Review



gene exp ddb2 hs00172068 m1  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 85
      Buy from Supplier

    Structured Review

    Thermo Fisher gene exp ddb2 hs00172068 m1
    Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details
    Gene Exp Ddb2 Hs00172068 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-cell+spatial+transcriptomics+data/Gene+Exp%2E+DDB2%2C+Hs00172068_m1/pmc11106736-23-76--1
    Average 85 stars, based on 1 article reviews
    gene exp ddb2 hs00172068 m1 - by Bioz Stars, 2026-11
    85/100 stars

    Images

    1) Product Images from "RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay"

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

    Journal: Radiation research

    doi: 10.1667/RADE-22-00206.1

    Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details
    Figure Legend Snippet: Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details

    Techniques Used: Generated

    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
    Figure Legend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

    Techniques Used: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Red Blood Cell Lysis, Control, Concentration Assay, Sequencing, cDNA Synthesis, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

    The Table Depicts Team Contributions (from Left to Right) Regarding Employed Genes, Reported Dose Estimates per Reference Sample 1–3, Differences among Reported and Reference Dose-Values as well as the Summed Absolute Difference over all Reference Samples (SAD), a Correct (Yes) or Incorrect (No) Order of Dose Estimates (from Lowest to Highest) Corresponding to Three Dose Categories [Unexposed, Low (1.2 Gy) and Highly Exposed (3.5 Gy)], the Use of FDXR Gene Expression Changes for dose estimation, as well as the Report Time
    Figure Legend Snippet: The Table Depicts Team Contributions (from Left to Right) Regarding Employed Genes, Reported Dose Estimates per Reference Sample 1–3, Differences among Reported and Reference Dose-Values as well as the Summed Absolute Difference over all Reference Samples (SAD), a Correct (Yes) or Incorrect (No) Order of Dose Estimates (from Lowest to Highest) Corresponding to Three Dose Categories [Unexposed, Low (1.2 Gy) and Highly Exposed (3.5 Gy)], the Use of FDXR Gene Expression Changes for dose estimation, as well as the Report Time

    Techniques Used: Gene Expression

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Impact of Low-Dose CT Radiation on Gene Expression and DNA Integrity
    Article Snippet: For each sample, 1 μg of total RNA was reverse-transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied BiosystemsTM, Life Technologies, Darmstadt, Germany). .. Equal quantities of cDNA were mixed with TaqManTM Universal PCR Master Mix (Applied BiosystemsTM, Thermo Fisher Scientific, Waltham, MA, USA) and gene-specific TaqManTM (Thermo Fisher Scientific, Waltham, MA, USA) assays for PUM1 (Hs00206469_m1), AEN (Hs00224322_m1), BAX (Hs00180269_m1), DDB2 (Hs00172068_m1), FDXR (Hs01031617_m1), EDA2R (Hs00939736_m1), MIR34AHG (Hs04333908_s1), PHLDA3 (Hs00385313_m1), POU2AF1 (Hs01573371_m1), and WNT3 (Hs00902257_m1). qRT-PCR was performed using the QuantStudioTM 12K OA Real-Time PCR System (Thermo Fisher Scientific Inc., Waltham, MA, USA), where each gene was measured in duplicate. ..

    Article Title: Validating a Four-gene Set for H-ARS Severity Prediction in Peripheral Blood Samples of Irradiated Rhesus Macaques
    Article Snippet: a Bundeswehr Institute of Radiobiology, Munich, Germany; b Division of Radioprotectants, Department of Pharmacology and Molecular Therapeutics, F. Edward Hébert School of Medicine, and c Armed Forces Radiobiology Research Institute, Uniformed Services University of the Health Sciences, Bethesda, Maryland; d Department of Radiology, Bundeswehrkrankenhaus Ulm, Ulm Germany; e Department of Radiation Oncology, University

    Quantitative RT-PCR:

    Article Title: Impact of Low-Dose CT Radiation on Gene Expression and DNA Integrity
    Article Snippet: For each sample, 1 μg of total RNA was reverse-transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied BiosystemsTM, Life Technologies, Darmstadt, Germany). .. Equal quantities of cDNA were mixed with TaqManTM Universal PCR Master Mix (Applied BiosystemsTM, Thermo Fisher Scientific, Waltham, MA, USA) and gene-specific TaqManTM (Thermo Fisher Scientific, Waltham, MA, USA) assays for PUM1 (Hs00206469_m1), AEN (Hs00224322_m1), BAX (Hs00180269_m1), DDB2 (Hs00172068_m1), FDXR (Hs01031617_m1), EDA2R (Hs00939736_m1), MIR34AHG (Hs04333908_s1), PHLDA3 (Hs00385313_m1), POU2AF1 (Hs01573371_m1), and WNT3 (Hs00902257_m1). qRT-PCR was performed using the QuantStudioTM 12K OA Real-Time PCR System (Thermo Fisher Scientific Inc., Waltham, MA, USA), where each gene was measured in duplicate. ..

    Article Title: Development of a Point-of-Care Microfluidic RNA Extraction Slide for Gene Expression Diagnosis after Irradiation
    Article Snippet: In times of war, radiological/nuclear emergency scenarios have become a reemphasized threat.. However, there are challenges in transferring whole-blood samples to laboratories for specialized diagnostics using RNA.. This project aims to miniaturize the process of unwieldy conventional RNA extraction with its stationed technical equipment using a microfluidicbased slide (MBS) for point-of-care diagnostics.

    Real-time Polymerase Chain Reaction:

    Article Title: Impact of Low-Dose CT Radiation on Gene Expression and DNA Integrity
    Article Snippet: For each sample, 1 μg of total RNA was reverse-transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied BiosystemsTM, Life Technologies, Darmstadt, Germany). .. Equal quantities of cDNA were mixed with TaqManTM Universal PCR Master Mix (Applied BiosystemsTM, Thermo Fisher Scientific, Waltham, MA, USA) and gene-specific TaqManTM (Thermo Fisher Scientific, Waltham, MA, USA) assays for PUM1 (Hs00206469_m1), AEN (Hs00224322_m1), BAX (Hs00180269_m1), DDB2 (Hs00172068_m1), FDXR (Hs01031617_m1), EDA2R (Hs00939736_m1), MIR34AHG (Hs04333908_s1), PHLDA3 (Hs00385313_m1), POU2AF1 (Hs01573371_m1), and WNT3 (Hs00902257_m1). qRT-PCR was performed using the QuantStudioTM 12K OA Real-Time PCR System (Thermo Fisher Scientific Inc., Waltham, MA, USA), where each gene was measured in duplicate. ..

    TaqMan Assay:

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. .. TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT FDXR (HS01031617_ml) DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) RNA amount used for cDNA synthesis 0.2 μg; 1.65 μg per array Cycles 1×/50°C/2min, 95°C/10min, 4O×/95°C/15 s, 60°C/1min 1×/95°C/10min, 40×/95°C/15 s, 60°C/1min 1×/95°C/5min, 40×/95°C/10 s, 60°C/30s 1×/95°C/15min, 45×/95°C/15s, 60°C/20s, 72°C/20s, 1×/95°C/5s, 1×/65°C/60s, 1×/97°C, cooling step TaqMan ® assay: 1 ×/50°C/2min, 1×/95°C/20s, 45×/95°C/3s, 60°C/30s SYBR Green assay: 1×/95°C/10min, 40×/95°C/15s, 59°C/30s, 72°C/30s, 1×/72°C/1min 1×/95°C/2min, 40×/95°C/10s, 60°C/1min 1× /50°C/2min, 1× /95°C/10min, 40×/95°C/1min, 60°C/1min cDNA amount used for cRNA synthesis N.D. .. Detection system QS7 Flex (Thermofisher) 7500 Real-Time PCR System (Thermo Fischer Scientific) Stratagene Mx30005P (Agilent Technologies, Inc.) LightCycler ® 480 Instrument, Roche Rotor-Gene Q (Qiagen) Rotor Gene Q (Qiagen) QuantStudio TM 12K OA Real-Time PCR System (Thermo Fisher Scientific) Number of interrogated genes > 41,000 transcripts Threshold 0.15 fixed Second Derivative Maximum method fixed fixed 0.05 Software Agilent Feature Extraction Normalization UBC (Hs00824723_ml) ΔCt(target gene) = Ct(target gene) - √(Ct(ITFG1) × Ct(DPM1)) ITFG1 (Hs00229263_ml), DPM1 (Hs00187270_ml) MRPS5-F: TAAACGGGAGCGAGGATGGA; MRPS5-R: ATGTTTCTCCACAGGGACCAG Human 18S rRNA (sequence, forward: GCTTAATTTGACTCAACACGGGA, reverse: AGCTATCAATCTGTCAATCCTGTCC, Thermo Fisher Scientific) TaqMan assay: ITFG1; SYBR Green assay: GAPDH and HPRT geometric mean HPRT1 Human 18S rRNA (Hs99999901_g1, Thermo Fisher Scientific) set normalization algorithm Software (v.9.5.1) Processed signal value were log2-transformed, normalization via GAPDH Quantification method Δ-Ct approach Δ-Ct approach ΔΔ-Ct approach, relative fold change in relation to the 0 Gy sample of the calibration curve Δ-Ct approach ΔΔ-Ct approach, relative fold change in relation to the 0 Gy sample of the calibration curve Δ-Ct approach Δ-Ct approach Quantification method Dose estimations based on in-house calibration curves Quality control SYBR Green assay: melting curve inspection Quality control Agilent QC report Standard curve No No Yes No No Yes Yes Quality control Standard curve Agilent QC report not available Slope No No No No No Yes Yes Slope 0,96 – 1,00 r-sqr No No Yes No No Yes Yes r-sqr 0.99 18s rRNA Cq UBC ITFG1, DPM1 MRPS5 Yes (–)RT and NTC HPRT1, (–)RT and NTC Yes 18s rRNA Cq not available Open in a separate window Note.

    SYBR Green Assay:

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. .. TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT FDXR (HS01031617_ml) DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) RNA amount used for cDNA synthesis 0.2 μg; 1.65 μg per array Cycles 1×/50°C/2min, 95°C/10min, 4O×/95°C/15 s, 60°C/1min 1×/95°C/10min, 40×/95°C/15 s, 60°C/1min 1×/95°C/5min, 40×/95°C/10 s, 60°C/30s 1×/95°C/15min, 45×/95°C/15s, 60°C/20s, 72°C/20s, 1×/95°C/5s, 1×/65°C/60s, 1×/97°C, cooling step TaqMan ® assay: 1 ×/50°C/2min, 1×/95°C/20s, 45×/95°C/3s, 60°C/30s SYBR Green assay: 1×/95°C/10min, 40×/95°C/15s, 59°C/30s, 72°C/30s, 1×/72°C/1min 1×/95°C/2min, 40×/95°C/10s, 60°C/1min 1× /50°C/2min, 1× /95°C/10min, 40×/95°C/1min, 60°C/1min cDNA amount used for cRNA synthesis N.D. .. Detection system QS7 Flex (Thermofisher) 7500 Real-Time PCR System (Thermo Fischer Scientific) Stratagene Mx30005P (Agilent Technologies, Inc.) LightCycler ® 480 Instrument, Roche Rotor-Gene Q (Qiagen) Rotor Gene Q (Qiagen) QuantStudio TM 12K OA Real-Time PCR System (Thermo Fisher Scientific) Number of interrogated genes > 41,000 transcripts Threshold 0.15 fixed Second Derivative Maximum method fixed fixed 0.05 Software Agilent Feature Extraction Normalization UBC (Hs00824723_ml) ΔCt(target gene) = Ct(target gene) - √(Ct(ITFG1) × Ct(DPM1)) ITFG1 (Hs00229263_ml), DPM1 (Hs00187270_ml) MRPS5-F: TAAACGGGAGCGAGGATGGA; MRPS5-R: ATGTTTCTCCACAGGGACCAG Human 18S rRNA (sequence, forward: GCTTAATTTGACTCAACACGGGA, reverse: AGCTATCAATCTGTCAATCCTGTCC, Thermo Fisher Scientific) TaqMan assay: ITFG1; SYBR Green assay: GAPDH and HPRT geometric mean HPRT1 Human 18S rRNA (Hs99999901_g1, Thermo Fisher Scientific) set normalization algorithm Software (v.9.5.1) Processed signal value were log2-transformed, normalization via GAPDH Quantification method Δ-Ct approach Δ-Ct approach ΔΔ-Ct approach, relative fold change in relation to the 0 Gy sample of the calibration curve Δ-Ct approach ΔΔ-Ct approach, relative fold change in relation to the 0 Gy sample of the calibration curve Δ-Ct approach Δ-Ct approach Quantification method Dose estimations based on in-house calibration curves Quality control SYBR Green assay: melting curve inspection Quality control Agilent QC report Standard curve No No Yes No No Yes Yes Quality control Standard curve Agilent QC report not available Slope No No No No No Yes Yes Slope 0,96 – 1,00 r-sqr No No Yes No No Yes Yes r-sqr 0.99 18s rRNA Cq UBC ITFG1, DPM1 MRPS5 Yes (–)RT and NTC HPRT1, (–)RT and NTC Yes 18s rRNA Cq not available Open in a separate window Note.

    Countercurrent Chromatography:

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. .. TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT FDXR (HS01031617_ml) DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) RNA amount used for cDNA synthesis 0.2 μg; 1.65 μg per array Cycles 1×/50°C/2min, 95°C/10min, 4O×/95°C/15 s, 60°C/1min 1×/95°C/10min, 40×/95°C/15 s, 60°C/1min 1×/95°C/5min, 40×/95°C/10 s, 60°C/30s 1×/95°C/15min, 45×/95°C/15s, 60°C/20s, 72°C/20s, 1×/95°C/5s, 1×/65°C/60s, 1×/97°C, cooling step TaqMan ® assay: 1 ×/50°C/2min, 1×/95°C/20s, 45×/95°C/3s, 60°C/30s SYBR Green assay: 1×/95°C/10min, 40×/95°C/15s, 59°C/30s, 72°C/30s, 1×/72°C/1min 1×/95°C/2min, 40×/95°C/10s, 60°C/1min 1× /50°C/2min, 1× /95°C/10min, 40×/95°C/1min, 60°C/1min cDNA amount used for cRNA synthesis N.D. .. Detection system QS7 Flex (Thermofisher) 7500 Real-Time PCR System (Thermo Fischer Scientific) Stratagene Mx30005P (Agilent Technologies, Inc.) LightCycler ® 480 Instrument, Roche Rotor-Gene Q (Qiagen) Rotor Gene Q (Qiagen) QuantStudio TM 12K OA Real-Time PCR System (Thermo Fisher Scientific) Number of interrogated genes > 41,000 transcripts Threshold 0.15 fixed Second Derivative Maximum method fixed fixed 0.05 Software Agilent Feature Extraction Normalization UBC (Hs00824723_ml) ΔCt(target gene) = Ct(target gene) - √(Ct(ITFG1) × Ct(DPM1)) ITFG1 (Hs00229263_ml), DPM1 (Hs00187270_ml) MRPS5-F: TAAACGGGAGCGAGGATGGA; MRPS5-R: ATGTTTCTCCACAGGGACCAG Human 18S rRNA (sequence, forward: GCTTAATTTGACTCAACACGGGA, reverse: AGCTATCAATCTGTCAATCCTGTCC, Thermo Fisher Scientific) TaqMan assay: ITFG1; SYBR Green assay: GAPDH and HPRT geometric mean HPRT1 Human 18S rRNA (Hs99999901_g1, Thermo Fisher Scientific) set normalization algorithm Software (v.9.5.1) Processed signal value were log2-transformed, normalization via GAPDH Quantification method Δ-Ct approach Δ-Ct approach ΔΔ-Ct approach, relative fold change in relation to the 0 Gy sample of the calibration curve Δ-Ct approach ΔΔ-Ct approach, relative fold change in relation to the 0 Gy sample of the calibration curve Δ-Ct approach Δ-Ct approach Quantification method Dose estimations based on in-house calibration curves Quality control SYBR Green assay: melting curve inspection Quality control Agilent QC report Standard curve No No Yes No No Yes Yes Quality control Standard curve Agilent QC report not available Slope No No No No No Yes Yes Slope 0,96 – 1,00 r-sqr No No Yes No No Yes Yes r-sqr 0.99 18s rRNA Cq UBC ITFG1, DPM1 MRPS5 Yes (–)RT and NTC HPRT1, (–)RT and NTC Yes 18s rRNA Cq not available Open in a separate window Note.

    cDNA Synthesis:

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. .. TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT FDXR (HS01031617_ml) DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) RNA amount used for cDNA synthesis 0.2 μg; 1.65 μg per array Cycles 1×/50°C/2min, 95°C/10min, 4O×/95°C/15 s, 60°C/1min 1×/95°C/10min, 40×/95°C/15 s, 60°C/1min 1×/95°C/5min, 40×/95°C/10 s, 60°C/30s 1×/95°C/15min, 45×/95°C/15s, 60°C/20s, 72°C/20s, 1×/95°C/5s, 1×/65°C/60s, 1×/97°C, cooling step TaqMan ® assay: 1 ×/50°C/2min, 1×/95°C/20s, 45×/95°C/3s, 60°C/30s SYBR Green assay: 1×/95°C/10min, 40×/95°C/15s, 59°C/30s, 72°C/30s, 1×/72°C/1min 1×/95°C/2min, 40×/95°C/10s, 60°C/1min 1× /50°C/2min, 1× /95°C/10min, 40×/95°C/1min, 60°C/1min cDNA amount used for cRNA synthesis N.D. .. Detection system QS7 Flex (Thermofisher) 7500 Real-Time PCR System (Thermo Fischer Scientific) Stratagene Mx30005P (Agilent Technologies, Inc.) LightCycler ® 480 Instrument, Roche Rotor-Gene Q (Qiagen) Rotor Gene Q (Qiagen) QuantStudio TM 12K OA Real-Time PCR System (Thermo Fisher Scientific) Number of interrogated genes > 41,000 transcripts Threshold 0.15 fixed Second Derivative Maximum method fixed fixed 0.05 Software Agilent Feature Extraction Normalization UBC (Hs00824723_ml) ΔCt(target gene) = Ct(target gene) - √(Ct(ITFG1) × Ct(DPM1)) ITFG1 (Hs00229263_ml), DPM1 (Hs00187270_ml) MRPS5-F: TAAACGGGAGCGAGGATGGA; MRPS5-R: ATGTTTCTCCACAGGGACCAG Human 18S rRNA (sequence, forward: GCTTAATTTGACTCAACACGGGA, reverse: AGCTATCAATCTGTCAATCCTGTCC, Thermo Fisher Scientific) TaqMan assay: ITFG1; SYBR Green assay: GAPDH and HPRT geometric mean HPRT1 Human 18S rRNA (Hs99999901_g1, Thermo Fisher Scientific) set normalization algorithm Software (v.9.5.1) Processed signal value were log2-transformed, normalization via GAPDH Quantification method Δ-Ct approach Δ-Ct approach ΔΔ-Ct approach, relative fold change in relation to the 0 Gy sample of the calibration curve Δ-Ct approach ΔΔ-Ct approach, relative fold change in relation to the 0 Gy sample of the calibration curve Δ-Ct approach Δ-Ct approach Quantification method Dose estimations based on in-house calibration curves Quality control SYBR Green assay: melting curve inspection Quality control Agilent QC report Standard curve No No Yes No No Yes Yes Quality control Standard curve Agilent QC report not available Slope No No No No No Yes Yes Slope 0,96 – 1,00 r-sqr No No Yes No No Yes Yes r-sqr 0.99 18s rRNA Cq UBC ITFG1, DPM1 MRPS5 Yes (–)RT and NTC HPRT1, (–)RT and NTC Yes 18s rRNA Cq not available Open in a separate window Note.

    other:

    Article Title: Applicability of Gene Expression in Saliva as an Alternative to Blood for Biodosimetry and Prediction of Radiation-induced Health Effects
    Article Snippet: PHPT1 (Hs03645225_m1), CCNG1 (Hs00171112_m1), CDKN1A (Hs00355782_m1), GADD45A (Hs00169255_m1), SESN1 (Hs00902782_m1), FDXR (Hs01031617_m1), DDB2 (Hs00172068_m1), POU2AF1 (Hs01573371_m1), and WNT3 (Hs00902257_m1) known as radiation-induced targets in blood were detected as well (2, 26–28, 35–37).

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT , FDXR (HS01031617_ml) , DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) , RNA amount used for cDNA synthesis , 0.2 μg; 1.65 μg per array.

    Gene Expression:

    Article Title: Enhanced γ-H2AX Foci Frequency and Altered Gene Expression in Participants Exposed to Ionizing Radiation During I-131 Nuclear Medicine Procedures.
    Article Snippet: Ionizing radiation (IR) is a ubiquitous environmental agent to which human beings are exposed continuously, mainly the background radiation that comes from both natural and man-made sources [1].. The increased background radiation in the recent decade has become a concern among the public in view of the reported health effects (stochastic and deterministic) generalized predominantly due to high doses and dose rates of exposure to IR from the Japanese atomic bomb survivors [2, 3].. Expanded radiobiology research complements the evidence generated from the ‘life span study’ and other epidemiology studies that the health effects of IR exposure are much more complex as the outcome depends on many physical and biological factors [4].



    Similar Products

    cell level resolution spatial data  (Complete Genomics Inc)
    99
    Complete Genomics Inc cell level resolution spatial data
    (a) Simplified cross-section of the human epidermis, highlighting squamous cells, melanocytes and basal cells. Coloured regions represent cSCC (green), which originates from squamous cells, melanoma (orange), which originates from melanocytes, and BCC (blue), which originates from basal cells. Two orange melanocytes are shown in the dermal region as occurs in invasive melanoma; other cells in the lower dermis layer are not depicted. (b) Overview of sample design and technologies used to generate data for this project. ROI - region of interest; FOV - field of view; S - cSCC; B - BCC; M - melanoma; HC - healthy (cancer patient); HNC - healthy (non-cancer patient donor). Technologies included are <t>single</t> <t>cell</t> RNA sequencing for fresh samples, single nuclei sequencing for formalin-fixed samples, Visium, Xenium, CosMX, GeoMX DSP for whole transcriptome, GeoMX DSP for proteins, Polaris, RNAscope, the proximal ligation assay, spatial glycomics and CODEX.
    Cell Level Resolution Spatial Data, supplied by Complete Genomics Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-cell+spatial+transcriptomics+data/Stereo-seq+Transcriptomics+Set+for+FFPE/bio_rxiv__2025__07__25__666708-218-8-14
    Average 99 stars, based on 1 article reviews
    cell level resolution spatial data - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    single-cell and spatial transcriptome data for cancer tissue  (10X Genomics)
    90
    10X Genomics single-cell and spatial transcriptome data for cancer tissue
    (a) Simplified cross-section of the human epidermis, highlighting squamous cells, melanocytes and basal cells. Coloured regions represent cSCC (green), which originates from squamous cells, melanoma (orange), which originates from melanocytes, and BCC (blue), which originates from basal cells. Two orange melanocytes are shown in the dermal region as occurs in invasive melanoma; other cells in the lower dermis layer are not depicted. (b) Overview of sample design and technologies used to generate data for this project. ROI - region of interest; FOV - field of view; S - cSCC; B - BCC; M - melanoma; HC - healthy (cancer patient); HNC - healthy (non-cancer patient donor). Technologies included are <t>single</t> <t>cell</t> RNA sequencing for fresh samples, single nuclei sequencing for formalin-fixed samples, Visium, Xenium, CosMX, GeoMX DSP for whole transcriptome, GeoMX DSP for proteins, Polaris, RNAscope, the proximal ligation assay, spatial glycomics and CODEX.
    Single Cell And Spatial Transcriptome Data For Cancer Tissue, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-cell+spatial+transcriptomics+data/single+cell+and+spatial+transcriptome+data+for+cancer+tissue/pmc12045154-227-7-12
    Average 90 stars, based on 1 article reviews
    single-cell and spatial transcriptome data for cancer tissue - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    single-cell spatial transcriptomics data  (Spatial Transcriptomics Inc)
    90
    Spatial Transcriptomics Inc single-cell spatial transcriptomics data
    (a) Simplified cross-section of the human epidermis, highlighting squamous cells, melanocytes and basal cells. Coloured regions represent cSCC (green), which originates from squamous cells, melanoma (orange), which originates from melanocytes, and BCC (blue), which originates from basal cells. Two orange melanocytes are shown in the dermal region as occurs in invasive melanoma; other cells in the lower dermis layer are not depicted. (b) Overview of sample design and technologies used to generate data for this project. ROI - region of interest; FOV - field of view; S - cSCC; B - BCC; M - melanoma; HC - healthy (cancer patient); HNC - healthy (non-cancer patient donor). Technologies included are <t>single</t> <t>cell</t> RNA sequencing for fresh samples, single nuclei sequencing for formalin-fixed samples, Visium, Xenium, CosMX, GeoMX DSP for whole transcriptome, GeoMX DSP for proteins, Polaris, RNAscope, the proximal ligation assay, spatial glycomics and CODEX.
    Single Cell Spatial Transcriptomics Data, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-cell+spatial+transcriptomics+data/spatial+transcriptomics+sequencing/pm40081939-173-16-17
    Average 90 stars, based on 1 article reviews
    single-cell spatial transcriptomics data - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    star-finder single cell and spatial transcriptomics data portal  (Spatial Transcriptomics Inc)
    90
    Spatial Transcriptomics Inc star-finder single cell and spatial transcriptomics data portal

    Star Finder Single Cell And Spatial Transcriptomics Data Portal, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-cell+spatial+transcriptomics+data/spatial+transcriptomics+sequencing/pmc07864098-111-0-4
    Average 90 stars, based on 1 article reviews
    star-finder single cell and spatial transcriptomics data portal - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    (a) Simplified cross-section of the human epidermis, highlighting squamous cells, melanocytes and basal cells. Coloured regions represent cSCC (green), which originates from squamous cells, melanoma (orange), which originates from melanocytes, and BCC (blue), which originates from basal cells. Two orange melanocytes are shown in the dermal region as occurs in invasive melanoma; other cells in the lower dermis layer are not depicted. (b) Overview of sample design and technologies used to generate data for this project. ROI - region of interest; FOV - field of view; S - cSCC; B - BCC; M - melanoma; HC - healthy (cancer patient); HNC - healthy (non-cancer patient donor). Technologies included are single cell RNA sequencing for fresh samples, single nuclei sequencing for formalin-fixed samples, Visium, Xenium, CosMX, GeoMX DSP for whole transcriptome, GeoMX DSP for proteins, Polaris, RNAscope, the proximal ligation assay, spatial glycomics and CODEX.

    Journal: bioRxiv

    Article Title: Integrating 12 Spatial and Single Cell Technologies to Characterise Tumour Neighbourhoods and Cellular Interactions in three Skin Cancer Types

    doi: 10.1101/2025.07.25.666708

    Figure Lengend Snippet: (a) Simplified cross-section of the human epidermis, highlighting squamous cells, melanocytes and basal cells. Coloured regions represent cSCC (green), which originates from squamous cells, melanoma (orange), which originates from melanocytes, and BCC (blue), which originates from basal cells. Two orange melanocytes are shown in the dermal region as occurs in invasive melanoma; other cells in the lower dermis layer are not depicted. (b) Overview of sample design and technologies used to generate data for this project. ROI - region of interest; FOV - field of view; S - cSCC; B - BCC; M - melanoma; HC - healthy (cancer patient); HNC - healthy (non-cancer patient donor). Technologies included are single cell RNA sequencing for fresh samples, single nuclei sequencing for formalin-fixed samples, Visium, Xenium, CosMX, GeoMX DSP for whole transcriptome, GeoMX DSP for proteins, Polaris, RNAscope, the proximal ligation assay, spatial glycomics and CODEX.

    Article Snippet: Cells expressing the two genes are visualized on single-cell level resolution spatial data from STOmics and Curio-Seeker (Takara Bio, USA) melanoma samples and appear to be in spatial proximity ( ).

    Techniques: RNA Sequencing, Sequencing, RNAscope, Ligation

    (a) Gene specificity score (GSS) and association of spatial spots with skin cancer heritability. GSS score for each gene in a spot/cell represents the enrichment of the gene as a top rank most abundant gene in the spot/cell and its neighbour spots/cells in an anatomical region, a spatial domain, or a cell type. The p-value shows the spatial heritability enrichment significance of a spot with a trait based on SNPs mapped to the genes with high GSS scores (one-sided Z-test for stratified coefficient different to 0). The p-value is more significant if the SNPs that are mapped to the high GSS genes explain a higher proportion of heritability for the trait. (b) Cell types with the highest enrichment of heritability explained by SNPs tagged to GSS genes of cells in a cell type. The white asterisks indicate the most enriched cell-type for heritability of cutaneous melanoma, cSCC and BCC traits. (c) gsMAP significance spatial heritability enrichment is shown at single-cell resolution across the tissue (upper tissue plots) or per annotated skin regions (lower violin plots) from the cosMx data of the sample mel48974. (d) LR pairs with significant association with SNP heritability explained by the corresponding cell types. The rectangles show cases where both L and R genes had PCC >0.3 between GSS of the gene and the gsMAP P-values (the significance level for the LD stratified coefficients for the spot bigger than 0). The results suggest which LR pairs are related with the heritability of a cell type pairs. (e) GSS of two LR pairs showing specificity of the L and R genes to tissue regions at the immune-rich dermal layers and the epidermis of the skin. (f) Manhattan plot showing top significant GWAS SNPs co-localizing with genes in melanocytes (red) and T cells (blue) that had the highest Pearson correlation between GSS and the gsMAP trait association P-value or associated with SNPs with genome-wide significance. The Y-axis shows the -log(P-value) from GWAS analysis.

    Journal: bioRxiv

    Article Title: Integrating 12 Spatial and Single Cell Technologies to Characterise Tumour Neighbourhoods and Cellular Interactions in three Skin Cancer Types

    doi: 10.1101/2025.07.25.666708

    Figure Lengend Snippet: (a) Gene specificity score (GSS) and association of spatial spots with skin cancer heritability. GSS score for each gene in a spot/cell represents the enrichment of the gene as a top rank most abundant gene in the spot/cell and its neighbour spots/cells in an anatomical region, a spatial domain, or a cell type. The p-value shows the spatial heritability enrichment significance of a spot with a trait based on SNPs mapped to the genes with high GSS scores (one-sided Z-test for stratified coefficient different to 0). The p-value is more significant if the SNPs that are mapped to the high GSS genes explain a higher proportion of heritability for the trait. (b) Cell types with the highest enrichment of heritability explained by SNPs tagged to GSS genes of cells in a cell type. The white asterisks indicate the most enriched cell-type for heritability of cutaneous melanoma, cSCC and BCC traits. (c) gsMAP significance spatial heritability enrichment is shown at single-cell resolution across the tissue (upper tissue plots) or per annotated skin regions (lower violin plots) from the cosMx data of the sample mel48974. (d) LR pairs with significant association with SNP heritability explained by the corresponding cell types. The rectangles show cases where both L and R genes had PCC >0.3 between GSS of the gene and the gsMAP P-values (the significance level for the LD stratified coefficients for the spot bigger than 0). The results suggest which LR pairs are related with the heritability of a cell type pairs. (e) GSS of two LR pairs showing specificity of the L and R genes to tissue regions at the immune-rich dermal layers and the epidermis of the skin. (f) Manhattan plot showing top significant GWAS SNPs co-localizing with genes in melanocytes (red) and T cells (blue) that had the highest Pearson correlation between GSS and the gsMAP trait association P-value or associated with SNPs with genome-wide significance. The Y-axis shows the -log(P-value) from GWAS analysis.

    Article Snippet: Cells expressing the two genes are visualized on single-cell level resolution spatial data from STOmics and Curio-Seeker (Takara Bio, USA) melanoma samples and appear to be in spatial proximity ( ).

    Techniques: Genome Wide

    Journal: Cell

    Article Title: Spatiotemporal analysis of human intestinal development at single-cell resolution

    doi: 10.1016/j.cell.2020.12.016

    Figure Lengend Snippet:

    Article Snippet: STAR-FINDer Single Cell and Spatial Transcriptomics Data Portal , This study , https://simmonslab.shinyapps.io/FetalAtlasDataPortal.

    Techniques: Conjugation Assay, Recombinant, Saline, Modification, Plasmid Preparation, Gene Expression, RNAscope, Generated, Software