Review



smartscribe reverse transcriptase  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    TaKaRa smartscribe reverse transcriptase
    Smartscribe Reverse Transcriptase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1130 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartscribe+reverse+transcriptase/SMARTScribe+Reverse+Transcriptase/pmc13076092-32-22-25
    Average 96 stars, based on 1130 article reviews
    smartscribe reverse transcriptase - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: Induction of multiple HIV-1 neutralizing B Cell Precursors in Humans
    Article Snippet: Briefly, RNA was combined with dNTPs (NEB, Cat. #N0447L), a template-switching oligonucleotide (TSO; containing 5’ padding and a plate-level barcode), and constant-region reverse primers specific for IgG, Igκ, and Igλ. .. Reactions were denatured at 72°C for 3 min, chilled on ice for 2 min, and supplemented with an RT mix containing 5x RT buffer (final 1x), 20 mM DTT (final 2 mM), RNaseOUTTM RNase Inhibitor (Thermo Fisher Scientific, Cat. #10777-019; final 1x), and SMARTScribeTM Reverse Transcriptase (Takara, Cat. #639538). ..

    Article Title: METTL3 mediates m 6 A methylation of ADAM17 to Downregulate ACE2–Ang-(1–7) axis and promote progression of hypertension
    Article Snippet: A minimum of 1 μg total RNA was fragmented with an NEBNext Magnesium RNA fragmentation module (New England Biolabs, Ipswich, MA, USA) by incubating at 94 °C for 5 min. Fragmented RNA, including rRNA, was enriched with m6A antibody–Dynabead complexes through immunoprecipitation. .. Immunoprecipitated RNA was then reverse-transcribed to yield first-strand cDNA via SMARTScribe reverse transcriptase (ClonTech, Japan). ..

    Article Title: Mesenchymal stroma cell-derived stem cell factor mediates cross-species compatibility of the hematopoietic stem cell niche
    Article Snippet: RNA was prepared using the miRNeasy Micro Kit (Qiagen). .. Total RNA was eluted in 10ul and 5ul were used for library preparation for next generation sequencing. cDNA was synthesized from 5 μl total RNA using the SmartScribe reverse transcriptase (Takara Bio, SMARTer HV Kit) with a universally tailed poly-dT primer and a template switching oligo followed by amplification for 12 cycles with the Advantage 2 DNA Polymerase (Takara Bio). .. After ultrasonic shearing (Covaris LE220), amplified cDNA samples were subjected to standard Illumina fragment library preparation using the NEBnext Ultra DNA library preparation chemistry (New England Biolabs).

    Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..

    Article Title: Discovery, Structural Characterization, and Preclinical Evaluation of Monoclonal Antibodies against Xylazine Poisoning
    Article Snippet: Xylazine is a nonopioid sedative that has emerged as a major adulterant in the illicit drug supply, contributing to rising fatal overdoses across the United States.. Xylazine toxicity is not reversed by naloxone, and there are no current FDA-approved therapeutics to counteract its effects in humans.. To address this issue, we developed and characterized monoclonal antibodies (mAbs) capable of sequestering xylazine to prevent or treat acute toxicity.

    Article Title: CD1a-Mediated Presentation of Canonical Microbial Peptides to T Cells
    Article Snippet: .. Total RNA was reverse-transcribed into cDNA using template switch oligonucleotide (TSO), primers for human TCR constant regions and SMARTScribe reverse transcriptases (Clontech) according to the manufacturer’s instructions. ..

    Article Title: The circadian isoform landscape of mouse livers
    Article Snippet: .. First strand reverse transcription was performed for 1 h at 42°C, before being heat inactivated for 5 min at 70°C, using the Smartscribe Reverse Transcriptase (Clontech). ..

    Immunoprecipitation:

    Article Title: METTL3 mediates m 6 A methylation of ADAM17 to Downregulate ACE2–Ang-(1–7) axis and promote progression of hypertension
    Article Snippet: A minimum of 1 μg total RNA was fragmented with an NEBNext Magnesium RNA fragmentation module (New England Biolabs, Ipswich, MA, USA) by incubating at 94 °C for 5 min. Fragmented RNA, including rRNA, was enriched with m6A antibody–Dynabead complexes through immunoprecipitation. .. Immunoprecipitated RNA was then reverse-transcribed to yield first-strand cDNA via SMARTScribe reverse transcriptase (ClonTech, Japan). ..

    Next-Generation Sequencing:

    Article Title: Mesenchymal stroma cell-derived stem cell factor mediates cross-species compatibility of the hematopoietic stem cell niche
    Article Snippet: RNA was prepared using the miRNeasy Micro Kit (Qiagen). .. Total RNA was eluted in 10ul and 5ul were used for library preparation for next generation sequencing. cDNA was synthesized from 5 μl total RNA using the SmartScribe reverse transcriptase (Takara Bio, SMARTer HV Kit) with a universally tailed poly-dT primer and a template switching oligo followed by amplification for 12 cycles with the Advantage 2 DNA Polymerase (Takara Bio). .. After ultrasonic shearing (Covaris LE220), amplified cDNA samples were subjected to standard Illumina fragment library preparation using the NEBnext Ultra DNA library preparation chemistry (New England Biolabs).

    Synthesized:

    Article Title: Mesenchymal stroma cell-derived stem cell factor mediates cross-species compatibility of the hematopoietic stem cell niche
    Article Snippet: RNA was prepared using the miRNeasy Micro Kit (Qiagen). .. Total RNA was eluted in 10ul and 5ul were used for library preparation for next generation sequencing. cDNA was synthesized from 5 μl total RNA using the SmartScribe reverse transcriptase (Takara Bio, SMARTer HV Kit) with a universally tailed poly-dT primer and a template switching oligo followed by amplification for 12 cycles with the Advantage 2 DNA Polymerase (Takara Bio). .. After ultrasonic shearing (Covaris LE220), amplified cDNA samples were subjected to standard Illumina fragment library preparation using the NEBnext Ultra DNA library preparation chemistry (New England Biolabs).

    Article Title: Discovery, Structural Characterization, and Preclinical Evaluation of Monoclonal Antibodies against Xylazine Poisoning
    Article Snippet: Xylazine is a nonopioid sedative that has emerged as a major adulterant in the illicit drug supply, contributing to rising fatal overdoses across the United States.. Xylazine toxicity is not reversed by naloxone, and there are no current FDA-approved therapeutics to counteract its effects in humans.. To address this issue, we developed and characterized monoclonal antibodies (mAbs) capable of sequestering xylazine to prevent or treat acute toxicity.

    Amplification:

    Article Title: Mesenchymal stroma cell-derived stem cell factor mediates cross-species compatibility of the hematopoietic stem cell niche
    Article Snippet: RNA was prepared using the miRNeasy Micro Kit (Qiagen). .. Total RNA was eluted in 10ul and 5ul were used for library preparation for next generation sequencing. cDNA was synthesized from 5 μl total RNA using the SmartScribe reverse transcriptase (Takara Bio, SMARTer HV Kit) with a universally tailed poly-dT primer and a template switching oligo followed by amplification for 12 cycles with the Advantage 2 DNA Polymerase (Takara Bio). .. After ultrasonic shearing (Covaris LE220), amplified cDNA samples were subjected to standard Illumina fragment library preparation using the NEBnext Ultra DNA library preparation chemistry (New England Biolabs).

    Article Title: Leukemic stem cell subtypes determine venetoclax resistance and therapeutic vulnerabilities in AML.
    Article Snippet: RNA quality assessment and quantification were performed with Bioanalyzer using Agilent RNA 6000 Pico Kit (Agilent, cat #5067-1513). .. Whole-transcriptome amplification was performed using a modified Smartseq2 protocol, with 5 μL of a modified RT Buffer containing 1 × SMART First Strand Buffer (Takara Bio Clontech, cat #639538), 1 mmol/L dithiothreitol (Takara Bio Clontech), 1 μmol/L template switching oligo (IDT), 10 U/μL SMARTScribe (Takara Bio Clontech, cat #639538), and 1 U/μL RNasin Plus RNase Inhibitor (Promega, cat #N2615). .. Tagmentation of cDNA was done using Nextera XT DNA Library Preparation Kit (Illumina, cat #FC-121-1030).

    Bicinchoninic Acid Protein Assay:

    Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..

    Staining:

    Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..

    Multiplex Assay:

    Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..

    Crocin Bleaching Assay:

    Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..

    Gel Extraction:

    Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..

    Sequencing:

    Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..

    Transgenic Assay:

    Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..

    Immunopeptidomics:

    Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..

    Polymerase Chain Reaction:

    Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..

    Recombinant:

    Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..

    Modification:

    Article Title: Leukemic stem cell subtypes determine venetoclax resistance and therapeutic vulnerabilities in AML.
    Article Snippet: RNA quality assessment and quantification were performed with Bioanalyzer using Agilent RNA 6000 Pico Kit (Agilent, cat #5067-1513). .. Whole-transcriptome amplification was performed using a modified Smartseq2 protocol, with 5 μL of a modified RT Buffer containing 1 × SMART First Strand Buffer (Takara Bio Clontech, cat #639538), 1 mmol/L dithiothreitol (Takara Bio Clontech), 1 μmol/L template switching oligo (IDT), 10 U/μL SMARTScribe (Takara Bio Clontech, cat #639538), and 1 U/μL RNasin Plus RNase Inhibitor (Promega, cat #N2615). .. Tagmentation of cDNA was done using Nextera XT DNA Library Preparation Kit (Illumina, cat #FC-121-1030).



    Similar Products

    96
    TaKaRa smartscribe reverse transcriptase
    Smartscribe Reverse Transcriptase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartscribe+reverse+transcriptase/SMARTScribe+Reverse+Transcriptase/pmc13076092-32-22-25
    Average 96 stars, based on 1 article reviews
    smartscribe reverse transcriptase - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    TaKaRa smartscribe reverse transcriptase kit
    Smartscribe Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartscribe+reverse+transcriptase/SMARTScribe+Reverse+Transcriptase/10__1021_slash_acsptsci__6c00117-175-37-41
    Average 96 stars, based on 1 article reviews
    smartscribe reverse transcriptase kit - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    TaKaRa smartscribe reverse transcriptases
    Smartscribe Reverse Transcriptases, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartscribe+reverse+transcriptase/SMARTScribe+Reverse+Transcriptase/bio_rxiv__64898__2026__05__05__723095-251-18-21
    Average 96 stars, based on 1 article reviews
    smartscribe reverse transcriptases - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    TaKaRa smartscribe
    Smartscribe, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartscribe+reverse+transcriptase/SMARTScribe+Reverse+Transcriptase/pm42102807-387-43-44
    Average 96 stars, based on 1 article reviews
    smartscribe - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    TaKaRa smartscribetm reverse transcriptase
    Smartscribetm Reverse Transcriptase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartscribe+reverse+transcriptase/SMARTScribe+Reverse+Transcriptase/med_rxiv__64898__2026__05__02__26352058-240-43-46
    Average 96 stars, based on 1 article reviews
    smartscribetm reverse transcriptase - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    TaKaRa smartscribetm reverse transcriptase takara
    Smartscribetm Reverse Transcriptase Takara, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartscribe+reverse+transcriptase/SMARTScribe+Reverse+Transcriptase/pm42085184-221-46-49
    Average 96 stars, based on 1 article reviews
    smartscribetm reverse transcriptase takara - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results