shctrl constructs (OriGene)
OriGene is a verified supplier 
OriGene manufactures this product 
96
Structured Review
OriGene
shctrl constructs
Shctrl Constructs, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 207 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/pm38873940-270-3-8
Average 96 stars, based on 207 article reviews
Shctrl Constructs, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 207 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/pm38873940-270-3-8
Average 96 stars, based on 207 article reviews
shctrl constructs - by Bioz Stars,
2026-11
96/100 stars
Images
Related Articles
Expressing:Article Title: S1P-S1PR1 signaling impairs CD8 + T cell metabolism and effector function in tumors. Article Snippet: • In selected experiments, mice received anti-PD-1 antibody (200 μg/mouse) or isotype control IgG, administered three times per week. shRNA mediated knockdown of T cells • HEK 293 T (ATCC) cells were cultured in T75 tissue culture flasks (Falcon, NY, USA) under standard conditions (37 °C, 5% CO2). .. Cells were maintained in complete DMEM (Gibco, Thermo Fisher Scientific) supplemented with:10% fetal bovine serum (FBS; Gibco), 1% penicillin–streptomycin (Gibco) • For lentiviral production, HEK293T cells were co-transfected with: • 15 μg lentiviral expression plasmid encoding S1pr1 shRNA, Eif2ak3 shRNA, or Article Title: Multiple motor proteins regulate TDP-43 anterograde axonal transport. Article Snippet: .. Lentiviral vectors transduction for protein–protein interaction experiments Lentiviral (LV) constructs expressing short hairpin RNA (shRNA) targeting KLC1 with the fluorescent reporter TurboGFP (LV-shKLC1-tGFP), or a Plasmid Preparation:Article Title: S1P-S1PR1 signaling impairs CD8 + T cell metabolism and effector function in tumors. Article Snippet: • In selected experiments, mice received anti-PD-1 antibody (200 μg/mouse) or isotype control IgG, administered three times per week. shRNA mediated knockdown of T cells • HEK 293 T (ATCC) cells were cultured in T75 tissue culture flasks (Falcon, NY, USA) under standard conditions (37 °C, 5% CO2). .. Cells were maintained in complete DMEM (Gibco, Thermo Fisher Scientific) supplemented with:10% fetal bovine serum (FBS; Gibco), 1% penicillin–streptomycin (Gibco) • For lentiviral production, HEK293T cells were co-transfected with: • 15 μg lentiviral expression plasmid encoding S1pr1 shRNA, Eif2ak3 shRNA, or shRNA:Article Title: S1P-S1PR1 signaling impairs CD8 + T cell metabolism and effector function in tumors. Article Snippet: • In selected experiments, mice received anti-PD-1 antibody (200 μg/mouse) or isotype control IgG, administered three times per week. shRNA mediated knockdown of T cells • HEK 293 T (ATCC) cells were cultured in T75 tissue culture flasks (Falcon, NY, USA) under standard conditions (37 °C, 5% CO2). .. Cells were maintained in complete DMEM (Gibco, Thermo Fisher Scientific) supplemented with:10% fetal bovine serum (FBS; Gibco), 1% penicillin–streptomycin (Gibco) • For lentiviral production, HEK293T cells were co-transfected with: • 15 μg lentiviral expression plasmid encoding S1pr1 shRNA, Eif2ak3 shRNA, or Article Title: Hippocalcin Regulates NMDA Receptor Function and Neuronal Activity Through Elavl3 in Mouse Hippocampal Neural Precursor Cells Article Snippet: Differentiation was induced by culturing NPCs in NB medium supplemented with 2% ( v / v ) B27 (Gibco) serum-free supplement, 0.5 mM L-glutamine, and 1% 100× penicillin-streptomycin antibiotic mixture for 5 days. .. For Gene silencing, the 4 unique 29-mer shRNA constructs designed to target mouse Hpca (Cat# TL515389), the 4 unique 29-mer shRNA constructs designed to target mouse Elavl3 (Cat# TL512545) and Article Title: Development of antibody-drug conjugates targeting L1CAM to treat metastatic cancer Article Snippet: For knocking down L1CAM in PDXs, L1CAM human shRNA plasmid kit (Origene Cat# TL303597) was used. .. ShControl cells were generated in both cases by transducing the cells with scrambled Article Title: Glucose-stimulated KIF5B-driven microtubule sliding organizes microtubule networks in mouse pancreatic β cells Article Snippet: The Kif5b -targeting shRNA [shRNA Kif5b ] #1, [TL510740B, 5’- ACTCTACGGAACACTATTCAGTGGCTGGA ] and [shRNA Kif5b ] #2, [TL51074CB 5’ – AGACCGTAAACGCTATCAGCAAGAAGTAG ] are in the plasmid backbone pGFP-C-shLenti and were from Origene (Rockville, MD, USA). .. The nontargeting shRNA control was Article Title: Multiple motor proteins regulate TDP-43 anterograde axonal transport. Article Snippet: .. Lentiviral vectors transduction for protein–protein interaction experiments Lentiviral (LV) constructs expressing short hairpin RNA (shRNA) targeting KLC1 with the fluorescent reporter TurboGFP (LV-shKLC1-tGFP), or a Article Title: CHD7 regulates cardiac neural crest cell differentiation through SOX5-mediated self-activation Article Snippet: SOX5-shRNA2 , Millipore Sigma , Cat#TRCN0000075497. .. Article Title: Sertad1 is elevated and plays a necessary role in neuron loss and cognitive impairment in a mouse model of Alzheimer's disease Article Snippet: .. The Control:Article Title: S1P-S1PR1 signaling impairs CD8 + T cell metabolism and effector function in tumors. Article Snippet: • In selected experiments, mice received anti-PD-1 antibody (200 μg/mouse) or isotype control IgG, administered three times per week. shRNA mediated knockdown of T cells • HEK 293 T (ATCC) cells were cultured in T75 tissue culture flasks (Falcon, NY, USA) under standard conditions (37 °C, 5% CO2). .. Cells were maintained in complete DMEM (Gibco, Thermo Fisher Scientific) supplemented with:10% fetal bovine serum (FBS; Gibco), 1% penicillin–streptomycin (Gibco) • For lentiviral production, HEK293T cells were co-transfected with: • 15 μg lentiviral expression plasmid encoding S1pr1 shRNA, Eif2ak3 shRNA, or Article Title: Development of antibody-drug conjugates targeting L1CAM to treat metastatic cancer Article Snippet: For knocking down L1CAM in PDXs, L1CAM human shRNA plasmid kit (Origene Cat# TL303597) was used. .. ShControl cells were generated in both cases by transducing the cells with scrambled Article Title: Glucose-stimulated KIF5B-driven microtubule sliding organizes microtubule networks in mouse pancreatic β cells Article Snippet: The Kif5b -targeting shRNA [shRNA Kif5b ] #1, [TL510740B, 5’- ACTCTACGGAACACTATTCAGTGGCTGGA ] and [shRNA Kif5b ] #2, [TL51074CB 5’ – AGACCGTAAACGCTATCAGCAAGAAGTAG ] are in the plasmid backbone pGFP-C-shLenti and were from Origene (Rockville, MD, USA). .. The nontargeting shRNA control was Article Title: Multiple motor proteins regulate TDP-43 anterograde axonal transport. Article Snippet: .. Lentiviral vectors transduction for protein–protein interaction experiments Lentiviral (LV) constructs expressing short hairpin RNA (shRNA) targeting KLC1 with the fluorescent reporter TurboGFP (LV-shKLC1-tGFP), or a Transfection:Article Title: S1P-S1PR1 signaling impairs CD8 + T cell metabolism and effector function in tumors. Article Snippet: • In selected experiments, mice received anti-PD-1 antibody (200 μg/mouse) or isotype control IgG, administered three times per week. shRNA mediated knockdown of T cells • HEK 293 T (ATCC) cells were cultured in T75 tissue culture flasks (Falcon, NY, USA) under standard conditions (37 °C, 5% CO2). .. Cells were maintained in complete DMEM (Gibco, Thermo Fisher Scientific) supplemented with:10% fetal bovine serum (FBS; Gibco), 1% penicillin–streptomycin (Gibco) • For lentiviral production, HEK293T cells were co-transfected with: • 15 μg lentiviral expression plasmid encoding S1pr1 shRNA, Eif2ak3 shRNA, or Construct:Article Title: Hippocalcin Regulates NMDA Receptor Function and Neuronal Activity Through Elavl3 in Mouse Hippocampal Neural Precursor Cells Article Snippet: Differentiation was induced by culturing NPCs in NB medium supplemented with 2% ( v / v ) B27 (Gibco) serum-free supplement, 0.5 mM L-glutamine, and 1% 100× penicillin-streptomycin antibiotic mixture for 5 days. .. For Gene silencing, the 4 unique 29-mer shRNA constructs designed to target mouse Hpca (Cat# TL515389), the 4 unique 29-mer shRNA constructs designed to target mouse Elavl3 (Cat# TL512545) and Article Title: Multiple motor proteins regulate TDP-43 anterograde axonal transport. Article Snippet: .. Lentiviral vectors transduction for protein–protein interaction experiments Lentiviral (LV) constructs expressing short hairpin RNA (shRNA) targeting KLC1 with the fluorescent reporter TurboGFP (LV-shKLC1-tGFP), or a Negative Control:Article Title: Hippocalcin Regulates NMDA Receptor Function and Neuronal Activity Through Elavl3 in Mouse Hippocampal Neural Precursor Cells Article Snippet: Differentiation was induced by culturing NPCs in NB medium supplemented with 2% ( v / v ) B27 (Gibco) serum-free supplement, 0.5 mM L-glutamine, and 1% 100× penicillin-streptomycin antibiotic mixture for 5 days. .. For Gene silencing, the 4 unique 29-mer shRNA constructs designed to target mouse Hpca (Cat# TL515389), the 4 unique 29-mer shRNA constructs designed to target mouse Elavl3 (Cat# TL512545) and Generated:Article Title: Development of antibody-drug conjugates targeting L1CAM to treat metastatic cancer Article Snippet: For knocking down L1CAM in PDXs, L1CAM human shRNA plasmid kit (Origene Cat# TL303597) was used. .. ShControl cells were generated in both cases by transducing the cells with scrambled Transduction:Article Title: Multiple motor proteins regulate TDP-43 anterograde axonal transport. Article Snippet: .. Lentiviral vectors transduction for protein–protein interaction experiments Lentiviral (LV) constructs expressing short hairpin RNA (shRNA) targeting KLC1 with the fluorescent reporter TurboGFP (LV-shKLC1-tGFP), or a Clone Assay:Article Title: Multiple motor proteins regulate TDP-43 anterograde axonal transport. Article Snippet: .. Lentiviral vectors transduction for protein–protein interaction experiments Lentiviral (LV) constructs expressing short hairpin RNA (shRNA) targeting KLC1 with the fluorescent reporter TurboGFP (LV-shKLC1-tGFP), or a |
