Review



algorithms graphpad prism 9 4 158 graphpad software  (Stratedigm Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Stratedigm Inc algorithms graphpad prism 9 4 158 graphpad software
    Algorithms Graphpad Prism 9 4 158 Graphpad Software, supplied by Stratedigm Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software%2C+algorithm+prism+9/pm39657661-252-75-111
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism 9 4 158 graphpad software - by Bioz Stars, 2026-09
    86/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Ongoing evolution of SARS-CoV-2 drives escape from mRNA vaccine-induced humoral immunity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains DH5a Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USBTM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo DNase Fisher Cat# AM2239 Recombinant Human ACE-2 His-tag Alexa Fluor 647 Protein R&D Systems Cat# AFR933 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A Oligonucleotides Lentivirus LTR qPCR Probe/56-FAM/ AGC+C/i5NitInd/GG + GA/ZEN/GCT CTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Plasmid ID 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Plasmid ID 179906 pTwist-SARS-CoV-2 Spike-DC18 A222V (GTG) This study Addgene Plasmid ID 212329 pTwist-SARS-CoV-2 Spike-DC18 D253G (GGC) This study Addgene Plasmid ID 212330 (Continued on next page) Cell Reports Medicine 5, 101850, December 17, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pTwist-SARS-CoV-2 Spike-DC18 HK.3 This study Addgene Plasmid ID 212572 pTwist-SARS-CoV-2 Spike-DC18 BA.2.86 This study Addgene Plasmid ID 212538 pTwist-SARS-CoV-2 Spike-DC18 JN.1 This study Addgene Plasmid ID 216526 pTwist-SARS-CoV-2 Spike-DC18 KP.2 This study Addgene Plasmid ID 223273 pTwist-SARS-CoV-2 Spike-DC18 KP.3 This study Addgene Plasmid ID 223276 pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automationworkstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/ windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/ en/home/global/forms/quantstudio12k-flex-software-download.html OPEN ACCESS ..

    Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER 293T/hDPP4 This study N/A 293T/hANPEP This study N/A Oligonucleotides Lentivirus LTR qPCR Probe/56FAM/AGC+C/i5NitInd/GG + GA/ZEN/ GCTCTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 5 ′ Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 3 ′ Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology NA Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 Δ18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 Δ18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 Δ18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 Spike-ΔC18 BA.5 This study Addgene Plasmid ID 212505 pTwist-SARS-CoV Spike-ΔC18 This study Addgene Plasmid ID 169465 pTwist-WIV1 Spike-ΔC18 This study Addgene Plasmid ID 164439 pTwist-NL63 Spike-ΔC17 This study N/A pTwist-229E Spike-ΔC15 This study N/A pTwist-MERS Spike-ΔC15 This study N/A pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific-software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/fluent-laboratory- automation-workstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/home/ global/forms/quantstudio-12k-flexsoftware-download.html Cell Reports 45, 116954, February 24, 2026 13 dose 8–9 months after the primary vaccination series, their second booster 4 to 6 months after their first booster and third booster 4 to 7 months after their second booster. ..

    Software:

    Article Title: Ongoing evolution of SARS-CoV-2 drives escape from mRNA vaccine-induced humoral immunity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains DH5a Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USBTM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo DNase Fisher Cat# AM2239 Recombinant Human ACE-2 His-tag Alexa Fluor 647 Protein R&D Systems Cat# AFR933 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A Oligonucleotides Lentivirus LTR qPCR Probe/56-FAM/ AGC+C/i5NitInd/GG + GA/ZEN/GCT CTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Plasmid ID 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Plasmid ID 179906 pTwist-SARS-CoV-2 Spike-DC18 A222V (GTG) This study Addgene Plasmid ID 212329 pTwist-SARS-CoV-2 Spike-DC18 D253G (GGC) This study Addgene Plasmid ID 212330 (Continued on next page) Cell Reports Medicine 5, 101850, December 17, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pTwist-SARS-CoV-2 Spike-DC18 HK.3 This study Addgene Plasmid ID 212572 pTwist-SARS-CoV-2 Spike-DC18 BA.2.86 This study Addgene Plasmid ID 212538 pTwist-SARS-CoV-2 Spike-DC18 JN.1 This study Addgene Plasmid ID 216526 pTwist-SARS-CoV-2 Spike-DC18 KP.2 This study Addgene Plasmid ID 223273 pTwist-SARS-CoV-2 Spike-DC18 KP.3 This study Addgene Plasmid ID 223276 pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automationworkstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/ windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/ en/home/global/forms/quantstudio12k-flex-software-download.html OPEN ACCESS ..

    Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER 293T/hDPP4 This study N/A 293T/hANPEP This study N/A Oligonucleotides Lentivirus LTR qPCR Probe/56FAM/AGC+C/i5NitInd/GG + GA/ZEN/ GCTCTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 5 ′ Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 3 ′ Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology NA Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 Δ18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 Δ18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 Δ18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 Spike-ΔC18 BA.5 This study Addgene Plasmid ID 212505 pTwist-SARS-CoV Spike-ΔC18 This study Addgene Plasmid ID 169465 pTwist-WIV1 Spike-ΔC18 This study Addgene Plasmid ID 164439 pTwist-NL63 Spike-ΔC17 This study N/A pTwist-229E Spike-ΔC15 This study N/A pTwist-MERS Spike-ΔC15 This study N/A pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific-software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/fluent-laboratory- automation-workstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/home/ global/forms/quantstudio-12k-flexsoftware-download.html Cell Reports 45, 116954, February 24, 2026 13 dose 8–9 months after the primary vaccination series, their second booster 4 to 6 months after their first booster and third booster 4 to 7 months after their second booster. ..

    Control:

    Article Title: Ongoing evolution of SARS-CoV-2 drives escape from mRNA vaccine-induced humoral immunity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains DH5a Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USBTM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo DNase Fisher Cat# AM2239 Recombinant Human ACE-2 His-tag Alexa Fluor 647 Protein R&D Systems Cat# AFR933 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A Oligonucleotides Lentivirus LTR qPCR Probe/56-FAM/ AGC+C/i5NitInd/GG + GA/ZEN/GCT CTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Plasmid ID 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Plasmid ID 179906 pTwist-SARS-CoV-2 Spike-DC18 A222V (GTG) This study Addgene Plasmid ID 212329 pTwist-SARS-CoV-2 Spike-DC18 D253G (GGC) This study Addgene Plasmid ID 212330 (Continued on next page) Cell Reports Medicine 5, 101850, December 17, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pTwist-SARS-CoV-2 Spike-DC18 HK.3 This study Addgene Plasmid ID 212572 pTwist-SARS-CoV-2 Spike-DC18 BA.2.86 This study Addgene Plasmid ID 212538 pTwist-SARS-CoV-2 Spike-DC18 JN.1 This study Addgene Plasmid ID 216526 pTwist-SARS-CoV-2 Spike-DC18 KP.2 This study Addgene Plasmid ID 223273 pTwist-SARS-CoV-2 Spike-DC18 KP.3 This study Addgene Plasmid ID 223276 pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automationworkstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/ windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/ en/home/global/forms/quantstudio12k-flex-software-download.html OPEN ACCESS ..

    Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER 293T/hDPP4 This study N/A 293T/hANPEP This study N/A Oligonucleotides Lentivirus LTR qPCR Probe/56FAM/AGC+C/i5NitInd/GG + GA/ZEN/ GCTCTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 5 ′ Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 3 ′ Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology NA Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 Δ18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 Δ18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 Δ18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 Spike-ΔC18 BA.5 This study Addgene Plasmid ID 212505 pTwist-SARS-CoV Spike-ΔC18 This study Addgene Plasmid ID 169465 pTwist-WIV1 Spike-ΔC18 This study Addgene Plasmid ID 164439 pTwist-NL63 Spike-ΔC17 This study N/A pTwist-229E Spike-ΔC15 This study N/A pTwist-MERS Spike-ΔC15 This study N/A pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific-software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/fluent-laboratory- automation-workstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/home/ global/forms/quantstudio-12k-flexsoftware-download.html Cell Reports 45, 116954, February 24, 2026 13 dose 8–9 months after the primary vaccination series, their second booster 4 to 6 months after their first booster and third booster 4 to 7 months after their second booster. ..

    Real-time Polymerase Chain Reaction:

    Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER 293T/hDPP4 This study N/A 293T/hANPEP This study N/A Oligonucleotides Lentivirus LTR qPCR Probe/56FAM/AGC+C/i5NitInd/GG + GA/ZEN/ GCTCTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 5 ′ Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 3 ′ Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology NA Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 Δ18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 Δ18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 Δ18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 Spike-ΔC18 BA.5 This study Addgene Plasmid ID 212505 pTwist-SARS-CoV Spike-ΔC18 This study Addgene Plasmid ID 169465 pTwist-WIV1 Spike-ΔC18 This study Addgene Plasmid ID 164439 pTwist-NL63 Spike-ΔC17 This study N/A pTwist-229E Spike-ΔC15 This study N/A pTwist-MERS Spike-ΔC15 This study N/A pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific-software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/fluent-laboratory- automation-workstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/home/ global/forms/quantstudio-12k-flexsoftware-download.html Cell Reports 45, 116954, February 24, 2026 13 dose 8–9 months after the primary vaccination series, their second booster 4 to 6 months after their first booster and third booster 4 to 7 months after their second booster. ..

    Recombinant:

    Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER 293T/hDPP4 This study N/A 293T/hANPEP This study N/A Oligonucleotides Lentivirus LTR qPCR Probe/56FAM/AGC+C/i5NitInd/GG + GA/ZEN/ GCTCTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 5 ′ Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 3 ′ Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology NA Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 Δ18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 Δ18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 Δ18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 Spike-ΔC18 BA.5 This study Addgene Plasmid ID 212505 pTwist-SARS-CoV Spike-ΔC18 This study Addgene Plasmid ID 169465 pTwist-WIV1 Spike-ΔC18 This study Addgene Plasmid ID 164439 pTwist-NL63 Spike-ΔC17 This study N/A pTwist-229E Spike-ΔC15 This study N/A pTwist-MERS Spike-ΔC15 This study N/A pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific-software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/fluent-laboratory- automation-workstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/home/ global/forms/quantstudio-12k-flexsoftware-download.html Cell Reports 45, 116954, February 24, 2026 13 dose 8–9 months after the primary vaccination series, their second booster 4 to 6 months after their first booster and third booster 4 to 7 months after their second booster. ..



    Similar Products

    algorithms graphpad prism 9 4 158 graphpad software  (Stratedigm Inc)
    86
    Stratedigm Inc algorithms graphpad prism 9 4 158 graphpad software
    Algorithms Graphpad Prism 9 4 158 Graphpad Software, supplied by Stratedigm Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software%2C+algorithm+prism+9/pm41632570-215-151-185
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism 9 4 158 graphpad software - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms graphpad prism 9 graphpad software  (Tree Star Inc)
    86
    Tree Star Inc algorithms graphpad prism 9 graphpad software
    Algorithms Graphpad Prism 9 Graphpad Software, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software%2C+algorithm+prism+9/flowjo10/pm41033313-255-211-244
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism 9 graphpad software - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    software, algorithm prism 9  (GraphPad Software Inc)
    90
    GraphPad Software Inc software, algorithm prism 9
    Software, Algorithm Prism 9, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software%2C+algorithm+prism+9/software++algorithm+prism+9/10__7554_slash_elife__101043-161-181-184
    Average 90 stars, based on 1 article reviews
    software, algorithm prism 9 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    software and algorithms graphpad prism 9  (GraphPad Software Inc)
    90
    GraphPad Software Inc software and algorithms graphpad prism 9
    Software And Algorithms Graphpad Prism 9, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software%2C+algorithm+prism+9/graphpad+prism+software/pm40081380-615-26-30
    Average 90 stars, based on 1 article reviews
    software and algorithms graphpad prism 9 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    algorithms imagej imagej fuji fuji imaris imaris graphpad prism 9 graphpad software  (Oxford Instruments)
    99
    Oxford Instruments algorithms imagej imagej fuji fuji imaris imaris graphpad prism 9 graphpad software
    Algorithms Imagej Imagej Fuji Fuji Imaris Imaris Graphpad Prism 9 Graphpad Software, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software%2C+algorithm+prism+9/Imaris/pm40022729-225-91-96
    Average 99 stars, based on 1 article reviews
    algorithms imagej imagej fuji fuji imaris imaris graphpad prism 9 graphpad software - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    algorithms graphpad prism 9 0 software graphpad software  (Tree Star Inc)
    86
    Tree Star Inc algorithms graphpad prism 9 0 software graphpad software
    Algorithms Graphpad Prism 9 0 Software Graphpad Software, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software%2C+algorithm+prism+9/flowjo10/pm39999840-198-48-60
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism 9 0 software graphpad software - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms graphpad prism 9 03 graphpad software  (Obio Technology Corp Ltd)
    86
    Obio Technology Corp Ltd algorithms graphpad prism 9 03 graphpad software
    Algorithms Graphpad Prism 9 03 Graphpad Software, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software%2C+algorithm+prism+9/03+9+algorithms+graphpad+graphpad+prism+software/pm39918960-217-88-82
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism 9 03 graphpad software - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    software, algorithm graphpad prism 9  (GraphPad Software Inc)
    90
    GraphPad Software Inc software, algorithm graphpad prism 9
    Software, Algorithm Graphpad Prism 9, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software%2C+algorithm+prism+9/graphpad+prism+software/10__7554_slash_elife__94168-474-88-89
    Average 90 stars, based on 1 article reviews
    software, algorithm graphpad prism 9 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    algorithms graphpad prism version 9 5 1 graphpad software  (Bio-Rad)
    98
    Bio-Rad algorithms graphpad prism version 9 5 1 graphpad software
    Algorithms Graphpad Prism Version 9 5 1 Graphpad Software, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software%2C+algorithm+prism+9/CFX+Manager+Software/pm39694035-185-97-118
    Average 98 stars, based on 1 article reviews
    algorithms graphpad prism version 9 5 1 graphpad software - by Bioz Stars, 2026-09
    98/100 stars
    		  Buy from Supplier
    software and algorithms graphpad prism version 9  (GraphPad Software Inc)
    90
    GraphPad Software Inc software and algorithms graphpad prism version 9
    Software And Algorithms Graphpad Prism Version 9, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software%2C+algorithm+prism+9/graphpad+prism+software/10__1016_slash_j__isci__2024__111557-187-52-53
    Average 90 stars, based on 1 article reviews
    software and algorithms graphpad prism version 9 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results