC-3′, and inserted into the Kpn I site of 14xUAS-BGI-nucEmGFP-POUT using T4 DNA ligase (Promega). .. To generate the UAS-cGASa-EGFP plasmid, Danio Rerio cGASa was amplified by PCR from pEGFPN1-cGASa-EGFP (ref. 103) using the primers 5′-CTGGGCAACGTGGAATTCGATATCATGAGCAGCCACAG GAGACCAG-3′ and 5′- GGTGGCTGAGACTTAATTACTAGTTTACTTGTA CAGCTCGTCCATGCC-3′, then inserted into a pTol1-UAS-nls-emGFP plasmid backbone linearized with Bioprocessing:Article Title: Disruption of the LRRK2 substrate RAB12 facilitates neurotransmission and causes hyperactivity in mice. Article Snippet: Constructs were assembled using the NEBuilder® HiFi DNA Assembly Kit (NEB, #E2621L) to generate AAV-hSyn-mCherry-GSTIRES-tTA and AAV-hSyn-mCherry-Rab12-IRES-tTA. .. To generate AAV-TRE-vGLUT1pHluorin, DNA fragments encoding fDIO-GFP-IRES-tTA were excised from the AAV-TREfDIO-GFP-IRES-tTA plasmid (Addgene, #118026) using EcoRI and Isolation:Article Title: Enzymatically controlled release of proteins and peptides: A promising, alternative secretion approach Article Snippet: .. Inserts were isolated by restriction from the gene synthesis vector with Gibson Assembly:Article Title: WEE1 opposes APC/C CDH1 activity to promote S phase entry. Article Snippet: .. All PCR products were run on 0.8% TBE agarose gels, and bands were gel extracted and assembled into |