Review



zikv preparation zikv human  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    ATCC zikv preparation zikv human
    (A) Representative immunostaining for <t>ZIKV</t> envelope protein (ZIKV-E, green) and DAPI (blue) of GSCs and forebrain-specific NPCs 48 h post-infection (p.i.) with ZIKV. Scale bar, 50 μm. (B) Quantification of infection efficiency in four GSC and NPC lines 48 h p.i. with ZIKV. (C) Quantification of ZIKV+ cells in a panel of human GSCs and NPCs. (D) Kinetics of viral RNA copies p.i. with ZIKV by measuring viral RNA copies by qRT-PCR in NPC C4–7 and GSC3565. (E) ZIKV infection efficiency of GSCs and NPCs was measured by direct measurement of viral RNA copies. (F) Representative bright-field images 5 days p.i. with ZIKV for GSCs, NPCs, and primary astrocytes. Scale bars, 50 μm. (G) Cell viability normalized to day 5 mock, as measured 5 days p.i. with ZIKV for GSCs, NPCs, and primary astrocytes. (H) GSCs (GSC3565), differentiated GSCs, NPCs (NPC C4–7), and differentiated NPCs were assayed for cell viability 72 h p.i. with ZIKV. (I) Apoptosis of GSCs (387, 3565) and primary (NPC194, fetal human [fh] NPC) or iPSC-derived NPCs (WT83, C4–7) p.i. with ZIKV was measured by cleaved caspase-3 <t>(CC3)</t> <t>staining.</t> (J) Representative immunostaining for ZIKV-E (green), CC3 (red), and DAPI (blue) of GSCs and forebrain-specific NPCs 48 h p.i. with ZIKV. Scale bar, 50 μm. (K) Representative immunostaining for ZIKV-E (green), CC3 (red), and DAPI (blue) of GSCs and forebrain-specific NPCs 72 h p.i. with ZIKV. Scale bars, 50 μm. (L) Quantification of the percentage of CC3+ cells in DAPI+ cells for GSCs and NPCs 72 h p.i. with ZIKV. (M) Cell viability of patient-derived cultures from GBM (387 and 3565), pontine glioma (3752 and 007), meningioma (CH-157MN, IOMM-LEE), ependymoma (EP1), and medulloblastoma cell lines (DAOY, D283, HDMB03, D341) 72 h after ZIKV infection. Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. NS, no significance. ****p < 0.0001 by one-way ANOVA.
    Zikv Preparation Zikv Human, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/representative+tissue+microarray+staining/Monocercomonas+sp/pmc09628766-737-34-57
    Average 92 stars, based on 22 article reviews
    zikv preparation zikv human - by Bioz Stars, 2026-09
    92/100 stars

    Images

    1) Product Images from "Zika Virus Targets Glioblastoma Stem Cells through a SOX2-Integrin α v β 5 Axis"

    Article Title: Zika Virus Targets Glioblastoma Stem Cells through a SOX2-Integrin α v β 5 Axis

    Journal: Cell stem cell

    doi: 10.1016/j.stem.2019.11.016

    (A) Representative immunostaining for ZIKV envelope protein (ZIKV-E, green) and DAPI (blue) of GSCs and forebrain-specific NPCs 48 h post-infection (p.i.) with ZIKV. Scale bar, 50 μm. (B) Quantification of infection efficiency in four GSC and NPC lines 48 h p.i. with ZIKV. (C) Quantification of ZIKV+ cells in a panel of human GSCs and NPCs. (D) Kinetics of viral RNA copies p.i. with ZIKV by measuring viral RNA copies by qRT-PCR in NPC C4–7 and GSC3565. (E) ZIKV infection efficiency of GSCs and NPCs was measured by direct measurement of viral RNA copies. (F) Representative bright-field images 5 days p.i. with ZIKV for GSCs, NPCs, and primary astrocytes. Scale bars, 50 μm. (G) Cell viability normalized to day 5 mock, as measured 5 days p.i. with ZIKV for GSCs, NPCs, and primary astrocytes. (H) GSCs (GSC3565), differentiated GSCs, NPCs (NPC C4–7), and differentiated NPCs were assayed for cell viability 72 h p.i. with ZIKV. (I) Apoptosis of GSCs (387, 3565) and primary (NPC194, fetal human [fh] NPC) or iPSC-derived NPCs (WT83, C4–7) p.i. with ZIKV was measured by cleaved caspase-3 (CC3) staining. (J) Representative immunostaining for ZIKV-E (green), CC3 (red), and DAPI (blue) of GSCs and forebrain-specific NPCs 48 h p.i. with ZIKV. Scale bar, 50 μm. (K) Representative immunostaining for ZIKV-E (green), CC3 (red), and DAPI (blue) of GSCs and forebrain-specific NPCs 72 h p.i. with ZIKV. Scale bars, 50 μm. (L) Quantification of the percentage of CC3+ cells in DAPI+ cells for GSCs and NPCs 72 h p.i. with ZIKV. (M) Cell viability of patient-derived cultures from GBM (387 and 3565), pontine glioma (3752 and 007), meningioma (CH-157MN, IOMM-LEE), ependymoma (EP1), and medulloblastoma cell lines (DAOY, D283, HDMB03, D341) 72 h after ZIKV infection. Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. NS, no significance. ****p < 0.0001 by one-way ANOVA.
    Figure Legend Snippet: (A) Representative immunostaining for ZIKV envelope protein (ZIKV-E, green) and DAPI (blue) of GSCs and forebrain-specific NPCs 48 h post-infection (p.i.) with ZIKV. Scale bar, 50 μm. (B) Quantification of infection efficiency in four GSC and NPC lines 48 h p.i. with ZIKV. (C) Quantification of ZIKV+ cells in a panel of human GSCs and NPCs. (D) Kinetics of viral RNA copies p.i. with ZIKV by measuring viral RNA copies by qRT-PCR in NPC C4–7 and GSC3565. (E) ZIKV infection efficiency of GSCs and NPCs was measured by direct measurement of viral RNA copies. (F) Representative bright-field images 5 days p.i. with ZIKV for GSCs, NPCs, and primary astrocytes. Scale bars, 50 μm. (G) Cell viability normalized to day 5 mock, as measured 5 days p.i. with ZIKV for GSCs, NPCs, and primary astrocytes. (H) GSCs (GSC3565), differentiated GSCs, NPCs (NPC C4–7), and differentiated NPCs were assayed for cell viability 72 h p.i. with ZIKV. (I) Apoptosis of GSCs (387, 3565) and primary (NPC194, fetal human [fh] NPC) or iPSC-derived NPCs (WT83, C4–7) p.i. with ZIKV was measured by cleaved caspase-3 (CC3) staining. (J) Representative immunostaining for ZIKV-E (green), CC3 (red), and DAPI (blue) of GSCs and forebrain-specific NPCs 48 h p.i. with ZIKV. Scale bar, 50 μm. (K) Representative immunostaining for ZIKV-E (green), CC3 (red), and DAPI (blue) of GSCs and forebrain-specific NPCs 72 h p.i. with ZIKV. Scale bars, 50 μm. (L) Quantification of the percentage of CC3+ cells in DAPI+ cells for GSCs and NPCs 72 h p.i. with ZIKV. (M) Cell viability of patient-derived cultures from GBM (387 and 3565), pontine glioma (3752 and 007), meningioma (CH-157MN, IOMM-LEE), ependymoma (EP1), and medulloblastoma cell lines (DAOY, D283, HDMB03, D341) 72 h after ZIKV infection. Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. NS, no significance. ****p < 0.0001 by one-way ANOVA.

    Techniques Used: Immunostaining, Infection, Quantitative RT-PCR, Derivative Assay, Staining

    (A) Representative immunostaining for ZIKV-E (green), SOX2 (red), and DAPI (blue) of GSCs and forebrain-specific hiPSC-derived NPCs 48 h p.i. with ZIKV. Scale bar, 50 μm. (B) Quantification of the percentage of SOX2+ cells in DAPI+ cells for GSCs and NPCs 48 h p.i. with ZIKV. (C) Representative immunostaining for ZIKV-E (green), SOX2 or AXL (red), and DAPI (blue) of GSCs (GSC3565) without transduction (shRNA) or transduced with control shRNA (shCONT), AXL shRNA (shAXL.2), or SOX2 shRNA (shSOX2.53) for 72 h and then 48 h with ZIKV infection. Scale bars, 100 μm. (D) Quantification of the percentage of ZIKV+ cells in DAPI+ cells in GSCs 1517 and 3565 under conditions for (C), with a range of ZIKV infection. (E) Viral copy number by qRT-PCR of GSCs (GSC3565 or GSC1517) or NPC C4–7 transduced with either shCONT or SOX2 shRNA (shSOX2.52 or shSOX2.53) for 72 h and then either exposed to mock conditions or infected with ZIKV for another 72 h. All comparisons are versus shCONT. (F) Gene set enrichment (GSE) bubble plots showing pathways positively (top, r > 0.4) or negatively (bottom, r < −0.4) correlated with SOX2 expression in the TCGA GBM HG-U133A microarray dataset. Each circle represents an enriched pathway, with the border color indicating the false discovery rate (FDR)-corrected p value. (G) GSE graph showing the top pathway enrichments positively or negatively correlated with SOX2 as described in (F). (H) Correlation of mRNA levels of SOX2 with IFNAR1, IRF1, promyelocytic leukemia (PML), and IFITIM1 from the TCGA GBM HG-U133A microarray dataset. (I) Correlation between SOX2 with ISGs from the TCGA GBM HG-U133A microarray dataset. The size and color of the dots indicate the degree of correlation (p < 0.001). Blank cells indicate a non-significant correlation. (J) qPCR of ISGs (IFNAR-1, ISH20, IRF1, IFITM1, TLR3, and OAS2) in GSCs (GSC3565) transduced with either shCONT or SOX2 shRNA (shSOX2.52 or shSOX2.53). Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. **p < 0.001, ****p < 0.0001 by one-way ANOVA.
    Figure Legend Snippet: (A) Representative immunostaining for ZIKV-E (green), SOX2 (red), and DAPI (blue) of GSCs and forebrain-specific hiPSC-derived NPCs 48 h p.i. with ZIKV. Scale bar, 50 μm. (B) Quantification of the percentage of SOX2+ cells in DAPI+ cells for GSCs and NPCs 48 h p.i. with ZIKV. (C) Representative immunostaining for ZIKV-E (green), SOX2 or AXL (red), and DAPI (blue) of GSCs (GSC3565) without transduction (shRNA) or transduced with control shRNA (shCONT), AXL shRNA (shAXL.2), or SOX2 shRNA (shSOX2.53) for 72 h and then 48 h with ZIKV infection. Scale bars, 100 μm. (D) Quantification of the percentage of ZIKV+ cells in DAPI+ cells in GSCs 1517 and 3565 under conditions for (C), with a range of ZIKV infection. (E) Viral copy number by qRT-PCR of GSCs (GSC3565 or GSC1517) or NPC C4–7 transduced with either shCONT or SOX2 shRNA (shSOX2.52 or shSOX2.53) for 72 h and then either exposed to mock conditions or infected with ZIKV for another 72 h. All comparisons are versus shCONT. (F) Gene set enrichment (GSE) bubble plots showing pathways positively (top, r > 0.4) or negatively (bottom, r < −0.4) correlated with SOX2 expression in the TCGA GBM HG-U133A microarray dataset. Each circle represents an enriched pathway, with the border color indicating the false discovery rate (FDR)-corrected p value. (G) GSE graph showing the top pathway enrichments positively or negatively correlated with SOX2 as described in (F). (H) Correlation of mRNA levels of SOX2 with IFNAR1, IRF1, promyelocytic leukemia (PML), and IFITIM1 from the TCGA GBM HG-U133A microarray dataset. (I) Correlation between SOX2 with ISGs from the TCGA GBM HG-U133A microarray dataset. The size and color of the dots indicate the degree of correlation (p < 0.001). Blank cells indicate a non-significant correlation. (J) qPCR of ISGs (IFNAR-1, ISH20, IRF1, IFITM1, TLR3, and OAS2) in GSCs (GSC3565) transduced with either shCONT or SOX2 shRNA (shSOX2.52 or shSOX2.53). Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. **p < 0.001, ****p < 0.0001 by one-way ANOVA.

    Techniques Used: Immunostaining, Derivative Assay, Transduction, shRNA, Control, Infection, Quantitative RT-PCR, Expressing, Microarray

    (A) Representative images of mock- or ZIKV-infected BCOs stained with neuronal markers (CTIP2 and NeuN), a neural progenitor cell marker (SOX2), and DAPI. Scale bars, 100 μm. (B) Quantification of BCO size p.i. with ZIKV. Significance was assessed by two-tailed Student’s t test, and experiments were performed in two batches with 12 organoids per group per batch. (C) BCO size fold change of ZIKV- and mock-treated groups over a period of 1 month. (D) Quantification of SOX2+ cells in ZIKV- versus mock-infected groups. *p < 0.05 by two-tailed Student’s t test. (E) Quantification of CC3+ cells in ZIKV- versus mock-infected groups. *p < 0.05 by two-tailed Student’s t test. (F) Quantification of SATB2+ cells within MAP2+ cells in ZIKV- versus mock-infected groups. **p < 0.01 by two-tailed Student’s t test. (G) Quantification of GFAP+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (H) Quantification of NeuN+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (I) Quantification of CTIP2+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (J) Bright-field images of engraftment of two patient-derived GSCs (387 and 3565) transduced with GFP into human BCOs over a time course. Scale bars, 1 mm. (K) Engrafted GSCs (GFP+) with normal BCO immunostained for integrin αvβ5 (red), GFP (green), and DAPI (blue). Scale bars, 200 μm. (L) Quantification of integrin αvβ5+ cells in normal BCOs or GSC-BCOs. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-tailed Student’s t test. (M) Representative images of GFP-labeled GSC-BCOs immunostained for integrin αvβ5 (red), GFP (green), and DAPI (blue). Scale bars, 100 μm. (N) Representative images of GFP-labeled GSC-BCOs immunostained for SOX2 (red), GFP (green), and DAPI (blue). Scale bars, 100 μm. (O) Images of GFP-labeled GSC-GFP BCOs 13 days p.i. with ZIKV. Scale bars, 1 mm. (P) Representative images of residual GSCs (green) and DAPI staining (blue) of GFP-labeled GSC-GFP BCOs cultured under mock conditions or with ZIKV for 2–4 weeks. Scale bars, 200 μm. The percentage of GFP+ cells among DAPI+ cells was quantified. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-way ANOVA. (Q) Representative immunostaining for integrin αvβ5 (red), GFP (green), ZIKV-E (white), and DAPI (blue) of GFP-labeled GSC-GFP BCOs mock- or ZIKV-infected for 2–4 weeks. Scale bars, 200 μm (left) and 100 μm (center). The percentage of ZIKV-E+ cells among integrin αvβ5 cells was quantified. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-tailed Student’s t test. (R) Representative images of 387 and 3565 GSC-BCOs with or without ZIKV, respectively, stained with SOX2, ZIKV-E, and DAPI. GFP shows the presence of GSCs (scale bars, 50 μm). ZIKV-E+, GFP+, and ZIKV-E+ cells among GFP+ cells were quantified by counting (two GSCs cell lines, two repeats, n = 12 organoids/group); *p < 0.05 by two-tailed Student’s t test. (S) Schematic of the experiment design. (T) Volcano plot showing differences between GSC-BCO ZIKV versus GSC-BCO mock. 113 genes were differentially expressed (greater than 1.5-fold) between these two groups (*p < 0.05). (U) Network analysis of genes differentially expressed upon ZIKV infection, represented as a bubble plot.
    Figure Legend Snippet: (A) Representative images of mock- or ZIKV-infected BCOs stained with neuronal markers (CTIP2 and NeuN), a neural progenitor cell marker (SOX2), and DAPI. Scale bars, 100 μm. (B) Quantification of BCO size p.i. with ZIKV. Significance was assessed by two-tailed Student’s t test, and experiments were performed in two batches with 12 organoids per group per batch. (C) BCO size fold change of ZIKV- and mock-treated groups over a period of 1 month. (D) Quantification of SOX2+ cells in ZIKV- versus mock-infected groups. *p < 0.05 by two-tailed Student’s t test. (E) Quantification of CC3+ cells in ZIKV- versus mock-infected groups. *p < 0.05 by two-tailed Student’s t test. (F) Quantification of SATB2+ cells within MAP2+ cells in ZIKV- versus mock-infected groups. **p < 0.01 by two-tailed Student’s t test. (G) Quantification of GFAP+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (H) Quantification of NeuN+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (I) Quantification of CTIP2+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (J) Bright-field images of engraftment of two patient-derived GSCs (387 and 3565) transduced with GFP into human BCOs over a time course. Scale bars, 1 mm. (K) Engrafted GSCs (GFP+) with normal BCO immunostained for integrin αvβ5 (red), GFP (green), and DAPI (blue). Scale bars, 200 μm. (L) Quantification of integrin αvβ5+ cells in normal BCOs or GSC-BCOs. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-tailed Student’s t test. (M) Representative images of GFP-labeled GSC-BCOs immunostained for integrin αvβ5 (red), GFP (green), and DAPI (blue). Scale bars, 100 μm. (N) Representative images of GFP-labeled GSC-BCOs immunostained for SOX2 (red), GFP (green), and DAPI (blue). Scale bars, 100 μm. (O) Images of GFP-labeled GSC-GFP BCOs 13 days p.i. with ZIKV. Scale bars, 1 mm. (P) Representative images of residual GSCs (green) and DAPI staining (blue) of GFP-labeled GSC-GFP BCOs cultured under mock conditions or with ZIKV for 2–4 weeks. Scale bars, 200 μm. The percentage of GFP+ cells among DAPI+ cells was quantified. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-way ANOVA. (Q) Representative immunostaining for integrin αvβ5 (red), GFP (green), ZIKV-E (white), and DAPI (blue) of GFP-labeled GSC-GFP BCOs mock- or ZIKV-infected for 2–4 weeks. Scale bars, 200 μm (left) and 100 μm (center). The percentage of ZIKV-E+ cells among integrin αvβ5 cells was quantified. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-tailed Student’s t test. (R) Representative images of 387 and 3565 GSC-BCOs with or without ZIKV, respectively, stained with SOX2, ZIKV-E, and DAPI. GFP shows the presence of GSCs (scale bars, 50 μm). ZIKV-E+, GFP+, and ZIKV-E+ cells among GFP+ cells were quantified by counting (two GSCs cell lines, two repeats, n = 12 organoids/group); *p < 0.05 by two-tailed Student’s t test. (S) Schematic of the experiment design. (T) Volcano plot showing differences between GSC-BCO ZIKV versus GSC-BCO mock. 113 genes were differentially expressed (greater than 1.5-fold) between these two groups (*p < 0.05). (U) Network analysis of genes differentially expressed upon ZIKV infection, represented as a bubble plot.

    Techniques Used: Infection, Staining, Marker, Two Tailed Test, Derivative Assay, Transduction, Labeling, Cell Culture, Immunostaining

    (A) Immunostaining of the subventricular zone (SVZ) of mice 72 h following ZIKV infection ZIKV-E (green), SOX2 (red, top panels), and integrin αvβ5 (red, bottom panels). Scale bars, 50 μm. (B) Higher magnification of images from (A), demonstrating ZIKV infection of SOX2+ (top panels) and integrin αvβ5+ cells. Scale bars, 10 μm. (C) Survival of ZIKV-infected NSG mice from (A) was plotted by the Kaplan-Meier method. (D) ZIKV-infected brains from the mice in (A) were collected upon death, and histology was assessed by H&E staining. Scale bars, 20 μm. (E) Survival of NSG mice following implantation of GSCs treated with isotype control, P1F6 antibody, ZIKV, combined P1F6 and ZIKV, combined CRISPR knockout (KO) of integrin β5 (sgRNA1 sgRNA2) with ZIKV inoculation, analyzed by log rank test; p < 0.01. (F) H&E staining of tumor-bearing brains from (E). Scale bars, 50 μm. (G) Intraoperative brain slices from GBM patients were pre-incubated with an IgG control antibody or an integrin-blocking antibody under mock conditions or upon ZIKV infection (10e3 FFU). Slices then underwent immunofluorescence staining for ZIKV-E (green), integrin αvβ5 (red), and DAPI (blue). Scale bars, 10 μm. (H) Intraoperative brain slices from GBM patients were pre-incubated with an IgG control antibody or an integrin-blocking antibody under mock conditions or upon ZIKV infection. Slices then underwent a viral RNA copy assay by qRT-PCR. Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. ****p < 0.0001 by one-way ANOVA.
    Figure Legend Snippet: (A) Immunostaining of the subventricular zone (SVZ) of mice 72 h following ZIKV infection ZIKV-E (green), SOX2 (red, top panels), and integrin αvβ5 (red, bottom panels). Scale bars, 50 μm. (B) Higher magnification of images from (A), demonstrating ZIKV infection of SOX2+ (top panels) and integrin αvβ5+ cells. Scale bars, 10 μm. (C) Survival of ZIKV-infected NSG mice from (A) was plotted by the Kaplan-Meier method. (D) ZIKV-infected brains from the mice in (A) were collected upon death, and histology was assessed by H&E staining. Scale bars, 20 μm. (E) Survival of NSG mice following implantation of GSCs treated with isotype control, P1F6 antibody, ZIKV, combined P1F6 and ZIKV, combined CRISPR knockout (KO) of integrin β5 (sgRNA1 sgRNA2) with ZIKV inoculation, analyzed by log rank test; p < 0.01. (F) H&E staining of tumor-bearing brains from (E). Scale bars, 50 μm. (G) Intraoperative brain slices from GBM patients were pre-incubated with an IgG control antibody or an integrin-blocking antibody under mock conditions or upon ZIKV infection (10e3 FFU). Slices then underwent immunofluorescence staining for ZIKV-E (green), integrin αvβ5 (red), and DAPI (blue). Scale bars, 10 μm. (H) Intraoperative brain slices from GBM patients were pre-incubated with an IgG control antibody or an integrin-blocking antibody under mock conditions or upon ZIKV infection. Slices then underwent a viral RNA copy assay by qRT-PCR. Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. ****p < 0.0001 by one-way ANOVA.

    Techniques Used: Immunostaining, Infection, Staining, Control, CRISPR, Knock-Out, Incubation, Blocking Assay, Immunofluorescence, Quantitative RT-PCR

    Related Articles

    Disruption:

    Article Title: Oral ciprofloxacin biofilm activity in a catheter-associated urinary tract infection model
    Article Snippet: .. Following ciprofloxacin exposure, of the susceptible isolates (ciprofloxacin MIC ≤ 0.5 mg/L, n = 8) three had complete biofilm disruption (PAE-83412, PAE-63519, PAE-12030) and four had >3 log 10 reduction in biofilm mass (PAE-21994, PAE-50210, PAE-81458, PAE-ATCC-27853). ..

    other:

    Article Title: Metabolic diversity in commensal protists regulates intestinal immunity and trans-kingdom competition.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays DNeasy PowerSoil Pro Kit Qiagen Cat# 47016 TURBO DNA-free Kit ThermoFisher Scientific Cat# AM1907 Direct-zol RNA Miniprep kit Zymo Research Cat# R2050 KAPA Stranded RNA-Seq Kit Roche KK8400 Deposited data Raw sequencing data (Tmu distal SI) This paper SDR: https://purl.stanford.edu/ hk632xt6449 Raw sequencing data (Tmu cecum) This paper SDR: https://purl.stanford.edu/ jv169bq2041 Raw sequencing data (Tc distal SI) This paper SDR: https://purl.stanford.edu/ bz204zx2289 Raw sequencing data (Tc cecum) This paper SDR: https://purl.stanford.edu/ yc907qm9119 Raw sequencing data (Tmu PBF maltose) This paper SDR: https://purl.stanford.edu/ mn686yr7047 Raw sequencing data (Tmu PBF mucus) This paper SDR: https://purl.stanford.edu/ dv208bv2737 Raw sequencing data (Tmu PBF wax) This paper SDR: https://purl.stanford.edu/ fn865fy8284 T. musculis genome assembly This paper SDR: https://purl.stanford.edu/ ht207tk9988 T. casperi genome assembly This paper SDR: https://purl.stanford.edu/ yc907qm9119 Raw sequencing data (16S) This paper SDR: https://purl.stanford.edu/ gh231tz1328 Experimental models: Organisms/strains C57BL/6J wild-type mice Jackson Laboratory Stock#: 000664 C57BL/6J Gpr91-/- mice Amgen N/A C57BL/6J SMART13 mice PMID 22138715 N/A B6N.129S2-Casp1tm1Flv/J Jackson Laboratory Stock#: 016621 Tritrichomonas musculis mEG2 Howitt et al.19 N/A Tritrichomonas casperi cEG1 This study N/A Pentatrichomonas hominis Hs-3:NIH ATCC Cat# 30000 Monocercomonas colubrorum ATCC Cat# 50210 Oligonucleotides Parabasalid PCR (forward): CCACGGGTAGCAGCA This study N/A Parabasalid PCR (reverse): GGCAGGGACGTATTCAA This study N/A Bacteria qPCR (forward): AAACTCAAAKGAATTGACG Yang et al.54 N/A Bacteria qPCR (reverse): CTCACRRCACGAGCTGAC Yang et al.54 N/A Bacteroidetes qPCR (forward): GTTTAATTCGATGATACG CGAG Yang et al.54 N/A Bacteroidetes qPCR (reverse): TTAASCCGACACCTCACGG Yang et al.54 N/A A. muciniphila qPCR (forward): CAGCACGTGAAGGTGG GGAC Schneeberger et al.55 N/A A. muciniphila qPCR (reverse): CCTTGCGGTTGGCTTCAGAT Schneeberger et al.55 N/A T. musculis qPCR (forward): GCTTTTGCAAGCTAGGTCCC Howitt et al.19 N/A T. musculis qPCR (reverse): TTTCTGATGGGGCGTACCAC Howitt et al.19 N/A T. casperi qPCR (forward): AGGTTACTGAATCATACATGCGT This study N/A T. casperi qPCR (reverse): GCAGGAGTTGCTTTCATTGTG This study N/A (Continued on next page) ll Cell 187, 62–78.e1–e9, January 4, 2024 e3 Article

    Article Title: Metabolic diversity in commensal protists regulates intestinal immunity and trans-kingdom competition
    Article Snippet: Monocercomonas colubrorum , ATCC , Cat# 50210.

    Article Title: Oral ciprofloxacin biofilm activity in a catheter-associated urinary tract infection model.
    Article Snippet: Emergence of ciprofloxacin resistance was identified in 10 isolates (PAE-50210, PAE-81458, PAE-ATCC-27853, PAE-91643, PAE-44425, PAE-92669, PAE-60707, PAE-60905, PAE-27501, PAE-87386).



    Similar Products

    94
    Proteintech representative tissue microarray staining
    Fig. 9. Reduced emerin expression at the nuclear periphery correlates with breast cancer invasiveness in patients. (A) Representative tissue <t>microarray</t> staining of emerin in 159 patients using emerin polyclonal antibodies (Proteintech, cat# 10351-1-AP) or secondary alone (Vector Lab, cat#: MP-7451). Nuclei are blue, emerin is brown, and arrows denote emerin staining in certain images for reference. As severity of cases increases, there is a visible reduction in emerin expression at the nuclear envelope and more deformed nuclei are present. (B) Quantification of emerin staining on IHC-stained patient samples using 0–3, with 0 having no staining at the nuclear periphery and 3 having complete, dark rim staining. N = 159 total samples, *P < 0.05 compared to normal tissue, one-way ANOVA and Dunnett’s test. Error bars represent standard deviation. (C) Representative tissue microarray staining of emerin in 183 patients using emerin monoclonal antibodies (Leica, NCL-Emerin) or secondary alone (Vector Lab, cat#: MP-7452) using the same samples used in A. Nuclei are blue and emerin is brown. As aggressiveness of cases increases, there is a visible reduction in emerin expression and more deformed nuclei are present. (D) Quantification of emerin staining using the 0 to 3 grading system. N = 183 total samples #P < 0.02 compared to all non-cancerous tissue, *P < 0.0062 compared to both normal and benign tissue, one-way ANOVA and Dunnett’s test. Error bars represent standard deviation.
    Representative Tissue Microarray Staining, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/representative+tissue+microarray+staining/Emerin+Antibody/pm39198511-175-15-28
    Average 94 stars, based on 1 article reviews
    representative tissue microarray staining - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    Fig. 9. Reduced emerin expression at the nuclear periphery correlates with breast cancer invasiveness in patients. (A) Representative tissue microarray staining of emerin in 159 patients using emerin polyclonal antibodies (Proteintech, cat# 10351-1-AP) or secondary alone (Vector Lab, cat#: MP-7451). Nuclei are blue, emerin is brown, and arrows denote emerin staining in certain images for reference. As severity of cases increases, there is a visible reduction in emerin expression at the nuclear envelope and more deformed nuclei are present. (B) Quantification of emerin staining on IHC-stained patient samples using 0–3, with 0 having no staining at the nuclear periphery and 3 having complete, dark rim staining. N = 159 total samples, *P < 0.05 compared to normal tissue, one-way ANOVA and Dunnett’s test. Error bars represent standard deviation. (C) Representative tissue microarray staining of emerin in 183 patients using emerin monoclonal antibodies (Leica, NCL-Emerin) or secondary alone (Vector Lab, cat#: MP-7452) using the same samples used in A. Nuclei are blue and emerin is brown. As aggressiveness of cases increases, there is a visible reduction in emerin expression and more deformed nuclei are present. (D) Quantification of emerin staining using the 0 to 3 grading system. N = 183 total samples #P < 0.02 compared to all non-cancerous tissue, *P < 0.0062 compared to both normal and benign tissue, one-way ANOVA and Dunnett’s test. Error bars represent standard deviation.

    Journal: Scientific reports

    Article Title: Emerin deficiency drives MCF7 cells to an invasive phenotype.

    doi: 10.1038/s41598-024-70752-5

    Figure Lengend Snippet: Fig. 9. Reduced emerin expression at the nuclear periphery correlates with breast cancer invasiveness in patients. (A) Representative tissue microarray staining of emerin in 159 patients using emerin polyclonal antibodies (Proteintech, cat# 10351-1-AP) or secondary alone (Vector Lab, cat#: MP-7451). Nuclei are blue, emerin is brown, and arrows denote emerin staining in certain images for reference. As severity of cases increases, there is a visible reduction in emerin expression at the nuclear envelope and more deformed nuclei are present. (B) Quantification of emerin staining on IHC-stained patient samples using 0–3, with 0 having no staining at the nuclear periphery and 3 having complete, dark rim staining. N = 159 total samples, *P < 0.05 compared to normal tissue, one-way ANOVA and Dunnett’s test. Error bars represent standard deviation. (C) Representative tissue microarray staining of emerin in 183 patients using emerin monoclonal antibodies (Leica, NCL-Emerin) or secondary alone (Vector Lab, cat#: MP-7452) using the same samples used in A. Nuclei are blue and emerin is brown. As aggressiveness of cases increases, there is a visible reduction in emerin expression and more deformed nuclei are present. (D) Quantification of emerin staining using the 0 to 3 grading system. N = 183 total samples #P < 0.02 compared to all non-cancerous tissue, *P < 0.0062 compared to both normal and benign tissue, one-way ANOVA and Dunnett’s test. Error bars represent standard deviation.

    Article Snippet: Reduced emerin expression at the nuclear periphery correlates with breast cancer invasiveness in patients. (A) Representative tissue microarray staining of emerin in 159 patients using emerin polyclonal antibodies (Proteintech, cat# 10351-1-AP) or secondary alone (Vector Lab, cat#: MP-7451).

    Techniques: Expressing, Microarray, Staining, Plasmid Preparation, Standard Deviation, Bioprocessing