Review



crispr design tool  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc crispr design tool
    Crispr Design Tool, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sh2+array/SEPT11+sh2+shRNA+(Plasmid+%23122023)/pm37298123-252-24-50
    Average 93 stars, based on 3 article reviews
    crispr design tool - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    CRISPR:

    Article Title: Genetic Ablation of LAT1 Inhibits Growth of Liver Cancer Cells and Downregulates mTORC1 Signaling.
    Article Snippet: .. The gene sequences of human slc7a5 gene were downloaded from NCBI and sgRNAs were designed to target the second exon of the gene using CRISPR design tool (http: //crispr.mit.edu, accessed on 12 May 2023). sgRNAs that have BbsI restriction endonuclease site overhangs were synthesized, annealed, and sub-cloned into pSpCas9-2A-GFP plasmids (Addgene #48,138, Cambridge, MA, USA) that is digested with BbsI (NEB, Beverly, MA, USA) using T4 DNA ligase (NEB, Beverly, MA, USA). ..

    Synthesized:

    Article Title: Genetic Ablation of LAT1 Inhibits Growth of Liver Cancer Cells and Downregulates mTORC1 Signaling.
    Article Snippet: .. The gene sequences of human slc7a5 gene were downloaded from NCBI and sgRNAs were designed to target the second exon of the gene using CRISPR design tool (http: //crispr.mit.edu, accessed on 12 May 2023). sgRNAs that have BbsI restriction endonuclease site overhangs were synthesized, annealed, and sub-cloned into pSpCas9-2A-GFP plasmids (Addgene #48,138, Cambridge, MA, USA) that is digested with BbsI (NEB, Beverly, MA, USA) using T4 DNA ligase (NEB, Beverly, MA, USA). ..

    Sequencing:

    Article Title: Avian photoreceptor homologies and the origin of double cones.
    Article Snippet: Compound Sakura Product code: 4583 T4 polynucleotide kinase New England Biolabs Cat#M0201S BbsI New England Biolabs Cat#R0539S Q5 high fidelity 2x Master Mix New England Biolabs Cat#M0492S Critical commercial assays Chromium Next GEM Single Cell 3’ kit v3.1 10X Genomics PN-1000121 DNeasy Blood and Tissue Kit QIAGEN Cat#69504 MinElute PCR purification kit QIAGEN Cat#28004 PureLink PCR purification kit (Invitrogen) Thermal Fisher Scientific Cat#K310001 Deposited data Single cell RNA-seq data NCBI Short Read Archive SRA: PRJNA1192504 Experimental models: Organisms/strains Gallus gallus - white Leghorn Charles River Laboratories RRID: NCBITaxon_9031 Anolis carolinensis Carolina Biological Supply RRID: NCBITaxon_28377 Oligonucleotides anti-THRB gRNA g5, GCAGCGATAATGATATCCGG This paper N/A anti-THRB gRNA g6, GATGCAGCGATAATGATATC This paper N/A anti-THRB gRNA g7, TATACCCAGTTACTTAGACA This paper N/A anti-THRB gRNA g8, TCATATTTACAGGAATAGGT This paper N/A non-targeting control (NTC) gRNA, GCACTGCTACGATCTACACC This paper N/A THRB g5,6,7 sequencing primer forward: AGACGTGTGCTCTTCCGATCTG AAATGGAGAAGCTGGAGAGC This paper N/A THRB g5,6,7 sequencing primer reverse: ACACTCTTTCCCTACACGACGCTCTTCCGATCT AGTGTGGGGCTAGTAGACAA This paper N/A (Continued on next page) e1 Current Biology 35, 2215–2227.e1–e6, May 19, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER THRB g8 sequencing primer forward: AGACGTGTGCTCTTCCGATCTG CACAATCTGTTGCCATGCCA This paper N/A THRB g8 sequencing primer reverse: ACACTCTTTCCCTACACGACGCTCTTCCGATCT TGCTGCATACTTAGGTACATTTCT This paper N/A Recombinant DNA pX458-Ef1a-Cas9-H2B-mCherry Addgene Cat#159655 Ac-OPN1LW-GFP Enright et al.24 N/A Software and algorithms Liftoff (v1.6.3) Shumate and Salzberg72 https://github.com/agshumate/Liftoff GMAP (2023-12-01) Wu and Watanabe73 http://research-pub.gene.com/gmap/ annotate_my_genome (v4.0) Farkas et al.74 https://github.com/cfarkas/ annotate_my_genomes AnimalTFDB (v3.0) Hu et al.75 https://guolab.wchscu.cn/AnimalTFDB/ kallisto-bustools (kb-python v0.27.2) Bray et al.76; Melsted et al.77; Melsted et al.78 https://www.kallistobus.tools/ DropletUtils (v1.14.2) Griffiths et al.79; Lun et al.80 https://bioconductor.org/packages/ release/bioc/html/DropletUtils.html Seurat (v5.0.1) Hao et al.81 https://satijalab.org/seurat/ glmGamPoi (v1.6.0) Ahlmann-Eltze et al.82 https://bioconductor.org/packages/ release/bioc/html/glmGamPoi.html scDblFinder (v1.8.0) Germain et al.30 https://www.bioconductor.org/packages/ release/bioc/html/scDblFinder.html qvalue (v2.26.0) Storey et al.83 https://www.bioconductor.org/packages/ release/bioc/html/qvalue.html Monocle 3 (v1.3.4) Trapnell et al.84 https://cole-trapnell-lab.github.io/ monocle3/ CRISPResso2 (v2.1.3) Clement et al.65 http://crispresso2.pinellolab.org/ submission CHOPCHOP (v3) Labun et al.85 https://chopchop.cbu.uib.no/ de-goulash Kulhankova et al.86 https://github.com/genid/de-goulash Other Corbo Lab code repository This paper https://doi.org/10.5281/zenodo.14884261 .. Fertilized specific-pathogen-free white Leghorn chicken (Gallus gallus domesticus) eggs (Charles River Laboratories or AvsBio, Norwich, CT) were stored at 14 C until incubation was initiated.

    Recombinant:

    Article Title: Avian photoreceptor homologies and the origin of double cones.
    Article Snippet: Compound Sakura Product code: 4583 T4 polynucleotide kinase New England Biolabs Cat#M0201S BbsI New England Biolabs Cat#R0539S Q5 high fidelity 2x Master Mix New England Biolabs Cat#M0492S Critical commercial assays Chromium Next GEM Single Cell 3’ kit v3.1 10X Genomics PN-1000121 DNeasy Blood and Tissue Kit QIAGEN Cat#69504 MinElute PCR purification kit QIAGEN Cat#28004 PureLink PCR purification kit (Invitrogen) Thermal Fisher Scientific Cat#K310001 Deposited data Single cell RNA-seq data NCBI Short Read Archive SRA: PRJNA1192504 Experimental models: Organisms/strains Gallus gallus - white Leghorn Charles River Laboratories RRID: NCBITaxon_9031 Anolis carolinensis Carolina Biological Supply RRID: NCBITaxon_28377 Oligonucleotides anti-THRB gRNA g5, GCAGCGATAATGATATCCGG This paper N/A anti-THRB gRNA g6, GATGCAGCGATAATGATATC This paper N/A anti-THRB gRNA g7, TATACCCAGTTACTTAGACA This paper N/A anti-THRB gRNA g8, TCATATTTACAGGAATAGGT This paper N/A non-targeting control (NTC) gRNA, GCACTGCTACGATCTACACC This paper N/A THRB g5,6,7 sequencing primer forward: AGACGTGTGCTCTTCCGATCTG AAATGGAGAAGCTGGAGAGC This paper N/A THRB g5,6,7 sequencing primer reverse: ACACTCTTTCCCTACACGACGCTCTTCCGATCT AGTGTGGGGCTAGTAGACAA This paper N/A (Continued on next page) e1 Current Biology 35, 2215–2227.e1–e6, May 19, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER THRB g8 sequencing primer forward: AGACGTGTGCTCTTCCGATCTG CACAATCTGTTGCCATGCCA This paper N/A THRB g8 sequencing primer reverse: ACACTCTTTCCCTACACGACGCTCTTCCGATCT TGCTGCATACTTAGGTACATTTCT This paper N/A Recombinant DNA pX458-Ef1a-Cas9-H2B-mCherry Addgene Cat#159655 Ac-OPN1LW-GFP Enright et al.24 N/A Software and algorithms Liftoff (v1.6.3) Shumate and Salzberg72 https://github.com/agshumate/Liftoff GMAP (2023-12-01) Wu and Watanabe73 http://research-pub.gene.com/gmap/ annotate_my_genome (v4.0) Farkas et al.74 https://github.com/cfarkas/ annotate_my_genomes AnimalTFDB (v3.0) Hu et al.75 https://guolab.wchscu.cn/AnimalTFDB/ kallisto-bustools (kb-python v0.27.2) Bray et al.76; Melsted et al.77; Melsted et al.78 https://www.kallistobus.tools/ DropletUtils (v1.14.2) Griffiths et al.79; Lun et al.80 https://bioconductor.org/packages/ release/bioc/html/DropletUtils.html Seurat (v5.0.1) Hao et al.81 https://satijalab.org/seurat/ glmGamPoi (v1.6.0) Ahlmann-Eltze et al.82 https://bioconductor.org/packages/ release/bioc/html/glmGamPoi.html scDblFinder (v1.8.0) Germain et al.30 https://www.bioconductor.org/packages/ release/bioc/html/scDblFinder.html qvalue (v2.26.0) Storey et al.83 https://www.bioconductor.org/packages/ release/bioc/html/qvalue.html Monocle 3 (v1.3.4) Trapnell et al.84 https://cole-trapnell-lab.github.io/ monocle3/ CRISPResso2 (v2.1.3) Clement et al.65 http://crispresso2.pinellolab.org/ submission CHOPCHOP (v3) Labun et al.85 https://chopchop.cbu.uib.no/ de-goulash Kulhankova et al.86 https://github.com/genid/de-goulash Other Corbo Lab code repository This paper https://doi.org/10.5281/zenodo.14884261 .. Fertilized specific-pathogen-free white Leghorn chicken (Gallus gallus domesticus) eggs (Charles River Laboratories or AvsBio, Norwich, CT) were stored at 14 C until incubation was initiated.

    Software:

    Article Title: Avian photoreceptor homologies and the origin of double cones.
    Article Snippet: Compound Sakura Product code: 4583 T4 polynucleotide kinase New England Biolabs Cat#M0201S BbsI New England Biolabs Cat#R0539S Q5 high fidelity 2x Master Mix New England Biolabs Cat#M0492S Critical commercial assays Chromium Next GEM Single Cell 3’ kit v3.1 10X Genomics PN-1000121 DNeasy Blood and Tissue Kit QIAGEN Cat#69504 MinElute PCR purification kit QIAGEN Cat#28004 PureLink PCR purification kit (Invitrogen) Thermal Fisher Scientific Cat#K310001 Deposited data Single cell RNA-seq data NCBI Short Read Archive SRA: PRJNA1192504 Experimental models: Organisms/strains Gallus gallus - white Leghorn Charles River Laboratories RRID: NCBITaxon_9031 Anolis carolinensis Carolina Biological Supply RRID: NCBITaxon_28377 Oligonucleotides anti-THRB gRNA g5, GCAGCGATAATGATATCCGG This paper N/A anti-THRB gRNA g6, GATGCAGCGATAATGATATC This paper N/A anti-THRB gRNA g7, TATACCCAGTTACTTAGACA This paper N/A anti-THRB gRNA g8, TCATATTTACAGGAATAGGT This paper N/A non-targeting control (NTC) gRNA, GCACTGCTACGATCTACACC This paper N/A THRB g5,6,7 sequencing primer forward: AGACGTGTGCTCTTCCGATCTG AAATGGAGAAGCTGGAGAGC This paper N/A THRB g5,6,7 sequencing primer reverse: ACACTCTTTCCCTACACGACGCTCTTCCGATCT AGTGTGGGGCTAGTAGACAA This paper N/A (Continued on next page) e1 Current Biology 35, 2215–2227.e1–e6, May 19, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER THRB g8 sequencing primer forward: AGACGTGTGCTCTTCCGATCTG CACAATCTGTTGCCATGCCA This paper N/A THRB g8 sequencing primer reverse: ACACTCTTTCCCTACACGACGCTCTTCCGATCT TGCTGCATACTTAGGTACATTTCT This paper N/A Recombinant DNA pX458-Ef1a-Cas9-H2B-mCherry Addgene Cat#159655 Ac-OPN1LW-GFP Enright et al.24 N/A Software and algorithms Liftoff (v1.6.3) Shumate and Salzberg72 https://github.com/agshumate/Liftoff GMAP (2023-12-01) Wu and Watanabe73 http://research-pub.gene.com/gmap/ annotate_my_genome (v4.0) Farkas et al.74 https://github.com/cfarkas/ annotate_my_genomes AnimalTFDB (v3.0) Hu et al.75 https://guolab.wchscu.cn/AnimalTFDB/ kallisto-bustools (kb-python v0.27.2) Bray et al.76; Melsted et al.77; Melsted et al.78 https://www.kallistobus.tools/ DropletUtils (v1.14.2) Griffiths et al.79; Lun et al.80 https://bioconductor.org/packages/ release/bioc/html/DropletUtils.html Seurat (v5.0.1) Hao et al.81 https://satijalab.org/seurat/ glmGamPoi (v1.6.0) Ahlmann-Eltze et al.82 https://bioconductor.org/packages/ release/bioc/html/glmGamPoi.html scDblFinder (v1.8.0) Germain et al.30 https://www.bioconductor.org/packages/ release/bioc/html/scDblFinder.html qvalue (v2.26.0) Storey et al.83 https://www.bioconductor.org/packages/ release/bioc/html/qvalue.html Monocle 3 (v1.3.4) Trapnell et al.84 https://cole-trapnell-lab.github.io/ monocle3/ CRISPResso2 (v2.1.3) Clement et al.65 http://crispresso2.pinellolab.org/ submission CHOPCHOP (v3) Labun et al.85 https://chopchop.cbu.uib.no/ de-goulash Kulhankova et al.86 https://github.com/genid/de-goulash Other Corbo Lab code repository This paper https://doi.org/10.5281/zenodo.14884261 .. Fertilized specific-pathogen-free white Leghorn chicken (Gallus gallus domesticus) eggs (Charles River Laboratories or AvsBio, Norwich, CT) were stored at 14 C until incubation was initiated.



    Similar Products

    transsignal sh2 domain array  (Panomics Inc)
    90
    Panomics Inc transsignal sh2 domain array
    Transsignal Sh2 Domain Array, supplied by Panomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sh2+array/transignal+sh3+domain+array/us08986687-71-1-5
    Average 90 stars, based on 1 article reviews
    transsignal sh2 domain array - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    transignaltm sh2 domain arrays panomics cat. no. ma3040  (Panomics Inc)
    90
    Panomics Inc transignaltm sh2 domain arrays panomics cat. no. ma3040
    Src <t>SH2</t> binding to cortactin does not involve tyrosine phosphorylation and binds cortactin repeats 1 and 5. (A) GST and GST-Src SH2 affinity precipitation from MTLn3 cells evaluated for cortactin tyrosine phosphorylation. The ratio of phosphorylated cortactin levels and the normalized amounts of total precipitated cortactin are indicated. (B) Src SH2 far western analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants. TYM, triple tyrosine mutant. (C) Affinity precipitation analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants from extracts with GST-Src SH2 domain. (D) Affinity precipitation of non-phosphorylated, recombinant cortactin with GST and GST-Src SH2. Normalized intensity levels are shown relative to GST control. (E) GST-SH2 domain far western blotting of the cortactin NTA and repeats region. CT, C terminus; LC, IgG light chain; NT, N terminus. Arrows denote position of IgG heavy chain (HC) recognized by cross reactivity with secondary antibodies during the blotting process. Asterisks indicate the positions of recombinant cortactin proteins. (F) GST-SH2 far western analysis of cortactin deletion cortactin constructs. (G) Far western binding of the GST-Src SH2 domain to tandem cortactin repeat chimeric constructs.
    Transignaltm Sh2 Domain Arrays Panomics Cat. No. Ma3040, supplied by Panomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sh2+array/transignaltm+sh2+domain+arrays+panomics+cat++no++ma3040/pmc03585525-405-2-6
    Average 90 stars, based on 1 article reviews
    transignaltm sh2 domain arrays panomics cat. no. ma3040 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    sh2 array  (Panomics Inc)
    90
    Panomics Inc sh2 array
    Src <t>SH2</t> binding to cortactin does not involve tyrosine phosphorylation and binds cortactin repeats 1 and 5. (A) GST and GST-Src SH2 affinity precipitation from MTLn3 cells evaluated for cortactin tyrosine phosphorylation. The ratio of phosphorylated cortactin levels and the normalized amounts of total precipitated cortactin are indicated. (B) Src SH2 far western analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants. TYM, triple tyrosine mutant. (C) Affinity precipitation analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants from extracts with GST-Src SH2 domain. (D) Affinity precipitation of non-phosphorylated, recombinant cortactin with GST and GST-Src SH2. Normalized intensity levels are shown relative to GST control. (E) GST-SH2 domain far western blotting of the cortactin NTA and repeats region. CT, C terminus; LC, IgG light chain; NT, N terminus. Arrows denote position of IgG heavy chain (HC) recognized by cross reactivity with secondary antibodies during the blotting process. Asterisks indicate the positions of recombinant cortactin proteins. (F) GST-SH2 far western analysis of cortactin deletion cortactin constructs. (G) Far western binding of the GST-Src SH2 domain to tandem cortactin repeat chimeric constructs.
    Sh2 Array, supplied by Panomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sh2+array/sh2+array/pmc03109159-140-17-16
    Average 90 stars, based on 1 article reviews
    sh2 array - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    protein domain array membranes containing sh2, sh3, pdz, or ww domains  (Panomics Inc)
    90
    Panomics Inc protein domain array membranes containing sh2, sh3, pdz, or ww domains
    Src <t>SH2</t> binding to cortactin does not involve tyrosine phosphorylation and binds cortactin repeats 1 and 5. (A) GST and GST-Src SH2 affinity precipitation from MTLn3 cells evaluated for cortactin tyrosine phosphorylation. The ratio of phosphorylated cortactin levels and the normalized amounts of total precipitated cortactin are indicated. (B) Src SH2 far western analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants. TYM, triple tyrosine mutant. (C) Affinity precipitation analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants from extracts with GST-Src SH2 domain. (D) Affinity precipitation of non-phosphorylated, recombinant cortactin with GST and GST-Src SH2. Normalized intensity levels are shown relative to GST control. (E) GST-SH2 domain far western blotting of the cortactin NTA and repeats region. CT, C terminus; LC, IgG light chain; NT, N terminus. Arrows denote position of IgG heavy chain (HC) recognized by cross reactivity with secondary antibodies during the blotting process. Asterisks indicate the positions of recombinant cortactin proteins. (F) GST-SH2 far western analysis of cortactin deletion cortactin constructs. (G) Far western binding of the GST-Src SH2 domain to tandem cortactin repeat chimeric constructs.
    Protein Domain Array Membranes Containing Sh2, Sh3, Pdz, Or Ww Domains, supplied by Panomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sh2+array/protein+domain+array+membranes+containing+sh2++sh3++pdz++or+ww+domains/pm20859618-39-0-15
    Average 90 stars, based on 1 article reviews
    protein domain array membranes containing sh2, sh3, pdz, or ww domains - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    sh2 domain array  (Panomics Inc)
    90
    Panomics Inc sh2 domain array
    Src <t>SH2</t> binding to cortactin does not involve tyrosine phosphorylation and binds cortactin repeats 1 and 5. (A) GST and GST-Src SH2 affinity precipitation from MTLn3 cells evaluated for cortactin tyrosine phosphorylation. The ratio of phosphorylated cortactin levels and the normalized amounts of total precipitated cortactin are indicated. (B) Src SH2 far western analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants. TYM, triple tyrosine mutant. (C) Affinity precipitation analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants from extracts with GST-Src SH2 domain. (D) Affinity precipitation of non-phosphorylated, recombinant cortactin with GST and GST-Src SH2. Normalized intensity levels are shown relative to GST control. (E) GST-SH2 domain far western blotting of the cortactin NTA and repeats region. CT, C terminus; LC, IgG light chain; NT, N terminus. Arrows denote position of IgG heavy chain (HC) recognized by cross reactivity with secondary antibodies during the blotting process. Asterisks indicate the positions of recombinant cortactin proteins. (F) GST-SH2 far western analysis of cortactin deletion cortactin constructs. (G) Far western binding of the GST-Src SH2 domain to tandem cortactin repeat chimeric constructs.
    Sh2 Domain Array, supplied by Panomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sh2+array/sh3+domain+arrays/pmc02637999-60-7-18
    Average 90 stars, based on 1 article reviews
    sh2 domain array - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    transignaltm sh2 domain array  (Panomics Inc)
    90
    Panomics Inc transignaltm sh2 domain array
    Src <t>SH2</t> binding to cortactin does not involve tyrosine phosphorylation and binds cortactin repeats 1 and 5. (A) GST and GST-Src SH2 affinity precipitation from MTLn3 cells evaluated for cortactin tyrosine phosphorylation. The ratio of phosphorylated cortactin levels and the normalized amounts of total precipitated cortactin are indicated. (B) Src SH2 far western analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants. TYM, triple tyrosine mutant. (C) Affinity precipitation analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants from extracts with GST-Src SH2 domain. (D) Affinity precipitation of non-phosphorylated, recombinant cortactin with GST and GST-Src SH2. Normalized intensity levels are shown relative to GST control. (E) GST-SH2 domain far western blotting of the cortactin NTA and repeats region. CT, C terminus; LC, IgG light chain; NT, N terminus. Arrows denote position of IgG heavy chain (HC) recognized by cross reactivity with secondary antibodies during the blotting process. Asterisks indicate the positions of recombinant cortactin proteins. (F) GST-SH2 far western analysis of cortactin deletion cortactin constructs. (G) Far western binding of the GST-Src SH2 domain to tandem cortactin repeat chimeric constructs.
    Transignaltm Sh2 Domain Array, supplied by Panomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sh2+array/transignal+sh3+domain+array/pmc02637999-132-1-6
    Average 90 stars, based on 1 article reviews
    transignaltm sh2 domain array - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    an sh2 domain array  (Panomics Inc)
    90
    Panomics Inc an sh2 domain array
    Src <t>SH2</t> binding to cortactin does not involve tyrosine phosphorylation and binds cortactin repeats 1 and 5. (A) GST and GST-Src SH2 affinity precipitation from MTLn3 cells evaluated for cortactin tyrosine phosphorylation. The ratio of phosphorylated cortactin levels and the normalized amounts of total precipitated cortactin are indicated. (B) Src SH2 far western analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants. TYM, triple tyrosine mutant. (C) Affinity precipitation analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants from extracts with GST-Src SH2 domain. (D) Affinity precipitation of non-phosphorylated, recombinant cortactin with GST and GST-Src SH2. Normalized intensity levels are shown relative to GST control. (E) GST-SH2 domain far western blotting of the cortactin NTA and repeats region. CT, C terminus; LC, IgG light chain; NT, N terminus. Arrows denote position of IgG heavy chain (HC) recognized by cross reactivity with secondary antibodies during the blotting process. Asterisks indicate the positions of recombinant cortactin proteins. (F) GST-SH2 far western analysis of cortactin deletion cortactin constructs. (G) Far western binding of the GST-Src SH2 domain to tandem cortactin repeat chimeric constructs.
    An Sh2 Domain Array, supplied by Panomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sh2+array/sh3+domain+arrays/10__1074_slash_jbc__m801319200-69-8-14
    Average 90 stars, based on 1 article reviews
    an sh2 domain array - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Src SH2 binding to cortactin does not involve tyrosine phosphorylation and binds cortactin repeats 1 and 5. (A) GST and GST-Src SH2 affinity precipitation from MTLn3 cells evaluated for cortactin tyrosine phosphorylation. The ratio of phosphorylated cortactin levels and the normalized amounts of total precipitated cortactin are indicated. (B) Src SH2 far western analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants. TYM, triple tyrosine mutant. (C) Affinity precipitation analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants from extracts with GST-Src SH2 domain. (D) Affinity precipitation of non-phosphorylated, recombinant cortactin with GST and GST-Src SH2. Normalized intensity levels are shown relative to GST control. (E) GST-SH2 domain far western blotting of the cortactin NTA and repeats region. CT, C terminus; LC, IgG light chain; NT, N terminus. Arrows denote position of IgG heavy chain (HC) recognized by cross reactivity with secondary antibodies during the blotting process. Asterisks indicate the positions of recombinant cortactin proteins. (F) GST-SH2 far western analysis of cortactin deletion cortactin constructs. (G) Far western binding of the GST-Src SH2 domain to tandem cortactin repeat chimeric constructs.

    Journal: Journal of Cell Science

    Article Title: Src binds cortactin through an SH2 domain cystine-mediated linkage

    doi: 10.1242/jcs.121046

    Figure Lengend Snippet: Src SH2 binding to cortactin does not involve tyrosine phosphorylation and binds cortactin repeats 1 and 5. (A) GST and GST-Src SH2 affinity precipitation from MTLn3 cells evaluated for cortactin tyrosine phosphorylation. The ratio of phosphorylated cortactin levels and the normalized amounts of total precipitated cortactin are indicated. (B) Src SH2 far western analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants. TYM, triple tyrosine mutant. (C) Affinity precipitation analysis of FLAG-tagged recombinant wild-type and cortactin phosphorylation mutants from extracts with GST-Src SH2 domain. (D) Affinity precipitation of non-phosphorylated, recombinant cortactin with GST and GST-Src SH2. Normalized intensity levels are shown relative to GST control. (E) GST-SH2 domain far western blotting of the cortactin NTA and repeats region. CT, C terminus; LC, IgG light chain; NT, N terminus. Arrows denote position of IgG heavy chain (HC) recognized by cross reactivity with secondary antibodies during the blotting process. Asterisks indicate the positions of recombinant cortactin proteins. (F) GST-SH2 far western analysis of cortactin deletion cortactin constructs. (G) Far western binding of the GST-Src SH2 domain to tandem cortactin repeat chimeric constructs.

    Article Snippet: Screening of TransignalTM SH2 Domain Arrays (Panomics Cat. NO. MA3040) was conducted using 1.0 mg of each cortactin peptide according to the manufacturer's protocol.

    Techniques: Binding Assay, Phospho-proteomics, Affinity Precipitation, Western Blot, Recombinant, Mutagenesis, Control, Far Western Blot, Construct

    Cortactin cysteines 112 and 246 are required for Src SH2 domain binding. (A) Alignment of cortactin repeats denoting C112 and C246. (B,C) Far western blotting of GST-Src SH2 domain with cortactin cysteine to alanine mutants. CT, C terminus; HC, IgG heavy chain; LC, IgG light chain; NT, N terminus; WT; full-length wild-type cortactin. Dashed line separates HC from chimeric cortactin proteins (asterisks) due to similar molecular weights. (D) Far western analysis of Src SH2 domain binding to the C112/C246A cortactin double cysteine mutant (DCM). (E) Affinity precipitation analysis of Src SH2 domain binding to the C112/C246A cortactin double cysteine mutant (DCM).

    Journal: Journal of Cell Science

    Article Title: Src binds cortactin through an SH2 domain cystine-mediated linkage

    doi: 10.1242/jcs.121046

    Figure Lengend Snippet: Cortactin cysteines 112 and 246 are required for Src SH2 domain binding. (A) Alignment of cortactin repeats denoting C112 and C246. (B,C) Far western blotting of GST-Src SH2 domain with cortactin cysteine to alanine mutants. CT, C terminus; HC, IgG heavy chain; LC, IgG light chain; NT, N terminus; WT; full-length wild-type cortactin. Dashed line separates HC from chimeric cortactin proteins (asterisks) due to similar molecular weights. (D) Far western analysis of Src SH2 domain binding to the C112/C246A cortactin double cysteine mutant (DCM). (E) Affinity precipitation analysis of Src SH2 domain binding to the C112/C246A cortactin double cysteine mutant (DCM).

    Article Snippet: Screening of TransignalTM SH2 Domain Arrays (Panomics Cat. NO. MA3040) was conducted using 1.0 mg of each cortactin peptide according to the manufacturer's protocol.

    Techniques: Binding Assay, Far Western Blot, Western Blot, Mutagenesis, Affinity Precipitation

    Cysteine-containing cortactin peptides dock within the Src SH2 phosphotyrosine binding region. (A) Molecular modelling of the Src SH2 domain with phosphorylated Src and cortactin pentapeptides. Enlarged views show position of Src R175, Src C185 and the respective central Src or cortactin peptide residues. (B) Calculated binding energies for each peptide docking condition shown in (A).

    Journal: Journal of Cell Science

    Article Title: Src binds cortactin through an SH2 domain cystine-mediated linkage

    doi: 10.1242/jcs.121046

    Figure Lengend Snippet: Cysteine-containing cortactin peptides dock within the Src SH2 phosphotyrosine binding region. (A) Molecular modelling of the Src SH2 domain with phosphorylated Src and cortactin pentapeptides. Enlarged views show position of Src R175, Src C185 and the respective central Src or cortactin peptide residues. (B) Calculated binding energies for each peptide docking condition shown in (A).

    Article Snippet: Screening of TransignalTM SH2 Domain Arrays (Panomics Cat. NO. MA3040) was conducted using 1.0 mg of each cortactin peptide according to the manufacturer's protocol.

    Techniques: Binding Assay

    Binding and phosphorylation of cortactin by Src is redox dependent and requires Src C185. (A) Co-immunoprecipitation (IP) of cortactin with Src followed by analysis under reducing (R) and non-reducing (NR) conditions. Asterisks denote equivalent bands in cortactin and Src immunoblots. (B) Co-immunoprecipitation of Src with cortactin followed by analysis under reducing (R) and non-reducing (NR) conditions. Asterisks denote equivalent bands in cortactin and Src immunoblots. (C) Phosphorylation of cortactin by Src in the absence and presence of DTT. (D) Far western analysis of GST-Src SH2 and C185A. (E) Affinity precipitation analysis of FAK and cortactin binding to GST-Src SH2 C185A.

    Journal: Journal of Cell Science

    Article Title: Src binds cortactin through an SH2 domain cystine-mediated linkage

    doi: 10.1242/jcs.121046

    Figure Lengend Snippet: Binding and phosphorylation of cortactin by Src is redox dependent and requires Src C185. (A) Co-immunoprecipitation (IP) of cortactin with Src followed by analysis under reducing (R) and non-reducing (NR) conditions. Asterisks denote equivalent bands in cortactin and Src immunoblots. (B) Co-immunoprecipitation of Src with cortactin followed by analysis under reducing (R) and non-reducing (NR) conditions. Asterisks denote equivalent bands in cortactin and Src immunoblots. (C) Phosphorylation of cortactin by Src in the absence and presence of DTT. (D) Far western analysis of GST-Src SH2 and C185A. (E) Affinity precipitation analysis of FAK and cortactin binding to GST-Src SH2 C185A.

    Article Snippet: Screening of TransignalTM SH2 Domain Arrays (Panomics Cat. NO. MA3040) was conducted using 1.0 mg of each cortactin peptide according to the manufacturer's protocol.

    Techniques: Binding Assay, Phospho-proteomics, Immunoprecipitation, Western Blot, Affinity Precipitation

    Src C185 forms a cystine bond with cortactin C112 and C246. (A) Sequence of the predicted Src SH2 domain tryptic fragment containing C185. Predicted cystine bonding between Src C185 and the cortactin C112 and C246 tryptic peptides with predicted masses are shown below. (B–D) Extracted ion chromatogram (left) and ion fragmentation spectra (right) from tandem LC-MS/MS of the GST-Src SH2 domain (B), the GST-SH2 domain with the cortactin C112 peptide (C) and the GST-SH2 domain with cortactin C246 peptide (D). Spectra were enlarged to indicate the position of the Src C185 b4 ion (boxed in red).

    Journal: Journal of Cell Science

    Article Title: Src binds cortactin through an SH2 domain cystine-mediated linkage

    doi: 10.1242/jcs.121046

    Figure Lengend Snippet: Src C185 forms a cystine bond with cortactin C112 and C246. (A) Sequence of the predicted Src SH2 domain tryptic fragment containing C185. Predicted cystine bonding between Src C185 and the cortactin C112 and C246 tryptic peptides with predicted masses are shown below. (B–D) Extracted ion chromatogram (left) and ion fragmentation spectra (right) from tandem LC-MS/MS of the GST-Src SH2 domain (B), the GST-SH2 domain with the cortactin C112 peptide (C) and the GST-SH2 domain with cortactin C246 peptide (D). Spectra were enlarged to indicate the position of the Src C185 b4 ion (boxed in red).

    Article Snippet: Screening of TransignalTM SH2 Domain Arrays (Panomics Cat. NO. MA3040) was conducted using 1.0 mg of each cortactin peptide according to the manufacturer's protocol.

    Techniques: Sequencing, Liquid Chromatography with Mass Spectroscopy

    Observed and predicted ion masses of GST-Src-SH2, GST-Src-SH2 + cortactin C112 and GST-Src-SH2 + cortactin C246 tryptic peptides

    Journal: Journal of Cell Science

    Article Title: Src binds cortactin through an SH2 domain cystine-mediated linkage

    doi: 10.1242/jcs.121046

    Figure Lengend Snippet: Observed and predicted ion masses of GST-Src-SH2, GST-Src-SH2 + cortactin C112 and GST-Src-SH2 + cortactin C246 tryptic peptides

    Article Snippet: Screening of TransignalTM SH2 Domain Arrays (Panomics Cat. NO. MA3040) was conducted using 1.0 mg of each cortactin peptide according to the manufacturer's protocol.

    Techniques:

    Model of cysteine-mediated interactions in cortactin regulation. (A) Model of cysteine-based cortactin activation and phosphorylation by Src. (B) Phylogenetic co-conservation of cortactin C112/246 and Src C185. Conserved cysteines are in red and the homologous positions highlighted in yellow. (C) Cartoon representation of Src SH2 binding to phosphotyrosine and cysteine residues. Src amino acids 172–191 within the SH2 domain binding pocket are in white; interacting arginine 175 and cysteine 185 residues are in red. Cystine bonding is indicated as a red line. Phosphotyrosine and cystine binding ligands are listed. (D) Alignment of cysteine-containing SH2 domains. Domains known to bind ligands in a phosphotyrosine-independent manner are in bold italics. Cysteine residues are in red. Shading: green; hydrophobic, blue; positively charged, red; negatively charged, yellow; polar.

    Journal: Journal of Cell Science

    Article Title: Src binds cortactin through an SH2 domain cystine-mediated linkage

    doi: 10.1242/jcs.121046

    Figure Lengend Snippet: Model of cysteine-mediated interactions in cortactin regulation. (A) Model of cysteine-based cortactin activation and phosphorylation by Src. (B) Phylogenetic co-conservation of cortactin C112/246 and Src C185. Conserved cysteines are in red and the homologous positions highlighted in yellow. (C) Cartoon representation of Src SH2 binding to phosphotyrosine and cysteine residues. Src amino acids 172–191 within the SH2 domain binding pocket are in white; interacting arginine 175 and cysteine 185 residues are in red. Cystine bonding is indicated as a red line. Phosphotyrosine and cystine binding ligands are listed. (D) Alignment of cysteine-containing SH2 domains. Domains known to bind ligands in a phosphotyrosine-independent manner are in bold italics. Cysteine residues are in red. Shading: green; hydrophobic, blue; positively charged, red; negatively charged, yellow; polar.

    Article Snippet: Screening of TransignalTM SH2 Domain Arrays (Panomics Cat. NO. MA3040) was conducted using 1.0 mg of each cortactin peptide according to the manufacturer's protocol.

    Techniques: Activation Assay, Phospho-proteomics, Binding Assay