|
Proteintech
resource source identifier antibodies rabbit polyclonal anti vwa2 proteintech Resource Source Identifier Antibodies Rabbit Polyclonal Anti Vwa2 Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/source/VWA2+Antibody/pm42835275-143-2-9 Average 93 stars, based on 1 article reviews
resource source identifier antibodies rabbit polyclonal anti vwa2 proteintech - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
resource source identifier antibodies anti pc1 santa cruz biotechnology Resource Source Identifier Antibodies Anti Pc1 Santa Cruz Biotechnology, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/source/Polycystin-1+Antibody/pm42834985-1062-2-7 Average 93 stars, based on 1 article reviews
resource source identifier antibodies anti pc1 santa cruz biotechnology - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
resource source identifier antibodies mouse monoclonal anti asc santa cruz Resource Source Identifier Antibodies Mouse Monoclonal Anti Asc Santa Cruz, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/source/ASC+Antibody/10__1016_slash_j__isci__2026__117743-137-5-12 Average 96 stars, based on 1 article reviews
resource source identifier antibodies mouse monoclonal anti asc santa cruz - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
resource source identifier antibodies anti hsf1 santa cruz biotechnology Resource Source Identifier Antibodies Anti Hsf1 Santa Cruz Biotechnology, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/source/HSF1+Antibody/pm42831021-386-2-7 Average 94 stars, based on 1 article reviews
resource source identifier antibodies anti hsf1 santa cruz biotechnology - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Shimadzu Corporation
electrospray ionization esi ion source Electrospray Ionization Esi Ion Source, supplied by Shimadzu Corporation, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/source/LCMS-8045/pm42827133-461-9-15 Average 97 stars, based on 1 article reviews
electrospray ionization esi ion source - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
resource source identifier antibodies anti β actin antibody santa cruz biotechnology rrid ab 626632 Resource Source Identifier Antibodies Anti β Actin Antibody Santa Cruz Biotechnology Rrid Ab 626632, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/source/%CE%B2-Actin+Antibody/pm42822446-294-2-8 Average 96 stars, based on 1 article reviews
resource source identifier antibodies anti β actin antibody santa cruz biotechnology rrid ab 626632 - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
MedChemExpress
resource source identifier antibodies neun medchemexpress Resource Source Identifier Antibodies Neun Medchemexpress, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/source/NeuN+Antibody/pm42546689-266-2-7 Average 94 stars, based on 1 article reviews
resource source identifier antibodies neun medchemexpress - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Bio-Rad
resource source identifier iscript cdna synthesis biorad Resource Source Identifier Iscript Cdna Synthesis Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/source/IScript+C+DNA+Synthesis+Kit/pm42815461-276-2-8 Average 99 stars, based on 1 article reviews
resource source identifier iscript cdna synthesis biorad - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
|
OriGene
rt qpcr primer sequence source ctrr3 for cggcctctccttctgtatgc Rt Qpcr Primer Sequence Source Ctrr3 For Cggcctctccttctgtatgc, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/source/Primer/pm42816552-656-14-34 Average 97 stars, based on 1 article reviews
rt qpcr primer sequence source ctrr3 for cggcctctccttctgtatgc - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
Xenocs Inc
micro focus genix 3d x ray source Micro Focus Genix 3d X Ray Source, supplied by Xenocs Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/source/GeniX3D/10__3390_slash_batteries12100385-93-6-7 Average 97 stars, based on 1 article reviews
micro focus genix 3d x ray source - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |