Review



reverse complement dna oligos  (Integrated DNA Technologies)


Bioz Verified Symbol Integrated DNA Technologies is a verified supplier
Bioz Manufacturer Symbol Integrated DNA Technologies manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    Integrated DNA Technologies reverse complement dna oligos
    Reverse Complement Dna Oligos, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 97/100, based on 6319 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+complement+oligo/DNA+oligo/pmc09651596-326-0-7
    Average 97 stars, based on 6319 article reviews
    reverse complement dna oligos - by Bioz Stars, 2026-11
    97/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: Conserved and cell type-specific transcriptional responses to IFN-γ in the ventral midbrain
    Article Snippet: After adding 1.5 μL of 10 μM barcoded RT primer (Integrated DNA Technologies), primer annealing was performed at 72°C for 3 minutes. .. Reverse transcription was performed by adding 7.5 μL RT mix to each well (2.81 μL of 40% polyethylene glycol 8000, 0.15 μL of 100 mM dNTPs, 3 μL of 5X Maxima H RT Buffer, 0.2 μL of 200 U/μL Maxima H Reverse Transcriptase (ThermoFisher), 0.2 μL of 20 U/μL SUPERaseIN, and 0.15 μL of 100 μM Template Switching Oligo (Integrated DNA Technologies), and 1 μL of nuclease free water). ..

    Sequencing:

    Article Title: RNF43 mutations facilitate mucinous colorectal cancer metastasis via formation of a tumour-intrinsic niche
    Article Snippet: .. The ss-oligo was ordered at Integrated DNA Technologies with phosphorothioate modifications of the last two nucleotide bonds at the 3’ and 5’ end (sequence: TATGCACAAGGCTGGGGAATGAGCCACCTCCAATCCACCTCACAGCACCCTGCTG CTTGCCCAGTGCCCCTACGCCGGGCCAGGCCTCCAGACAGCAGTGGATCTGGAGA AAGCTATTGCACAGAACGC). .. A gRNA was chosen using the Benchling tool ( https://benchling.com ) that created a double stranded break close to the mutation (sequence: CCAGATCCACTGCTGTCAGG) and cloned in pSpCas9(BB)-2A-Puro (Addgene, 48139).

    Article Title: An isogenic human iPSC model unravels neurodevelopmental abnormalities in SMA
    Article Snippet: .. The following single-stranded (ss) oligos (IDT) were annealed and cloned into the px458 plasmid (Addgene # 48138) using BbsI and T7 DNA ligase in a one-step digestion-ligation reaction to produce the CRISPR gRNA. gRNA 1 FOR for SMN-Clover: CACC TGCTCACATTCCTTAAATTA gRNA 1 REV for SMN-Clover: AAAC TAATTTAAGGAATGTGAGCA The correct insertion of the gRNA into the px458 plasmid, resulting in pTG- Cr -SMN, was confirmed by Sanger Sequencing (Microsynths). .. To generate pTG-HR-SMN:Clover, the commercially available vector HR120-PA1 (Systembio) was used as backbone.

    Synthesized:

    Article Title: Engineering inducible biomolecular assemblies for genome imaging and manipulation in living cells
    Article Snippet: .. DNA oligo primers were synthesized at Integrated DNA Technologies (IDT Inc). .. PCR reactions were performed using Q5 DNA polymerase system (M0491L, New England BioLabs) following the manufacturer’s instructions.

    Binding Assay:

    Article Title: Differential Glucose-Regulation of MicroRNAs in Pancreatic Islets of Non-Obese Type 2 Diabetes Model Goto-Kakizaki Rat
    Article Snippet: The predicted targets were then intersected with a list of glucose-regulated mRNAs expressed in rat islets, supplementary material of Bensellam et al (2009) , which were re-annotated with the latest available Affymetrix annotation file, Rat230_2.na30.annot.csv (Release 30, 11/15/2009). .. To generate the inserts encompassing the two rno-miR-335 binding sites in the proximal region of Stxbp1-3′UTR, single-stranded oligonucleotide sequences (ultramers TM ) were purchased (Integrated DNA Technologies, Inc. Germany). .. The sequences included position 1368 to 1547 (TargetScan numbering) of the 3′UTR of Stxbp1 (NM_003165).

    Fluorescence In Situ Hybridization:

    Article Title: Achieving single nucleotide sensitivity in direct hybridization genome imaging
    Article Snippet: .. The designed oligo FISH probes (without any labeling/modification) were purchased from IDT, and fluorescently labeled as previously described . .. Briefly, to conjugate an amino-ddUTP at the 3′ end of each oligonucleotide, 66.7 μM DNA oligonucleotides, 200 μM Amino-11-ddUTP (Lumiprobe) and 0.4U/μl Terminal Deoxynucleotidyl Transferase (TdT, Thermo Scientific, EP0162) were mixed in 1X TdT Reaction buffer (Thermo Scientific) and incubated overnight at 37 °C.

    Labeling:

    Article Title: Achieving single nucleotide sensitivity in direct hybridization genome imaging
    Article Snippet: .. The designed oligo FISH probes (without any labeling/modification) were purchased from IDT, and fluorescently labeled as previously described . .. Briefly, to conjugate an amino-ddUTP at the 3′ end of each oligonucleotide, 66.7 μM DNA oligonucleotides, 200 μM Amino-11-ddUTP (Lumiprobe) and 0.4U/μl Terminal Deoxynucleotidyl Transferase (TdT, Thermo Scientific, EP0162) were mixed in 1X TdT Reaction buffer (Thermo Scientific) and incubated overnight at 37 °C.

    Clone Assay:

    Article Title: An isogenic human iPSC model unravels neurodevelopmental abnormalities in SMA
    Article Snippet: .. The following single-stranded (ss) oligos (IDT) were annealed and cloned into the px458 plasmid (Addgene # 48138) using BbsI and T7 DNA ligase in a one-step digestion-ligation reaction to produce the CRISPR gRNA. gRNA 1 FOR for SMN-Clover: CACC TGCTCACATTCCTTAAATTA gRNA 1 REV for SMN-Clover: AAAC TAATTTAAGGAATGTGAGCA The correct insertion of the gRNA into the px458 plasmid, resulting in pTG- Cr -SMN, was confirmed by Sanger Sequencing (Microsynths). .. To generate pTG-HR-SMN:Clover, the commercially available vector HR120-PA1 (Systembio) was used as backbone.

    Plasmid Preparation:

    Article Title: An isogenic human iPSC model unravels neurodevelopmental abnormalities in SMA
    Article Snippet: .. The following single-stranded (ss) oligos (IDT) were annealed and cloned into the px458 plasmid (Addgene # 48138) using BbsI and T7 DNA ligase in a one-step digestion-ligation reaction to produce the CRISPR gRNA. gRNA 1 FOR for SMN-Clover: CACC TGCTCACATTCCTTAAATTA gRNA 1 REV for SMN-Clover: AAAC TAATTTAAGGAATGTGAGCA The correct insertion of the gRNA into the px458 plasmid, resulting in pTG- Cr -SMN, was confirmed by Sanger Sequencing (Microsynths). .. To generate pTG-HR-SMN:Clover, the commercially available vector HR120-PA1 (Systembio) was used as backbone.

    CRISPR:

    Article Title: An isogenic human iPSC model unravels neurodevelopmental abnormalities in SMA
    Article Snippet: .. The following single-stranded (ss) oligos (IDT) were annealed and cloned into the px458 plasmid (Addgene # 48138) using BbsI and T7 DNA ligase in a one-step digestion-ligation reaction to produce the CRISPR gRNA. gRNA 1 FOR for SMN-Clover: CACC TGCTCACATTCCTTAAATTA gRNA 1 REV for SMN-Clover: AAAC TAATTTAAGGAATGTGAGCA The correct insertion of the gRNA into the px458 plasmid, resulting in pTG- Cr -SMN, was confirmed by Sanger Sequencing (Microsynths). .. To generate pTG-HR-SMN:Clover, the commercially available vector HR120-PA1 (Systembio) was used as backbone.



    Similar Products

    reverse complement oligo  (Thermo Fisher)
    99
    Thermo Fisher reverse complement oligo
    Reverse Complement Oligo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+complement+oligo/Oligomycin/us12297243-355-26-35
    Average 99 stars, based on 1 article reviews
    reverse complement oligo - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    reverse complement oligo  (New England Biolabs)
    99
    New England Biolabs reverse complement oligo
    Reverse Complement Oligo, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+complement+oligo/T4+DNA+Ligase/pmc10569714__sciadv__adg3754_sm-5-14-26
    Average 99 stars, based on 1 article reviews
    reverse complement oligo - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    reverse complement dna oligo  (Sangon Biotech)
    86
    Sangon Biotech reverse complement dna oligo
    Reverse Complement Dna Oligo, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+complement+oligo/oligonucleotides/pm36522639-214-12-19
    Average 86 stars, based on 1 article reviews
    reverse complement dna oligo - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    reverse complement dna oligos  (Integrated DNA Technologies)
    97
    Integrated DNA Technologies reverse complement dna oligos
    Reverse Complement Dna Oligos, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+complement+oligo/DNA+oligo/pmc09651596-326-0-7
    Average 97 stars, based on 1 article reviews
    reverse complement dna oligos - by Bioz Stars, 2026-11
    97/100 stars
    		  Buy from Supplier

    Image Search Results