digitonin thermo fischer scientific (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
97
Structured Review
Thermo Fisher
digitonin thermo fischer scientific
Digitonin Thermo Fischer Scientific, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sigma+plot+version+13+0+software/Digitonin/pm41528844-784-86-87
Average 97 stars, based on 1 article reviews
Digitonin Thermo Fischer Scientific, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sigma+plot+version+13+0+software/Digitonin/pm41528844-784-86-87
Average 97 stars, based on 1 article reviews
digitonin thermo fischer scientific - by Bioz Stars,
2026-09
97/100 stars
Images
Related Articles
Lysis:Article Title: FLNB and TTC26 regulate ciliary Hedgehog signaling to maintain intervertebral disc matrix homeostasis in adolescent idiopathic scoliosis. Article Snippet: .. Briefly, cells were lysed in Protease Inhibitor:Article Title: FLNB and TTC26 regulate ciliary Hedgehog signaling to maintain intervertebral disc matrix homeostasis in adolescent idiopathic scoliosis. Article Snippet: .. Briefly, cells were lysed in Incubation:Article Title: Sex-Dimorphic Neural Memory Shapes Pancreatic Tissue Resilience Article Snippet: Oligos (5’-3’ – IDT 25nm, standard desalting): Tn5_1 – TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG Tn5_2_ME_comp – GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG TN5MEREV - /5Phos/CTGTCTCTTATACACATCT .. 50×10 single live acinar cells (previously optimized cell number) were centrifuged at 500g for 4 minutes at 4°C and resuspended in 50 μl of ATAC resuspension buffer (RSB) (10mM Tris-HCL (Sigma) pH7.4, 10mM NaCl (Sigma), 3mM MgCl 2 (Sigma)) with 0.1% NP40 (Thermo Fisher), 0.1% Tween-20 (Sigma) and 0.01% Purification:Article Title: Structure of giant kelp Photosystem I-FCP uncovers drivers of antenna evolution across the red lineage Article Snippet: .. Using Membrane:Article Title: Mitochondrial integrated stress response activation creates a therapeutic vulnerability to MCL-1 inhibition in acute myeloid leukemia. Article Snippet: Briefly, 500,000 cells were seeded and treated with either DMSO or 50 nM IACS for 24 h. Cells were collected, washed with PBS and stained with AquaZombie viability dye (Biolegend). .. Cells were exposed to a 0.0001% Sequencing:Article Title: Mitochondrial integrated stress response activation creates a therapeutic vulnerability to MCL-1 inhibition in acute myeloid leukemia. Article Snippet: Briefly, 500,000 cells were seeded and treated with either DMSO or 50 nM IACS for 24 h. Cells were collected, washed with PBS and stained with AquaZombie viability dye (Biolegend). .. Cells were exposed to a 0.0001% Neutralization:Article Title: Mitochondrial integrated stress response activation creates a therapeutic vulnerability to MCL-1 inhibition in acute myeloid leukemia. Article Snippet: Briefly, 500,000 cells were seeded and treated with either DMSO or 50 nM IACS for 24 h. Cells were collected, washed with PBS and stained with AquaZombie viability dye (Biolegend). .. Cells were exposed to a 0.0001% Clear Native PAGE:Article Title: Activation of AMPK as a therapeutic strategy for FBXL4-related mitochondrial DNA depletion syndrome. Article Snippet: .. For BN-PAGE analysis, the mitochondria-enriched pellet was processed in 1× Native PAGE buffer (Thermo Fisher #BN2003) supplemented with 1% |