Review



gpx4 for ip  (Novus Biologicals)


Bioz Verified Symbol Novus Biologicals is a verified supplier
Bioz Manufacturer Symbol Novus Biologicals manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Novus Biologicals gpx4 for ip
    a Ontologies (GREAT analysis) derived from ZNF354A ChIP-seq peaks in HEK293T cells. Histogram displays enriched annotation terms ranked by binomial p value, indicating functional categories significantly associated with ZNF354A-bound genomic regions . b Volcano plot of RNA-seq analysis from U2OS cells (siControl-Ctrl vs. siZNF354A, 72 h), displaying expression changes of 22586 transcripts. Log2 fold change (FC) vs. −log10 P value plotted. Highlighted genes involved in GSH synthesis (MAT1A, SLC7A11, GSTO2, MGST, CTH), iron metabolism (HMOX1, FTH), and mevalonate pathway (HMGCR). Black dots: significantly upregulated genes (FC > 2, P < 0.05). P values were corrected for multiple testing using the Benjamini-Hochberg’s method c Gene Set Enrichment Analysis (GSEA) dot plot highlighting significantly enriched GO-terms in siZNF354A cells. Gene count, gene ratio, and specific p-values indicated. Enrichment scores and p values were computed by permutation testing (10,000 permutations) using ranked gene lists. d GSEA plots for Biological Process BP and Cellular Component CC GO categories. e Model overview of ZNF354A-regulated selenium-/thiol-dependent and independent pathways in phospholipid peroxide detoxification. ZNF354A targets highlighted in green. Main proteins/pathways upregulated by ZNF354A depletion are indicated (see Supplementary Table ). In thiol-dependent pathways <t>GPX4</t> converts phospholipid hydroperoxides (PL-OOH) to alcohols (PL-OH), dependent on glutathione (GSH) synthesis via cystine uptake and reduction. The methionine cycle contributes with precursors. In parallel the NAD(P)H/FSP1/ubiquinone system reduces peroxyl radicals in phospholipids (PLOO•). SLC7A11 (xCT) cystine/glutamate antiporter; TXNRD1 thioredoxin reductase-1; CTH γ-cystathionase; MAT1A methionine adenosyltransferase; GSTs GSH-S-transferases; GSR GSH-disulfide reductase; GPX4 glutathione peroxidase-4; GSSG oxidized glutathione; FSP1 ferroptosis suppressor protein; CoQ10H2 ubiquinol; CoQ10(H), ubiquinone; SEPHS2 selenophosphate synthetase-2; FTH ferritin heavy chain-1; HMGC , 3-hydroxy-3-methylglutaryl-CoA reductase. Created in BioRender. Abrami, L. ( https://BioRender.com/mmywn2r ). Source data provided as a Source Data file. See Data Availability or ( https://tronoapps.epfl.ch/web/krabopedia/ ) for full datasets.
    Gpx4 For Ip, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setdb1/SETDB1+Antibody+(5H6A12)+-+BSA+Free/pmc12820049-377-104-113
    Average 93 stars, based on 2 article reviews
    gpx4 for ip - by Bioz Stars, 2026-10
    93/100 stars

    Images

    1) Product Images from "Identification of a lipid oxygen radical defense pathway and its epigenetic control"

    Article Title: Identification of a lipid oxygen radical defense pathway and its epigenetic control

    Journal: Nature Communications

    doi: 10.1038/s41467-025-67304-4

    a Ontologies (GREAT analysis) derived from ZNF354A ChIP-seq peaks in HEK293T cells. Histogram displays enriched annotation terms ranked by binomial p value, indicating functional categories significantly associated with ZNF354A-bound genomic regions . b Volcano plot of RNA-seq analysis from U2OS cells (siControl-Ctrl vs. siZNF354A, 72 h), displaying expression changes of 22586 transcripts. Log2 fold change (FC) vs. −log10 P value plotted. Highlighted genes involved in GSH synthesis (MAT1A, SLC7A11, GSTO2, MGST, CTH), iron metabolism (HMOX1, FTH), and mevalonate pathway (HMGCR). Black dots: significantly upregulated genes (FC > 2, P < 0.05). P values were corrected for multiple testing using the Benjamini-Hochberg’s method c Gene Set Enrichment Analysis (GSEA) dot plot highlighting significantly enriched GO-terms in siZNF354A cells. Gene count, gene ratio, and specific p-values indicated. Enrichment scores and p values were computed by permutation testing (10,000 permutations) using ranked gene lists. d GSEA plots for Biological Process BP and Cellular Component CC GO categories. e Model overview of ZNF354A-regulated selenium-/thiol-dependent and independent pathways in phospholipid peroxide detoxification. ZNF354A targets highlighted in green. Main proteins/pathways upregulated by ZNF354A depletion are indicated (see Supplementary Table ). In thiol-dependent pathways GPX4 converts phospholipid hydroperoxides (PL-OOH) to alcohols (PL-OH), dependent on glutathione (GSH) synthesis via cystine uptake and reduction. The methionine cycle contributes with precursors. In parallel the NAD(P)H/FSP1/ubiquinone system reduces peroxyl radicals in phospholipids (PLOO•). SLC7A11 (xCT) cystine/glutamate antiporter; TXNRD1 thioredoxin reductase-1; CTH γ-cystathionase; MAT1A methionine adenosyltransferase; GSTs GSH-S-transferases; GSR GSH-disulfide reductase; GPX4 glutathione peroxidase-4; GSSG oxidized glutathione; FSP1 ferroptosis suppressor protein; CoQ10H2 ubiquinol; CoQ10(H), ubiquinone; SEPHS2 selenophosphate synthetase-2; FTH ferritin heavy chain-1; HMGC , 3-hydroxy-3-methylglutaryl-CoA reductase. Created in BioRender. Abrami, L. ( https://BioRender.com/mmywn2r ). Source data provided as a Source Data file. See Data Availability or ( https://tronoapps.epfl.ch/web/krabopedia/ ) for full datasets.
    Figure Legend Snippet: a Ontologies (GREAT analysis) derived from ZNF354A ChIP-seq peaks in HEK293T cells. Histogram displays enriched annotation terms ranked by binomial p value, indicating functional categories significantly associated with ZNF354A-bound genomic regions . b Volcano plot of RNA-seq analysis from U2OS cells (siControl-Ctrl vs. siZNF354A, 72 h), displaying expression changes of 22586 transcripts. Log2 fold change (FC) vs. −log10 P value plotted. Highlighted genes involved in GSH synthesis (MAT1A, SLC7A11, GSTO2, MGST, CTH), iron metabolism (HMOX1, FTH), and mevalonate pathway (HMGCR). Black dots: significantly upregulated genes (FC > 2, P < 0.05). P values were corrected for multiple testing using the Benjamini-Hochberg’s method c Gene Set Enrichment Analysis (GSEA) dot plot highlighting significantly enriched GO-terms in siZNF354A cells. Gene count, gene ratio, and specific p-values indicated. Enrichment scores and p values were computed by permutation testing (10,000 permutations) using ranked gene lists. d GSEA plots for Biological Process BP and Cellular Component CC GO categories. e Model overview of ZNF354A-regulated selenium-/thiol-dependent and independent pathways in phospholipid peroxide detoxification. ZNF354A targets highlighted in green. Main proteins/pathways upregulated by ZNF354A depletion are indicated (see Supplementary Table ). In thiol-dependent pathways GPX4 converts phospholipid hydroperoxides (PL-OOH) to alcohols (PL-OH), dependent on glutathione (GSH) synthesis via cystine uptake and reduction. The methionine cycle contributes with precursors. In parallel the NAD(P)H/FSP1/ubiquinone system reduces peroxyl radicals in phospholipids (PLOO•). SLC7A11 (xCT) cystine/glutamate antiporter; TXNRD1 thioredoxin reductase-1; CTH γ-cystathionase; MAT1A methionine adenosyltransferase; GSTs GSH-S-transferases; GSR GSH-disulfide reductase; GPX4 glutathione peroxidase-4; GSSG oxidized glutathione; FSP1 ferroptosis suppressor protein; CoQ10H2 ubiquinol; CoQ10(H), ubiquinone; SEPHS2 selenophosphate synthetase-2; FTH ferritin heavy chain-1; HMGC , 3-hydroxy-3-methylglutaryl-CoA reductase. Created in BioRender. Abrami, L. ( https://BioRender.com/mmywn2r ). Source data provided as a Source Data file. See Data Availability or ( https://tronoapps.epfl.ch/web/krabopedia/ ) for full datasets.

    Techniques Used: Derivative Assay, ChIP-sequencing, Functional Assay, RNA Sequencing, Expressing

    a–c Lipid peroxides measured by flow cytometry (Bodipy-C11, Liperfluo) and membrane permeability (propidium iodide) in U2OS cells transfected with siControl or siZNF354A (72 h) ± RSL3 (3 μM, 24 h). Mean ± SEM; dots indicate biologically independent experiments.; p values compare to siControl, by two-way ANOVA, Tukey’s test. d Viability (ATP detection) of U2OS cells (siControl or siZNF354A, 72 h) ± RSL3 (3 μM) or H₂O₂ (50 µM, 16 h). Mean ± SD; representative assay (of three), n = 36.; p values compare to siControl, by two-way ANOVA, Sidak’s test. e , f Lipid peroxidation ( e ) and viability ( f ) of U2OS cells expressing wild-type (WT) or KRAB-binding mutant ZNF354A ± ferrostatin-1 (Fer-1, 15 µM, added at 0 and 48 h post-transfection). Mean ± SEM and dots represent biologically independent experiments ( e ). Mean ± SD normalized to untreated controls (empty plasmid) of representative assay (of three) n = 33 ( f ). p values compare untreated controls vs Fer-1, by two-way ANOVA, Holm-Sidak’s test. g Viability (as in f) of HeLa cells expressing ZNF354A, supplemented with FSP1, GPX4, GPX4 + N-Acetyl-Cysteine (NAC, 1 mM), or NAC alone. Mean ± SD; representative assay (of three), n = 33.; p values compare untreated controls at each time point, by two-way ANOVA, Sidak’s test. h Cellular level of GSH was measured in control cells and upon silencing of ZNF354A or GPX4 and upon over expression of ZNF354A. Mean ± SEM. and dots represent biologically independent experiments, p values obtained, by two-way ANOVA, Tukey’s test. i , Western blot of total cell extracts (TCE) and ZNF354A immunoprecipitates (IP) from indicated cancer cells, showing Short-S (42 kDa), 20 L isoforms ( ~ 49, 62, 69 kDa), GAPDH (loading control), total ZNF354A, and phospho-Ser/Thr proteins. j Viability (as in d) of cancer cells (from h) ± RSL3 (3 μM) or H₂O₂ (50 µM, 16 h). Viability normalized to untreated controls (100%). Mean ± SD; representative assay ( n = 35). p values compare each condition to HepG2 reference, by two-way ANOVA, Dunnett’s test.
    Figure Legend Snippet: a–c Lipid peroxides measured by flow cytometry (Bodipy-C11, Liperfluo) and membrane permeability (propidium iodide) in U2OS cells transfected with siControl or siZNF354A (72 h) ± RSL3 (3 μM, 24 h). Mean ± SEM; dots indicate biologically independent experiments.; p values compare to siControl, by two-way ANOVA, Tukey’s test. d Viability (ATP detection) of U2OS cells (siControl or siZNF354A, 72 h) ± RSL3 (3 μM) or H₂O₂ (50 µM, 16 h). Mean ± SD; representative assay (of three), n = 36.; p values compare to siControl, by two-way ANOVA, Sidak’s test. e , f Lipid peroxidation ( e ) and viability ( f ) of U2OS cells expressing wild-type (WT) or KRAB-binding mutant ZNF354A ± ferrostatin-1 (Fer-1, 15 µM, added at 0 and 48 h post-transfection). Mean ± SEM and dots represent biologically independent experiments ( e ). Mean ± SD normalized to untreated controls (empty plasmid) of representative assay (of three) n = 33 ( f ). p values compare untreated controls vs Fer-1, by two-way ANOVA, Holm-Sidak’s test. g Viability (as in f) of HeLa cells expressing ZNF354A, supplemented with FSP1, GPX4, GPX4 + N-Acetyl-Cysteine (NAC, 1 mM), or NAC alone. Mean ± SD; representative assay (of three), n = 33.; p values compare untreated controls at each time point, by two-way ANOVA, Sidak’s test. h Cellular level of GSH was measured in control cells and upon silencing of ZNF354A or GPX4 and upon over expression of ZNF354A. Mean ± SEM. and dots represent biologically independent experiments, p values obtained, by two-way ANOVA, Tukey’s test. i , Western blot of total cell extracts (TCE) and ZNF354A immunoprecipitates (IP) from indicated cancer cells, showing Short-S (42 kDa), 20 L isoforms ( ~ 49, 62, 69 kDa), GAPDH (loading control), total ZNF354A, and phospho-Ser/Thr proteins. j Viability (as in d) of cancer cells (from h) ± RSL3 (3 μM) or H₂O₂ (50 µM, 16 h). Viability normalized to untreated controls (100%). Mean ± SD; representative assay ( n = 35). p values compare each condition to HepG2 reference, by two-way ANOVA, Dunnett’s test.

    Techniques Used: Flow Cytometry, Membrane, Permeability, Transfection, Expressing, Binding Assay, Mutagenesis, Plasmid Preparation, Control, Over Expression, Western Blot

    a–d Incorporation of 3 H-palmitic acid ( 3 H-palm) in GPX4 from U2OS cells silenced for 72 h with pooled ( a ) or individual ( c ) ZDHHC siRNAs. Cells were metabolically labeled for 3 h at 37 °C with 3 H-palm; GPX4 was immunoprecipitated (IP-GPX4), resolved by SDS–PAGE, and analyzed by Western blot (WB) and autoradiography ( 3 H-palm). The levels of 3 H-palm incorporation in siControl (Ctrl) were set to 100% and results are mean ± SEM, and each dot represents an independent experiment ( n = 3). p values compare siCtrl, two-way ANOVA, Dunnett’s test. e HEK WT or ZDHHC20-KO cells were incubated with 100 μM C16:0-azide for the indicated times or with palmitic acid for 8 h. Incorporated C16:0-azide was detected by click chemistry with alkyne-mPEG 5 K (200 μM), followed by SDS–PAGE and WB for GPX4. Results are representative of three independent experiments. f–h same as in ( a ), for ( f ), HEK WT (Ctrl) or ZDHHC20-KO cells, recomplemented with empty vector or short/long ZDHHC20 or ( h ) U2OS cells left untreated or treated for 4 h with 50 μM H₂O₂. For f Myc-ZDHHC20 expression was confirmed by WB. The levels of 3 H-palm incorporation were set to 100% in Control-WT cells for g, or untreated control cells, in ( h ). Results are mean ± SEM, and each dot represents an independent experiment ( g ) n = 4 and h n = 6). p values comparing to Ctrl or as indicated by, ( g ) two-way ANOVA, Tukey’s test, and ( h ) Two-tailed Student’s t-test. i Cellular glutathione measured in U2OS cells, siCtrl or siZDHHC20 (72 h) alone or recomplemented with short/long ZDHHC20 (24 h). Data are mean ± SEM from one of three independent experiments ( n = 6). p values by, two-way ANOVA, Tukey’s test j Viability assessed using Promega Glo ATB detection in U2OS cells as in i, treated as in ( h ). Data are mean ± SEM from one of three independent experiments ( n = 36 replicates). p values by, two-way ANOVA, Tukey’s test k Proposed Model: Under homeostasis, ATF2–SETDB1–KAP1–ZNF354A repress antioxidant genes. Lipid peroxide accumulation activates p38/JNK signaling, leading to ZNF354A dissociation and induction of antioxidant responses. Created in BioRender. abrami, I ( https://BioRender.com/gvmrwgl ).
    Figure Legend Snippet: a–d Incorporation of 3 H-palmitic acid ( 3 H-palm) in GPX4 from U2OS cells silenced for 72 h with pooled ( a ) or individual ( c ) ZDHHC siRNAs. Cells were metabolically labeled for 3 h at 37 °C with 3 H-palm; GPX4 was immunoprecipitated (IP-GPX4), resolved by SDS–PAGE, and analyzed by Western blot (WB) and autoradiography ( 3 H-palm). The levels of 3 H-palm incorporation in siControl (Ctrl) were set to 100% and results are mean ± SEM, and each dot represents an independent experiment ( n = 3). p values compare siCtrl, two-way ANOVA, Dunnett’s test. e HEK WT or ZDHHC20-KO cells were incubated with 100 μM C16:0-azide for the indicated times or with palmitic acid for 8 h. Incorporated C16:0-azide was detected by click chemistry with alkyne-mPEG 5 K (200 μM), followed by SDS–PAGE and WB for GPX4. Results are representative of three independent experiments. f–h same as in ( a ), for ( f ), HEK WT (Ctrl) or ZDHHC20-KO cells, recomplemented with empty vector or short/long ZDHHC20 or ( h ) U2OS cells left untreated or treated for 4 h with 50 μM H₂O₂. For f Myc-ZDHHC20 expression was confirmed by WB. The levels of 3 H-palm incorporation were set to 100% in Control-WT cells for g, or untreated control cells, in ( h ). Results are mean ± SEM, and each dot represents an independent experiment ( g ) n = 4 and h n = 6). p values comparing to Ctrl or as indicated by, ( g ) two-way ANOVA, Tukey’s test, and ( h ) Two-tailed Student’s t-test. i Cellular glutathione measured in U2OS cells, siCtrl or siZDHHC20 (72 h) alone or recomplemented with short/long ZDHHC20 (24 h). Data are mean ± SEM from one of three independent experiments ( n = 6). p values by, two-way ANOVA, Tukey’s test j Viability assessed using Promega Glo ATB detection in U2OS cells as in i, treated as in ( h ). Data are mean ± SEM from one of three independent experiments ( n = 36 replicates). p values by, two-way ANOVA, Tukey’s test k Proposed Model: Under homeostasis, ATF2–SETDB1–KAP1–ZNF354A repress antioxidant genes. Lipid peroxide accumulation activates p38/JNK signaling, leading to ZNF354A dissociation and induction of antioxidant responses. Created in BioRender. abrami, I ( https://BioRender.com/gvmrwgl ).

    Techniques Used: Metabolic Labelling, Labeling, Immunoprecipitation, SDS Page, Western Blot, Autoradiography, Incubation, Plasmid Preparation, Expressing, Control, Two Tailed Test

    Related Articles

    Generated:

    Article Title: Identification of a lipid oxygen radical defense pathway and its epigenetic control.
    Article Snippet: .. The antibodies and reagents were acquired from: ATF2 (Abcam: ab_131484; RRID: AB_11156678, rabbit: 1:2000x), ATF2 (Abcam: E243 ab32160, RRID: AB_2243137, rabbit: 1:2000x), phosphor-ATF2 (T69) (Abcam : 131106; RRID: AB_11157608;rabbit:1:1000x), GAPDH (Thermofisher : 398600; RRID: AB_2533438; mouse: 1:4000x), ZDHHC20 (Sigma: SAB4501054; RRID: AB_10744838; rabbit: 1:2000x), HA-HRP (Roche: 112013819001; RRID: AB_390917; rat: 1:5000x), KAP1 (Abcam: ab_109289; RRID: AB_10863057, rabbit: 1:1000x), phosphor-KAP1 S473 was generated in D. TRONO AR TI CL E IN P RE SS laboratory using the following peptide krsrSgegevsgl (rabbit: 1:500x), Nucleocapside N SARS-CoV-2 (Genetex: GTX135357; RRID: AB_2868464; rabbit 1:4000x), FLAG (Sigma: F3165; RRID: AB_259529; mouse: 1:2000x), phosphor-Threonine-Serine (BD: 612548; RRID: AB_399843; rabbit: 1:1000x), GPX4 for WB (Cell Signalling: 52455; RRID: AB_2924984, rabbit: 1:1000x), GPX4 for IP (MA5-49216, RRID: AB_3074874, mouse 1:2000x), SETDB1 (Novus Biologicals: NBP1_51677; RRID: AB_11002952, mouse: 1:2000x), NRF2 (Abnova: H00004780; RRID:566020, mouse: 1:2000x), V5-HRP (Sigma: V2260; RRID: AB_261857, mouse : 1:2000x), Actin (Millipore: MAB1501; RRID: AB_2223041, mouse: 1:4000x), MAT1A (Abcam: 129176; RRID: AB_11145300, rabbit: 1:2000x), ZNF354A (Santa Cruz: 81140; RRID: AB_1131557, mouse: 1:1000x), MAT1A (Abcam: ab1129176, RRID: AB_11145300, rabbit: 1:1000x), Myc (Millipore : 9E10 ,05-419, RRID: AB_309725, mouse: 1:3000x), and HRPconjugated secondary antibodies (GE-Healthcare). .. RSL-3 (Sigma: S8155), Hydrogen Peroxide 30% (Fisher: H/1750/15), Rotenone (Cayman Chemical: CAY13995), Ferrostatin-1 (Sigma: SML0583), Bodipy 581/591 C11 (Sigma: D3861), Liperfluo (Fisher: L248), Propidium Iodide (Thermofisher: P3566), Cell Viability assay (Promega: G9711), JQ1 (Sigma: SML1524), Mithramycin (LKT: M3476), Erastin (Millipore: 329600) , all resuspended in DMSO and Nacetylcysteine (NAC) (Selleckchem: S1623) resuspended in water, with pH adjusted to 7.4). siRNA For human ZNF354A, 3 different siRNA in 3’-UTR were tested and validated, from Qiagen: ZNF354A (TACATCCTTGAGAGAGATGTA), from Santa Cruz (sc-91974), ZNF354A (GTCACGTGATCATCAGAAA), and from Origene , ZNF354A (GAGGTTTATCCATGGAATTAAATACCT). siRNAs against all human ZDHHC genes were the same as previously published 97.

    Article Title: Identification of the Lipid Oxygen Radical Defense pathway and its epigenetic control
    Article Snippet: HELA (ATCC: CCL_2) cells were grown in MEM Media supplemented with 10% fetal calf serum, 1% penicillin–streptomycin, 1% NEAA and 1% glutamine (all media from ThermoFisher Scientific). .. The antibodies and reagents were acquired from: ATF2 (Abcam: ab_131484; RRID: AB_11156678, rabbit: 1:2000x), phosphor-ATF2 (T69) (Abcam : 131106; RRID: AB_11157608;rabbit:1:1000x), GAPDH (Thermofisher : 398600; RRID: AB_2533438; mouse: 1:4000x), ZDHHC20 (Sigma: SAB4501054; RRID: AB_10744838; rabbit: 1:2000x), HA-HRP (Roche: 112013819001; RRID: AB_390917; rat: 1:5000x), KAP1 (Abcam: ab_109289; RRID: AB_10863057, rabbit: 1:1000x), phosphor-KAP1 S473 was generated in D. TRONO laboratory using the following peptide krsrSgegevsgl (rabbit: 1:500x), Nucleocapside N SARS-CoV-2 (Genetex: GTX135357; RRID: AB_2868464; rabbit 1:4000x), FLAG (Sigma: F3165; RRID: AB_259529; mouse: 1:2000x), phosphor-Threonine-Serine (BD: 612548; RRID: AB_399843; rabbit: 1:1000x), GPX4 (Cell Signalling: 52455; RRID: AB_2924984, rabbit: 1:1000x), SETDB1 (Novus Biologicals: NBP1_51677; RRID: AB_11002952, mouse: 1:2000x), NRF2 (Abnova: H00004780; RRID:566020, mouse: 1:2000x), V5-HRP (Sigma: V2260; RRID: AB_261857, mouse : 1:2000x), Actin (Millipore: MAB1501; RRID: AB_2223041, mouse: 1:4000x), MAT1A (Abcam: 129176; RRID: AB_11145300, rabit: 1:2000x), ZNF354A (Santa Cruz: 81140; RRID: AB_1131557, mouse: 1:1000x), 4G10 phospho-Tyrosine (Millipore: 05-321; RRID: AB_309678, mouse: 1:1000x) and HRP-conjugated secondary antibodies (GE-Healthcare). .. RSL-3 (Sigma: S8155), Hydrogen Peroxide 30% (Fisher: H/1750/15), Rotenone (Cayman Chemical: CAY-13995), Ferrostatin-1 (Sigma: SML0583), Bodipy 581/591 C11 (Sigma: D3861), Liperfluo (Fisher: L248), Propidium Iodide (Thermofisher: P3566), Cell Viability assay (Promega: G9711), JQ1 (Sigma: SML-1524), Mithramycin (LKT: M3476), Erastin (Millipore: 329600), all resuspended in DMSO and N-acetylcysteine (Selleckchem: S1623) resuspended in water, with pH adjusted to 7.4).

    Article Title: Identification of a lipid oxygen radical defense pathway and its epigenetic control
    Article Snippet: .. The antibodies and reagents were acquired from: ATF2 (Abcam: ab_131484; RRID: AB_11156678, rabbit: 1:2000x), ATF2 (Abcam: E243 ab32160, RRID: AB_2243137, rabbit: 1:2000x), phosphor-ATF2 (T69) (Abcam: 131106; RRID: AB_11157608;rabbit:1:1000x), GAPDH (Thermofisher: 398600; RRID: AB_2533438; mouse: 1:4000x), ZDHHC20 (Sigma: SAB4501054; RRID: AB_10744838; rabbit: 1:2000x), HA-HRP (Roche: 112013819001; RRID: AB_390917; rat: 1:5000x), KAP1 (Abcam: ab_109289; RRID: AB_10863057, rabbit: 1:1000x), phosphor-KAP1 S473 was generated in D. TRONO laboratory using the following peptide krsrSgegevsgl (rabbit: 1:500x), Nucleocapside N SARS-CoV-2 (Genetex: GTX135357; RRID: AB_2868464; rabbit 1:4000x), FLAG (Sigma: F3165; RRID: AB_259529; mouse: 1:2000x), phosphor-Threonine-Serine (BD: 612548; RRID: AB_399843; rabbit: 1:1000x), GPX4 for WB (Cell Signalling: 52455; RRID: AB_2924984, rabbit: 1:1000x), GPX4 for IP (MA5-49216, RRID: AB_3074874, mouse 1:2000x), SETDB1 (Novus Biologicals: NBP1_51677; RRID: AB_11002952, mouse: 1:2000x), NRF2 (Abnova: H00004780; RRID:566020, mouse: 1:2000x), V5-HRP (Sigma: V2260; RRID: AB_261857, mouse: 1:2000x), Actin (Millipore: MAB1501; RRID: AB_2223041, mouse: 1:4000x), MAT1A (Abcam: 129176; RRID: AB_11145300, rabbit: 1:2000x), ZNF354A (Santa Cruz: 81140; RRID: AB_1131557, mouse: 1:1000x), MAT1A (Abcam: ab1129176, RRID: AB_11145300, rabbit: 1:1000x), Myc (Millipore: 9E10, 05-419, RRID: AB_309725, mouse: 1:3000x), and HRP-conjugated secondary antibodies (GE-Healthcare). .. RSL-3 (Sigma: S8155), Hydrogen Peroxide 30% (Fisher: H/1750/15), Rotenone (Cayman Chemical: CAY-13995), Ferrostatin-1 (Sigma: SML0583), Bodipy 581/591 C11 (Sigma: D3861), Liperfluo (Fisher: L248), Propidium Iodide (Thermofisher: P3566), Cell Viability assay (Promega: G9711), JQ1 (Sigma: SML-1524), Mithramycin (LKT: M3476), Erastin (Millipore: 329600), all resuspended in DMSO and N-acetylcysteine (NAC) (Selleckchem: S1623) resuspended in water, with pH adjusted to 7.4).

    Western Blot:

    Article Title: Identification of a lipid oxygen radical defense pathway and its epigenetic control.
    Article Snippet: .. The antibodies and reagents were acquired from: ATF2 (Abcam: ab_131484; RRID: AB_11156678, rabbit: 1:2000x), ATF2 (Abcam: E243 ab32160, RRID: AB_2243137, rabbit: 1:2000x), phosphor-ATF2 (T69) (Abcam : 131106; RRID: AB_11157608;rabbit:1:1000x), GAPDH (Thermofisher : 398600; RRID: AB_2533438; mouse: 1:4000x), ZDHHC20 (Sigma: SAB4501054; RRID: AB_10744838; rabbit: 1:2000x), HA-HRP (Roche: 112013819001; RRID: AB_390917; rat: 1:5000x), KAP1 (Abcam: ab_109289; RRID: AB_10863057, rabbit: 1:1000x), phosphor-KAP1 S473 was generated in D. TRONO AR TI CL E IN P RE SS laboratory using the following peptide krsrSgegevsgl (rabbit: 1:500x), Nucleocapside N SARS-CoV-2 (Genetex: GTX135357; RRID: AB_2868464; rabbit 1:4000x), FLAG (Sigma: F3165; RRID: AB_259529; mouse: 1:2000x), phosphor-Threonine-Serine (BD: 612548; RRID: AB_399843; rabbit: 1:1000x), GPX4 for WB (Cell Signalling: 52455; RRID: AB_2924984, rabbit: 1:1000x), GPX4 for IP (MA5-49216, RRID: AB_3074874, mouse 1:2000x), SETDB1 (Novus Biologicals: NBP1_51677; RRID: AB_11002952, mouse: 1:2000x), NRF2 (Abnova: H00004780; RRID:566020, mouse: 1:2000x), V5-HRP (Sigma: V2260; RRID: AB_261857, mouse : 1:2000x), Actin (Millipore: MAB1501; RRID: AB_2223041, mouse: 1:4000x), MAT1A (Abcam: 129176; RRID: AB_11145300, rabbit: 1:2000x), ZNF354A (Santa Cruz: 81140; RRID: AB_1131557, mouse: 1:1000x), MAT1A (Abcam: ab1129176, RRID: AB_11145300, rabbit: 1:1000x), Myc (Millipore : 9E10 ,05-419, RRID: AB_309725, mouse: 1:3000x), and HRPconjugated secondary antibodies (GE-Healthcare). .. RSL-3 (Sigma: S8155), Hydrogen Peroxide 30% (Fisher: H/1750/15), Rotenone (Cayman Chemical: CAY13995), Ferrostatin-1 (Sigma: SML0583), Bodipy 581/591 C11 (Sigma: D3861), Liperfluo (Fisher: L248), Propidium Iodide (Thermofisher: P3566), Cell Viability assay (Promega: G9711), JQ1 (Sigma: SML1524), Mithramycin (LKT: M3476), Erastin (Millipore: 329600) , all resuspended in DMSO and Nacetylcysteine (NAC) (Selleckchem: S1623) resuspended in water, with pH adjusted to 7.4). siRNA For human ZNF354A, 3 different siRNA in 3’-UTR were tested and validated, from Qiagen: ZNF354A (TACATCCTTGAGAGAGATGTA), from Santa Cruz (sc-91974), ZNF354A (GTCACGTGATCATCAGAAA), and from Origene , ZNF354A (GAGGTTTATCCATGGAATTAAATACCT). siRNAs against all human ZDHHC genes were the same as previously published 97.

    Article Title: Identification of a lipid oxygen radical defense pathway and its epigenetic control
    Article Snippet: .. The antibodies and reagents were acquired from: ATF2 (Abcam: ab_131484; RRID: AB_11156678, rabbit: 1:2000x), ATF2 (Abcam: E243 ab32160, RRID: AB_2243137, rabbit: 1:2000x), phosphor-ATF2 (T69) (Abcam: 131106; RRID: AB_11157608;rabbit:1:1000x), GAPDH (Thermofisher: 398600; RRID: AB_2533438; mouse: 1:4000x), ZDHHC20 (Sigma: SAB4501054; RRID: AB_10744838; rabbit: 1:2000x), HA-HRP (Roche: 112013819001; RRID: AB_390917; rat: 1:5000x), KAP1 (Abcam: ab_109289; RRID: AB_10863057, rabbit: 1:1000x), phosphor-KAP1 S473 was generated in D. TRONO laboratory using the following peptide krsrSgegevsgl (rabbit: 1:500x), Nucleocapside N SARS-CoV-2 (Genetex: GTX135357; RRID: AB_2868464; rabbit 1:4000x), FLAG (Sigma: F3165; RRID: AB_259529; mouse: 1:2000x), phosphor-Threonine-Serine (BD: 612548; RRID: AB_399843; rabbit: 1:1000x), GPX4 for WB (Cell Signalling: 52455; RRID: AB_2924984, rabbit: 1:1000x), GPX4 for IP (MA5-49216, RRID: AB_3074874, mouse 1:2000x), SETDB1 (Novus Biologicals: NBP1_51677; RRID: AB_11002952, mouse: 1:2000x), NRF2 (Abnova: H00004780; RRID:566020, mouse: 1:2000x), V5-HRP (Sigma: V2260; RRID: AB_261857, mouse: 1:2000x), Actin (Millipore: MAB1501; RRID: AB_2223041, mouse: 1:4000x), MAT1A (Abcam: 129176; RRID: AB_11145300, rabbit: 1:2000x), ZNF354A (Santa Cruz: 81140; RRID: AB_1131557, mouse: 1:1000x), MAT1A (Abcam: ab1129176, RRID: AB_11145300, rabbit: 1:1000x), Myc (Millipore: 9E10, 05-419, RRID: AB_309725, mouse: 1:3000x), and HRP-conjugated secondary antibodies (GE-Healthcare). .. RSL-3 (Sigma: S8155), Hydrogen Peroxide 30% (Fisher: H/1750/15), Rotenone (Cayman Chemical: CAY-13995), Ferrostatin-1 (Sigma: SML0583), Bodipy 581/591 C11 (Sigma: D3861), Liperfluo (Fisher: L248), Propidium Iodide (Thermofisher: P3566), Cell Viability assay (Promega: G9711), JQ1 (Sigma: SML-1524), Mithramycin (LKT: M3476), Erastin (Millipore: 329600), all resuspended in DMSO and N-acetylcysteine (NAC) (Selleckchem: S1623) resuspended in water, with pH adjusted to 7.4).



    Similar Products

    n a rabbit anti setdb1 proteintech  (Proteintech)
    95
    Proteintech n a rabbit anti setdb1 proteintech
    N A Rabbit Anti Setdb1 Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setdb1/SETDB1+Antibody/pm42776838-284-107-110
    Average 95 stars, based on 1 article reviews
    n a rabbit anti setdb1 proteintech - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    anti setdb1  (Proteintech)
    95
    Proteintech anti setdb1
    Anti Setdb1, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setdb1/SETDB1+Antibody/pm41935187-517-26-27
    Average 95 stars, based on 1 article reviews
    anti setdb1 - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    setdb1 huabio em1709 76 wb  (Huabio Inc)
    86
    Huabio Inc setdb1 huabio em1709 76 wb
    Setdb1 Huabio Em1709 76 Wb, supplied by Huabio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setdb1/76+em1709+huabio+setdb1+wb/pm41881308-100-76-77
    Average 86 stars, based on 1 article reviews
    setdb1 huabio em1709 76 wb - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    setdb1  (Proteintech)
    95
    Proteintech setdb1
    ZNF638 knockdown modulated histone modifications of HBV cccDNA microchromosomes. A Nuclear HBV cccDNA pulldown-WB procedures. After transfection with siRNAs targeting ZNF638, TASOR, and <t>SETDB1</t> for 48 h, HepAD38 cells were transferred to Tet-free medium to induce HBV replication and cultured for an additional 6 days; HepG2-NTCP cells were infected with 6 × 10 5 copies/ml HBV for 6 days. T5 exonuclease was used to digest isolated extracts to remove rcDNA, ssDNA and dsDNA. Following incubation with a specific biotinylated cccDNA bait, streptavidin-coated magnetic beads were employed to precipitate the baited cccDNA and associated proteins in the complex. B Western blotting for the detection of proteins of interest alone with various histone H3 in HepG2-NTCP cells (left) and HepAD38 cells (right). Semiquantitative measures from densitometry were normalized to controls and plotted as changes in folds (n = 3). C Southern blotting for HBV cccDNA from HepG2-NTCP (left) and HepAD38 (right) cells. (Nondig.: Non-digested DNAs)
    Setdb1, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setdb1/SETDB1+Antibody/pmc13005360-146-33-34
    Average 95 stars, based on 1 article reviews
    setdb1 - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    anti setdb1  (ABclonal Biotechnology)
    94
    ABclonal Biotechnology anti setdb1
    ZNF638 knockdown modulated histone modifications of HBV cccDNA microchromosomes. A Nuclear HBV cccDNA pulldown-WB procedures. After transfection with siRNAs targeting ZNF638, TASOR, and <t>SETDB1</t> for 48 h, HepAD38 cells were transferred to Tet-free medium to induce HBV replication and cultured for an additional 6 days; HepG2-NTCP cells were infected with 6 × 10 5 copies/ml HBV for 6 days. T5 exonuclease was used to digest isolated extracts to remove rcDNA, ssDNA and dsDNA. Following incubation with a specific biotinylated cccDNA bait, streptavidin-coated magnetic beads were employed to precipitate the baited cccDNA and associated proteins in the complex. B Western blotting for the detection of proteins of interest alone with various histone H3 in HepG2-NTCP cells (left) and HepAD38 cells (right). Semiquantitative measures from densitometry were normalized to controls and plotted as changes in folds (n = 3). C Southern blotting for HBV cccDNA from HepG2-NTCP (left) and HepAD38 (right) cells. (Nondig.: Non-digested DNAs)
    Anti Setdb1, supplied by ABclonal Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setdb1/SETDB1+Rabbit+pAb/pmc12816977-37-0-2
    Average 94 stars, based on 1 article reviews
    anti setdb1 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    gpx4 for ip  (Novus Biologicals)
    93
    Novus Biologicals gpx4 for ip
    ZNF638 knockdown modulated histone modifications of HBV cccDNA microchromosomes. A Nuclear HBV cccDNA pulldown-WB procedures. After transfection with siRNAs targeting ZNF638, TASOR, and <t>SETDB1</t> for 48 h, HepAD38 cells were transferred to Tet-free medium to induce HBV replication and cultured for an additional 6 days; HepG2-NTCP cells were infected with 6 × 10 5 copies/ml HBV for 6 days. T5 exonuclease was used to digest isolated extracts to remove rcDNA, ssDNA and dsDNA. Following incubation with a specific biotinylated cccDNA bait, streptavidin-coated magnetic beads were employed to precipitate the baited cccDNA and associated proteins in the complex. B Western blotting for the detection of proteins of interest alone with various histone H3 in HepG2-NTCP cells (left) and HepAD38 cells (right). Semiquantitative measures from densitometry were normalized to controls and plotted as changes in folds (n = 3). C Southern blotting for HBV cccDNA from HepG2-NTCP (left) and HepAD38 (right) cells. (Nondig.: Non-digested DNAs)
    Gpx4 For Ip, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setdb1/SETDB1+Antibody+(5H6A12)+-+BSA+Free/pm41372219-292-114-123
    Average 93 stars, based on 1 article reviews
    gpx4 for ip - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    setdb1  (Novus Biologicals)
    93
    Novus Biologicals setdb1
    ZNF638 knockdown modulated histone modifications of HBV cccDNA microchromosomes. A Nuclear HBV cccDNA pulldown-WB procedures. After transfection with siRNAs targeting ZNF638, TASOR, and <t>SETDB1</t> for 48 h, HepAD38 cells were transferred to Tet-free medium to induce HBV replication and cultured for an additional 6 days; HepG2-NTCP cells were infected with 6 × 10 5 copies/ml HBV for 6 days. T5 exonuclease was used to digest isolated extracts to remove rcDNA, ssDNA and dsDNA. Following incubation with a specific biotinylated cccDNA bait, streptavidin-coated magnetic beads were employed to precipitate the baited cccDNA and associated proteins in the complex. B Western blotting for the detection of proteins of interest alone with various histone H3 in HepG2-NTCP cells (left) and HepAD38 cells (right). Semiquantitative measures from densitometry were normalized to controls and plotted as changes in folds (n = 3). C Southern blotting for HBV cccDNA from HepG2-NTCP (left) and HepAD38 (right) cells. (Nondig.: Non-digested DNAs)
    Setdb1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setdb1/SETDB1+Antibody+(5H6A12)+-+BSA+Free/pm41372219-292-122-123
    Average 93 stars, based on 1 article reviews
    setdb1 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    ZNF638 knockdown modulated histone modifications of HBV cccDNA microchromosomes. A Nuclear HBV cccDNA pulldown-WB procedures. After transfection with siRNAs targeting ZNF638, TASOR, and SETDB1 for 48 h, HepAD38 cells were transferred to Tet-free medium to induce HBV replication and cultured for an additional 6 days; HepG2-NTCP cells were infected with 6 × 10 5 copies/ml HBV for 6 days. T5 exonuclease was used to digest isolated extracts to remove rcDNA, ssDNA and dsDNA. Following incubation with a specific biotinylated cccDNA bait, streptavidin-coated magnetic beads were employed to precipitate the baited cccDNA and associated proteins in the complex. B Western blotting for the detection of proteins of interest alone with various histone H3 in HepG2-NTCP cells (left) and HepAD38 cells (right). Semiquantitative measures from densitometry were normalized to controls and plotted as changes in folds (n = 3). C Southern blotting for HBV cccDNA from HepG2-NTCP (left) and HepAD38 (right) cells. (Nondig.: Non-digested DNAs)

    Journal: Cell Communication and Signaling : CCS

    Article Title: ZNF638 represses the transcription of HBV closed circular DNA involving HUSH complex-mediated histone modifications of epigenetic silencing

    doi: 10.1186/s12964-026-02726-1

    Figure Lengend Snippet: ZNF638 knockdown modulated histone modifications of HBV cccDNA microchromosomes. A Nuclear HBV cccDNA pulldown-WB procedures. After transfection with siRNAs targeting ZNF638, TASOR, and SETDB1 for 48 h, HepAD38 cells were transferred to Tet-free medium to induce HBV replication and cultured for an additional 6 days; HepG2-NTCP cells were infected with 6 × 10 5 copies/ml HBV for 6 days. T5 exonuclease was used to digest isolated extracts to remove rcDNA, ssDNA and dsDNA. Following incubation with a specific biotinylated cccDNA bait, streptavidin-coated magnetic beads were employed to precipitate the baited cccDNA and associated proteins in the complex. B Western blotting for the detection of proteins of interest alone with various histone H3 in HepG2-NTCP cells (left) and HepAD38 cells (right). Semiquantitative measures from densitometry were normalized to controls and plotted as changes in folds (n = 3). C Southern blotting for HBV cccDNA from HepG2-NTCP (left) and HepAD38 (right) cells. (Nondig.: Non-digested DNAs)

    Article Snippet: The probing antibodies against the following antigens: ZNF638 (Bethyl, USA), MPP8 (Proteintech), H3K9me3 (Abcam, UK), H3K27ac (Gene Tex, San Antonio, USA), H3K4me3 (Active motif, Carlsbad, CA, USA), H3 (Cell Signaling Technology, Massachusetts USA), SETDB1 (Proteintech) and GAPDH (Proteintech) were used for overnight incubation at 4 °C following the blocking procedure.

    Techniques: Knockdown, Transfection, Cell Culture, Infection, Isolation, Incubation, Magnetic Beads, Western Blot, Southern Blot

    ZNF638 dependent epigenetic silencing of HBV cccDNA transcription required marking of SETDB1-mediated H3K9me3. A Levels of HBV DNA, cccDNA and pgRNA in SETDB1 knockdown HepG2-NTCP cells at 6 d of 6 × 10 5 copies/ml HBV infections after SETDB1 siRNA transfection for 48 h. B Dose response of SETDB1 knockdown on increased HBV DNA levels. C Time course of HBV cccDNA transcription shown as the ratio of pgRNA to cccDNA for efficacy comparison. D-G Effect of SETDB1 siRNA transfection at 48 h on normalized HBV transcription levels at 6 d of 6 × 10⁵ copies/ml HBV infections in ZNF638 knockdown or overexpressing HepG2-NTCP cells. H-I ChIP-qPCR assays on cccDNAs for H3K9me3 enrichment at the ZNF638 binding regions using cccDNAs isolated from sgZNF638 or ZNF638oe HepG2-NTCP cells at 6 d post HBV infection

    Journal: Cell Communication and Signaling : CCS

    Article Title: ZNF638 represses the transcription of HBV closed circular DNA involving HUSH complex-mediated histone modifications of epigenetic silencing

    doi: 10.1186/s12964-026-02726-1

    Figure Lengend Snippet: ZNF638 dependent epigenetic silencing of HBV cccDNA transcription required marking of SETDB1-mediated H3K9me3. A Levels of HBV DNA, cccDNA and pgRNA in SETDB1 knockdown HepG2-NTCP cells at 6 d of 6 × 10 5 copies/ml HBV infections after SETDB1 siRNA transfection for 48 h. B Dose response of SETDB1 knockdown on increased HBV DNA levels. C Time course of HBV cccDNA transcription shown as the ratio of pgRNA to cccDNA for efficacy comparison. D-G Effect of SETDB1 siRNA transfection at 48 h on normalized HBV transcription levels at 6 d of 6 × 10⁵ copies/ml HBV infections in ZNF638 knockdown or overexpressing HepG2-NTCP cells. H-I ChIP-qPCR assays on cccDNAs for H3K9me3 enrichment at the ZNF638 binding regions using cccDNAs isolated from sgZNF638 or ZNF638oe HepG2-NTCP cells at 6 d post HBV infection

    Article Snippet: The probing antibodies against the following antigens: ZNF638 (Bethyl, USA), MPP8 (Proteintech), H3K9me3 (Abcam, UK), H3K27ac (Gene Tex, San Antonio, USA), H3K4me3 (Active motif, Carlsbad, CA, USA), H3 (Cell Signaling Technology, Massachusetts USA), SETDB1 (Proteintech) and GAPDH (Proteintech) were used for overnight incubation at 4 °C following the blocking procedure.

    Techniques: Knockdown, Transfection, Comparison, ChIP-qPCR, Binding Assay, Isolation, Infection