Review



genbank data base  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc genbank data base

    Genbank Data Base, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+based+on+the+contin+algorithm/BRD4+(LONG+ISOFORM)_pLX307+(Plasmid+%2398318)/pmc09617197-176-28-41
    Average 93 stars, based on 25 article reviews
    genbank data base - by Bioz Stars, 2026-09
    93/100 stars

    Images

    1) Product Images from "Cloning BRD4 long isoform into overexpression vectors for stable overexpression of BRD4-L in mammalian cells"

    Article Title: Cloning BRD4 long isoform into overexpression vectors for stable overexpression of BRD4-L in mammalian cells

    Journal: STAR Protocols

    doi: 10.1016/j.xpro.2022.101785


    Figure Legend Snippet:

    Techniques Used: Virus, Recombinant, Cloning, Gel Extraction, Plasmid Preparation, Sequencing, Over Expression, Expressing, Software, Imaging

    Related Articles

    Mutagenesis:

    Article Title: BRD4 binds to active cranial neural crest enhancers to regulate RUNX2 activity during osteoblast differentiation.
    Article Snippet: O9-1 cranial neural crest cells were maintained in culture as described (Ishii et al. 2012) and grown on Matrigel coated plates (Corning 356234 or Biotechne 3432-005-01). .. To create D ev el o pm en t • A cc ep te d m an us cr ip t BRD4 mutant lines, O9-1 cells were transfected with LentiCRISPRv2GFP (Addgene #82416 (Walter et al. 2017)) containing gRNA (TGTCTACGGAGAGCGGCCCT) targeting exon 3 and were single cell sorted based on GFP fluorescence into 96 well plates. ..

    Transfection:

    Article Title: BRD4 binds to active cranial neural crest enhancers to regulate RUNX2 activity during osteoblast differentiation.
    Article Snippet: O9-1 cranial neural crest cells were maintained in culture as described (Ishii et al. 2012) and grown on Matrigel coated plates (Corning 356234 or Biotechne 3432-005-01). .. To create D ev el o pm en t • A cc ep te d m an us cr ip t BRD4 mutant lines, O9-1 cells were transfected with LentiCRISPRv2GFP (Addgene #82416 (Walter et al. 2017)) containing gRNA (TGTCTACGGAGAGCGGCCCT) targeting exon 3 and were single cell sorted based on GFP fluorescence into 96 well plates. ..

    Single Cell:

    Article Title: BRD4 binds to active cranial neural crest enhancers to regulate RUNX2 activity during osteoblast differentiation.
    Article Snippet: O9-1 cranial neural crest cells were maintained in culture as described (Ishii et al. 2012) and grown on Matrigel coated plates (Corning 356234 or Biotechne 3432-005-01). .. To create D ev el o pm en t • A cc ep te d m an us cr ip t BRD4 mutant lines, O9-1 cells were transfected with LentiCRISPRv2GFP (Addgene #82416 (Walter et al. 2017)) containing gRNA (TGTCTACGGAGAGCGGCCCT) targeting exon 3 and were single cell sorted based on GFP fluorescence into 96 well plates. ..

    Fluorescence:

    Article Title: BRD4 binds to active cranial neural crest enhancers to regulate RUNX2 activity during osteoblast differentiation.
    Article Snippet: O9-1 cranial neural crest cells were maintained in culture as described (Ishii et al. 2012) and grown on Matrigel coated plates (Corning 356234 or Biotechne 3432-005-01). .. To create D ev el o pm en t • A cc ep te d m an us cr ip t BRD4 mutant lines, O9-1 cells were transfected with LentiCRISPRv2GFP (Addgene #82416 (Walter et al. 2017)) containing gRNA (TGTCTACGGAGAGCGGCCCT) targeting exon 3 and were single cell sorted based on GFP fluorescence into 96 well plates. ..

    Amplification:

    Article Title: Identification of a SNAI1 enhancer RNA that drives cancer cell plasticity.
    Article Snippet: The inducible vector for SNAI1 ectopic expression was generated Nature Communications | (2025) 16:2890 11 using Gateway cloning into the pLIX-403 vector (Addgene; 41395). .. BRD4 truncation mutants were amplified by PCR from pcDNA5-Flag-BRD4-WT (Addgene; 90331) and inserted into thepCDNA3.1-FLAGvector. .. CRISPRa, CRISPRi, and Cas13d gRNAs were inserted into the lentiviral vectors lenti sgRNA(MS2)_puro optimized backbone (Addgene; 73797), pLKO.1-U6PURO-AA19 (kindly provided by Dr. M.A.F.V.

    Article Title: Increased expression of BRD4 isoforms long (BRD4-L) and short (BRD4-S) promotes chemotherapy resistance in high-grade serous ovarian carcinoma
    Article Snippet: .. The BRD4-L and BRD4-S DNA sequences were amplified via polymerase chain reaction (PCR) and cloned into LentiV_Blast (Addgene, #111887; [ ]) overexpression plasmid, with the use of Cold Fusion cloning kit (System Biosciences, cat. #MC010A-1). ..

    Polymerase Chain Reaction:

    Article Title: Identification of a SNAI1 enhancer RNA that drives cancer cell plasticity.
    Article Snippet: The inducible vector for SNAI1 ectopic expression was generated Nature Communications | (2025) 16:2890 11 using Gateway cloning into the pLIX-403 vector (Addgene; 41395). .. BRD4 truncation mutants were amplified by PCR from pcDNA5-Flag-BRD4-WT (Addgene; 90331) and inserted into thepCDNA3.1-FLAGvector. .. CRISPRa, CRISPRi, and Cas13d gRNAs were inserted into the lentiviral vectors lenti sgRNA(MS2)_puro optimized backbone (Addgene; 73797), pLKO.1-U6PURO-AA19 (kindly provided by Dr. M.A.F.V.

    Article Title: Increased expression of BRD4 isoforms long (BRD4-L) and short (BRD4-S) promotes chemotherapy resistance in high-grade serous ovarian carcinoma
    Article Snippet: .. The BRD4-L and BRD4-S DNA sequences were amplified via polymerase chain reaction (PCR) and cloned into LentiV_Blast (Addgene, #111887; [ ]) overexpression plasmid, with the use of Cold Fusion cloning kit (System Biosciences, cat. #MC010A-1). ..

    shRNA:

    Article Title: Identification of a SNAI1 enhancer RNA that drives cancer cell plasticity
    Article Snippet: .. We used shRNA constructs from Sigma‒Aldrich for gene knockdown: TRCN0000040031 for SMAD4 knockdown, TRCN0000199427 (#1) and TRCN0000318771 (#2) for BRD4 knockdown, and TRCN0000063819 for SNAI1 knockdown. lenti-dCAS-VP64_Blast (Addgene; 61425) and lenti-MS2-P65-HSF1_Hygro (Addgene; 61426) were used for the generation of CRISPRa stable cells. pHR-SFFV-dCas9-BFP-KRAB (Addgene; 46911) and pXR001: EF1a-CasRx-2A-EGFP (Addgene; 109049) were used for the generation of CRISPRi and CRISPR/Cas13d stable cells, respectively. .. A final concentration of 25 nM scramble GapmeR (UGGGCGUAUAGACGUGUUACAC) or GapmeR targeting SNAI1e (UGCAUCUGGACAGGGGUCUU) was transfected using lipofectamine 3000 (Thermo Fisher Scientific; L3000015).

    Construct:

    Article Title: Identification of a SNAI1 enhancer RNA that drives cancer cell plasticity
    Article Snippet: .. We used shRNA constructs from Sigma‒Aldrich for gene knockdown: TRCN0000040031 for SMAD4 knockdown, TRCN0000199427 (#1) and TRCN0000318771 (#2) for BRD4 knockdown, and TRCN0000063819 for SNAI1 knockdown. lenti-dCAS-VP64_Blast (Addgene; 61425) and lenti-MS2-P65-HSF1_Hygro (Addgene; 61426) were used for the generation of CRISPRa stable cells. pHR-SFFV-dCas9-BFP-KRAB (Addgene; 46911) and pXR001: EF1a-CasRx-2A-EGFP (Addgene; 109049) were used for the generation of CRISPRi and CRISPR/Cas13d stable cells, respectively. .. A final concentration of 25 nM scramble GapmeR (UGGGCGUAUAGACGUGUUACAC) or GapmeR targeting SNAI1e (UGCAUCUGGACAGGGGUCUU) was transfected using lipofectamine 3000 (Thermo Fisher Scientific; L3000015).

    Knockdown:

    Article Title: Identification of a SNAI1 enhancer RNA that drives cancer cell plasticity
    Article Snippet: .. We used shRNA constructs from Sigma‒Aldrich for gene knockdown: TRCN0000040031 for SMAD4 knockdown, TRCN0000199427 (#1) and TRCN0000318771 (#2) for BRD4 knockdown, and TRCN0000063819 for SNAI1 knockdown. lenti-dCAS-VP64_Blast (Addgene; 61425) and lenti-MS2-P65-HSF1_Hygro (Addgene; 61426) were used for the generation of CRISPRa stable cells. pHR-SFFV-dCas9-BFP-KRAB (Addgene; 46911) and pXR001: EF1a-CasRx-2A-EGFP (Addgene; 109049) were used for the generation of CRISPRi and CRISPR/Cas13d stable cells, respectively. .. A final concentration of 25 nM scramble GapmeR (UGGGCGUAUAGACGUGUUACAC) or GapmeR targeting SNAI1e (UGCAUCUGGACAGGGGUCUU) was transfected using lipofectamine 3000 (Thermo Fisher Scientific; L3000015).

    CRISPR:

    Article Title: Identification of a SNAI1 enhancer RNA that drives cancer cell plasticity
    Article Snippet: .. We used shRNA constructs from Sigma‒Aldrich for gene knockdown: TRCN0000040031 for SMAD4 knockdown, TRCN0000199427 (#1) and TRCN0000318771 (#2) for BRD4 knockdown, and TRCN0000063819 for SNAI1 knockdown. lenti-dCAS-VP64_Blast (Addgene; 61425) and lenti-MS2-P65-HSF1_Hygro (Addgene; 61426) were used for the generation of CRISPRa stable cells. pHR-SFFV-dCas9-BFP-KRAB (Addgene; 46911) and pXR001: EF1a-CasRx-2A-EGFP (Addgene; 109049) were used for the generation of CRISPRi and CRISPR/Cas13d stable cells, respectively. .. A final concentration of 25 nM scramble GapmeR (UGGGCGUAUAGACGUGUUACAC) or GapmeR targeting SNAI1e (UGCAUCUGGACAGGGGUCUU) was transfected using lipofectamine 3000 (Thermo Fisher Scientific; L3000015).

    Cloning:

    Article Title: The BRD4–NUT Fusion Alone Drives Malignant Transformation of NUT Carcinoma
    Article Snippet: Estimates of IC50 were calculated by logistic regression (GraphPad Prism). .. Plasmids, cloning, and viral transduction pInducer20 blast blast-N-BRD4-NUT-C-HA lentiviral plasmidwas created by Gibson assembly of gBlocks (synthesized by Integrated DNA Technologies, Inc.; IDT) of the BRD4–NUT coding sequence into pInducer20 blast (Addgene #109334) using Gateway LR Clonase II Enzyme Mix according to the manufacturer’s instructions (Thermo Fisher Scientific). .. To create lentivirus, 293T cells were transfected with vector DNA, pRev, pTat, pHIV Gag/pol, and pVSVG by transfection using Lipofectamine 2000 (Invitrogen).

    Article Title: Increased expression of BRD4 isoforms long (BRD4-L) and short (BRD4-S) promotes chemotherapy resistance in high-grade serous ovarian carcinoma
    Article Snippet: .. The BRD4-L and BRD4-S DNA sequences were amplified via polymerase chain reaction (PCR) and cloned into LentiV_Blast (Addgene, #111887; [ ]) overexpression plasmid, with the use of Cold Fusion cloning kit (System Biosciences, cat. #MC010A-1). ..

    Transduction:

    Article Title: The BRD4–NUT Fusion Alone Drives Malignant Transformation of NUT Carcinoma
    Article Snippet: Estimates of IC50 were calculated by logistic regression (GraphPad Prism). .. Plasmids, cloning, and viral transduction pInducer20 blast blast-N-BRD4-NUT-C-HA lentiviral plasmidwas created by Gibson assembly of gBlocks (synthesized by Integrated DNA Technologies, Inc.; IDT) of the BRD4–NUT coding sequence into pInducer20 blast (Addgene #109334) using Gateway LR Clonase II Enzyme Mix according to the manufacturer’s instructions (Thermo Fisher Scientific). .. To create lentivirus, 293T cells were transfected with vector DNA, pRev, pTat, pHIV Gag/pol, and pVSVG by transfection using Lipofectamine 2000 (Invitrogen).

    Synthesized:

    Article Title: The BRD4–NUT Fusion Alone Drives Malignant Transformation of NUT Carcinoma
    Article Snippet: Estimates of IC50 were calculated by logistic regression (GraphPad Prism). .. Plasmids, cloning, and viral transduction pInducer20 blast blast-N-BRD4-NUT-C-HA lentiviral plasmidwas created by Gibson assembly of gBlocks (synthesized by Integrated DNA Technologies, Inc.; IDT) of the BRD4–NUT coding sequence into pInducer20 blast (Addgene #109334) using Gateway LR Clonase II Enzyme Mix according to the manufacturer’s instructions (Thermo Fisher Scientific). .. To create lentivirus, 293T cells were transfected with vector DNA, pRev, pTat, pHIV Gag/pol, and pVSVG by transfection using Lipofectamine 2000 (Invitrogen).

    Sequencing:

    Article Title: The BRD4–NUT Fusion Alone Drives Malignant Transformation of NUT Carcinoma
    Article Snippet: Estimates of IC50 were calculated by logistic regression (GraphPad Prism). .. Plasmids, cloning, and viral transduction pInducer20 blast blast-N-BRD4-NUT-C-HA lentiviral plasmidwas created by Gibson assembly of gBlocks (synthesized by Integrated DNA Technologies, Inc.; IDT) of the BRD4–NUT coding sequence into pInducer20 blast (Addgene #109334) using Gateway LR Clonase II Enzyme Mix according to the manufacturer’s instructions (Thermo Fisher Scientific). .. To create lentivirus, 293T cells were transfected with vector DNA, pRev, pTat, pHIV Gag/pol, and pVSVG by transfection using Lipofectamine 2000 (Invitrogen).

    Clone Assay:

    Article Title: Increased expression of BRD4 isoforms long (BRD4-L) and short (BRD4-S) promotes chemotherapy resistance in high-grade serous ovarian carcinoma
    Article Snippet: .. The BRD4-L and BRD4-S DNA sequences were amplified via polymerase chain reaction (PCR) and cloned into LentiV_Blast (Addgene, #111887; [ ]) overexpression plasmid, with the use of Cold Fusion cloning kit (System Biosciences, cat. #MC010A-1). ..

    Article Title: Solid phase transitions as a solution to the genome folding paradox.
    Article Snippet: Ultra-long-range genomic contacts, which are key components of neuronal genome architecture, constitute a biochemical enigma.. This is because regulatory DNA elements make selective and stable contacts with DNA sequences located hundreds of kilobases away, instead of interacting with proximal sequences occupied by the exact same transcription factors.. This is exemplified in olfactory sensory neurons (OSNs), in which only a fraction of LHX2-, EBF1and LDB1-bound sites interact with each other, converging into highly selective multi-chromosomal enhancer hubs.

    Over Expression:

    Article Title: Increased expression of BRD4 isoforms long (BRD4-L) and short (BRD4-S) promotes chemotherapy resistance in high-grade serous ovarian carcinoma
    Article Snippet: .. The BRD4-L and BRD4-S DNA sequences were amplified via polymerase chain reaction (PCR) and cloned into LentiV_Blast (Addgene, #111887; [ ]) overexpression plasmid, with the use of Cold Fusion cloning kit (System Biosciences, cat. #MC010A-1). ..

    Plasmid Preparation:

    Article Title: Increased expression of BRD4 isoforms long (BRD4-L) and short (BRD4-S) promotes chemotherapy resistance in high-grade serous ovarian carcinoma
    Article Snippet: .. The BRD4-L and BRD4-S DNA sequences were amplified via polymerase chain reaction (PCR) and cloned into LentiV_Blast (Addgene, #111887; [ ]) overexpression plasmid, with the use of Cold Fusion cloning kit (System Biosciences, cat. #MC010A-1). ..

    Article Title: Solid phase transitions as a solution to the genome folding paradox.
    Article Snippet: Ultra-long-range genomic contacts, which are key components of neuronal genome architecture, constitute a biochemical enigma.. This is because regulatory DNA elements make selective and stable contacts with DNA sequences located hundreds of kilobases away, instead of interacting with proximal sequences occupied by the exact same transcription factors.. This is exemplified in olfactory sensory neurons (OSNs), in which only a fraction of LHX2-, EBF1and LDB1-bound sites interact with each other, converging into highly selective multi-chromosomal enhancer hubs.



    Similar Products

    90
    Provencher Inc software based on the contin algorithm
    Software Based On The Contin Algorithm, supplied by Provencher Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+based+on+the+contin+algorithm/contin+software/pmc10344913-101-8-11
    Average 90 stars, based on 1 article reviews
    software based on the contin algorithm - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Provencher Inc software package based on the contin algorithm
    Software Package Based On The Contin Algorithm, supplied by Provencher Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+based+on+the+contin+algorithm/contin+software/pmc03944685-85-33-35
    Average 90 stars, based on 1 article reviews
    software package based on the contin algorithm - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    ALV GmbH software package based on the contin algorithm
    Software Package Based On The Contin Algorithm, supplied by ALV GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+based+on+the+contin+algorithm/contin+software/pmc01697867-55-36-32
    Average 90 stars, based on 1 article reviews
    software package based on the contin algorithm - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results