human pluripotent embryonic carcinoma ntera2 cl d1 nt2d1 cells (ATCC)

ATCC is a verified supplier

ATCC manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

ATCC human pluripotent embryonic carcinoma ntera2 cl d1 nt2d1 cells

Upregulation of the transcription factors POU3F2 and NTF3 during neuronal differentiation of <t>NT2D1.</t> a The protocol for neuronal induction of NT2D1 cells is schematized. b β3-tubulin staining for neuronal cells in NT2D1 cells untreated (non) and treated with neuronal induction medium at the indicated time points. c Quantification of β3-tubulin-positive cells. d Immunoblotting analysis for POU3F2, POU3F3, β3-tubulin, and NTF3 in NT2D1 cells untreated or treated with neuronal induction medium at the indicated time points. The values show the expression relative to that of untreated cells (to which a value of 1 was assigned). e Microarray analysis showed that neuronal induction for 6 h increased the expression of NTF3 and GADD45 in NT2D1 cells. f NTF3 mRNA expression after neuronal induction was analyzed by real-time PCR. The levels of mRNA were calculated as the relative expression compared with that of non-induced NT2D1 cells. GAPDH mRNA was used as a control. * p < 0.05; *** p < 0.001. g Phospho-TrkC (Tyr820) staining in treated and untreated NT2D1 cells. Values are presented as mean ± SEM of three independent experiments for c and f

Human Pluripotent Embryonic Carcinoma Ntera2 Cl D1 Nt2d1 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 151 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/representative+tissue+microarray+staining/NTERA-2+cl%2ED1%3B+Embryonal+Carcinoma%3B+Human/pmc06153716-29-0-8
Average 95 stars, based on 151 article reviews

human pluripotent embryonic carcinoma ntera2 cl d1 nt2d1 cells - by Bioz Stars, 2026-09

95/100 stars

Images

1) Product Images from "NTF3 Is a Novel Target Gene of the Transcription Factor POU3F2 and Is Required for Neuronal Differentiation"

Article Title: NTF3 Is a Novel Target Gene of the Transcription Factor POU3F2 and Is Required for Neuronal Differentiation

Journal: Molecular Neurobiology

doi: 10.1007/s12035-018-0995-y

Upregulation of the transcription factors POU3F2 and NTF3 during neuronal differentiation of NT2D1. a The protocol for neuronal induction of NT2D1 cells is schematized. b β3-tubulin staining for neuronal cells in NT2D1 cells untreated (non) and treated with neuronal induction medium at the indicated time points. c Quantification of β3-tubulin-positive cells. d Immunoblotting analysis for POU3F2, POU3F3, β3-tubulin, and NTF3 in NT2D1 cells untreated or treated with neuronal induction medium at the indicated time points. The values show the expression relative to that of untreated cells (to which a value of 1 was assigned). e Microarray analysis showed that neuronal induction for 6 h increased the expression of NTF3 and GADD45 in NT2D1 cells. f NTF3 mRNA expression after neuronal induction was analyzed by real-time PCR. The levels of mRNA were calculated as the relative expression compared with that of non-induced NT2D1 cells. GAPDH mRNA was used as a control. * p < 0.05; *** p < 0.001. g Phospho-TrkC (Tyr820) staining in treated and untreated NT2D1 cells. Values are presented as mean ± SEM of three independent experiments for c and f

Figure Legend Snippet: Upregulation of the transcription factors POU3F2 and NTF3 during neuronal differentiation of NT2D1. a The protocol for neuronal induction of NT2D1 cells is schematized. b β3-tubulin staining for neuronal cells in NT2D1 cells untreated (non) and treated with neuronal induction medium at the indicated time points. c Quantification of β3-tubulin-positive cells. d Immunoblotting analysis for POU3F2, POU3F3, β3-tubulin, and NTF3 in NT2D1 cells untreated or treated with neuronal induction medium at the indicated time points. The values show the expression relative to that of untreated cells (to which a value of 1 was assigned). e Microarray analysis showed that neuronal induction for 6 h increased the expression of NTF3 and GADD45 in NT2D1 cells. f NTF3 mRNA expression after neuronal induction was analyzed by real-time PCR. The levels of mRNA were calculated as the relative expression compared with that of non-induced NT2D1 cells. GAPDH mRNA was used as a control. * p < 0.05; *** p < 0.001. g Phospho-TrkC (Tyr820) staining in treated and untreated NT2D1 cells. Values are presented as mean ± SEM of three independent experiments for c and f

Techniques Used: Staining, Western Blot, Expressing, Microarray, Real-time Polymerase Chain Reaction, Control

Identification of the POU3F2 binding site on the NTF3 promoter. a Transcription factor response elements predicted by the Transcription Element Search System for the nucleotide sequence of the NTF3 promoter region (− 1823 to + 243). The transcription start site is indicated as + 1. b Comparison of NTF3 promoter sequence conservation between different species. c Biotin-labeled oligonucleotides containing the intact or mutated POU3F2 binding site were hybridized with total lysates prepared from NT2D1 cells. The POU3F2-DNA complexes were precipitated by streptavidin agarose beads. POU3F2 was analyzed by Western blot analyses. The input of nuclear extracts was used as loading control. Three independent experiments were performed. d Chromatin was prepared from NT2D1 cells treated with induction medium for 0, 2, and 6 h. Cell lysates were mixed with antibodies against POU3F2 or IgG and then precipitated. The precipitates were analyzed by PCR for the presence of the NTF3 promoter sequence. The DNA purified from the sonicated chromatin was directly analyzed by PCR using the ChIP primer, which was used as an input control (Input). e The values of the ChIP DNA were normalized to that of the NT2D1 cells at 0 h (as a control). Values of fold-change over the control are presented as mean ± SEM of three independent experiments for d . * p < 0.05 compared with the control

Figure Legend Snippet: Identification of the POU3F2 binding site on the NTF3 promoter. a Transcription factor response elements predicted by the Transcription Element Search System for the nucleotide sequence of the NTF3 promoter region (− 1823 to + 243). The transcription start site is indicated as + 1. b Comparison of NTF3 promoter sequence conservation between different species. c Biotin-labeled oligonucleotides containing the intact or mutated POU3F2 binding site were hybridized with total lysates prepared from NT2D1 cells. The POU3F2-DNA complexes were precipitated by streptavidin agarose beads. POU3F2 was analyzed by Western blot analyses. The input of nuclear extracts was used as loading control. Three independent experiments were performed. d Chromatin was prepared from NT2D1 cells treated with induction medium for 0, 2, and 6 h. Cell lysates were mixed with antibodies against POU3F2 or IgG and then precipitated. The precipitates were analyzed by PCR for the presence of the NTF3 promoter sequence. The DNA purified from the sonicated chromatin was directly analyzed by PCR using the ChIP primer, which was used as an input control (Input). e The values of the ChIP DNA were normalized to that of the NT2D1 cells at 0 h (as a control). Values of fold-change over the control are presented as mean ± SEM of three independent experiments for d . * p < 0.05 compared with the control

Techniques Used: Binding Assay, Sequencing, Comparison, Labeling, Western Blot, Control, Purification, Sonication

Effects of POU3F2 on NTF3 promoter activity. a Schematic representation of NTF3-luciferase chimeric constructs. The negative numbers refer to the numbers of bases upstream of the transcription start (+ 1) site of the NTF3 gene. b NT2D1 cells were transiently transfected with the pGL3 basic vector or NTF3 promoter constructs of different lengths. The luciferase activity of each reporter was normalized to the Renilla luciferase activity and compared with that of cells transfected with the pGL3 basic vector (to which a value of 1 was assigned). *** p < 0.001. c NT2D1 cells were transfected with the pGL3 basic vector, pNTF3-1902, and pNTF3-1902 POU3F2 mut. Approximately 24 h later, cells were treated with neuronal induction medium. The transcriptional activity of each reporter was normalized to the Renilla luciferase activity and compared with that of cells transfected with the pGL3 basic vector (to which a value of 1 was assigned). *** p < 0.001. Values are presented as mean ± SEM of three independent experiments for b and c

Figure Legend Snippet: Effects of POU3F2 on NTF3 promoter activity. a Schematic representation of NTF3-luciferase chimeric constructs. The negative numbers refer to the numbers of bases upstream of the transcription start (+ 1) site of the NTF3 gene. b NT2D1 cells were transiently transfected with the pGL3 basic vector or NTF3 promoter constructs of different lengths. The luciferase activity of each reporter was normalized to the Renilla luciferase activity and compared with that of cells transfected with the pGL3 basic vector (to which a value of 1 was assigned). *** p < 0.001. c NT2D1 cells were transfected with the pGL3 basic vector, pNTF3-1902, and pNTF3-1902 POU3F2 mut. Approximately 24 h later, cells were treated with neuronal induction medium. The transcriptional activity of each reporter was normalized to the Renilla luciferase activity and compared with that of cells transfected with the pGL3 basic vector (to which a value of 1 was assigned). *** p < 0.001. Values are presented as mean ± SEM of three independent experiments for b and c

Techniques Used: Activity Assay, Luciferase, Construct, Transfection, Plasmid Preparation

Effects of POU3F2 silencing on neuronal differentiation and NTF3 expression in NT2D1 cells. a POU3F2 expression in POU3F2-knockdown (shPOU3F2) and control (shLuc) NT2D1 cells was determined by Western blot analyses after neuronal induction for 6 h. GAPDH was used as a loading control. The values represent the relative expression compared with that of the non-induced shLuc cells (to which a value of 1 was assigned). b NTF3 mRNA expression of the cells described in a was analyzed by real-time PCR. mRNA levels were calculated relative to that of the non-induced shLuc cells. * p < 0.05; *** p < 0.001. c Neuronal morphology of shLuc and shPOU3F2 cells that were treated with neuronal induction medium for 24 h or left untreated (non). d Quantification of cell numbers of shLuc and shPOU3F2 described in c . All the percentages of the shLuc and shNTF3 cells were compared to that of the non-induction shLuc cells (to which a value of 100% was assigned). e β3-tubulin staining was performed on shLuc and shPOU3F2 cells, which were treated with neuronal induction medium for 0, 6, or 24 h or left untreated, after which neuronal cells were detected. Values represent the mean ± SEM of three independent experiments for b and d

Figure Legend Snippet: Effects of POU3F2 silencing on neuronal differentiation and NTF3 expression in NT2D1 cells. a POU3F2 expression in POU3F2-knockdown (shPOU3F2) and control (shLuc) NT2D1 cells was determined by Western blot analyses after neuronal induction for 6 h. GAPDH was used as a loading control. The values represent the relative expression compared with that of the non-induced shLuc cells (to which a value of 1 was assigned). b NTF3 mRNA expression of the cells described in a was analyzed by real-time PCR. mRNA levels were calculated relative to that of the non-induced shLuc cells. * p < 0.05; *** p < 0.001. c Neuronal morphology of shLuc and shPOU3F2 cells that were treated with neuronal induction medium for 24 h or left untreated (non). d Quantification of cell numbers of shLuc and shPOU3F2 described in c . All the percentages of the shLuc and shNTF3 cells were compared to that of the non-induction shLuc cells (to which a value of 100% was assigned). e β3-tubulin staining was performed on shLuc and shPOU3F2 cells, which were treated with neuronal induction medium for 0, 6, or 24 h or left untreated, after which neuronal cells were detected. Values represent the mean ± SEM of three independent experiments for b and d

Techniques Used: Expressing, Knockdown, Control, Western Blot, Real-time Polymerase Chain Reaction, Staining

Effects of NTF3 silencing and NTF3 recombinant protein treatment on the viability and neuronal differentiation of NT2D1 cells. a NTF3 mRNA levels in NTF3-knockdown (shNTF3) and control (shLuc) NT2D1 cells, which were treated with neuronal induction medium for 0, 24, or 48 h or left untreated (Non), were determined by real-time PCR. mRNA levels were calculated as the relative expression compared with the untreated shLuc cells. *** p < 0.001. b Phase contrast microscopy images of untreated shLuc and shNTF3 cells and those cells 24 h after neuronal induction with concomitant treatment of rNTF3 (5, 20 ng/ml) or vehicle. c Quantification of neuron number of shLuc and shNTF3 cells as described in b . All the percentages of neurons differentiated from shLuc and shNTF3 cells were compared to that of neurons differentiated from the vehicle-treated shLuc cells (to which a value of 100% was assigned). * p < 0.05; ** p < 0.01. d A suggested model of the POU3F2/NTF3 pathway that mediates the process of neuron differentiation. Values are presented as mean ± SEM of at least three independent experiments for a and c

Figure Legend Snippet: Effects of NTF3 silencing and NTF3 recombinant protein treatment on the viability and neuronal differentiation of NT2D1 cells. a NTF3 mRNA levels in NTF3-knockdown (shNTF3) and control (shLuc) NT2D1 cells, which were treated with neuronal induction medium for 0, 24, or 48 h or left untreated (Non), were determined by real-time PCR. mRNA levels were calculated as the relative expression compared with the untreated shLuc cells. *** p < 0.001. b Phase contrast microscopy images of untreated shLuc and shNTF3 cells and those cells 24 h after neuronal induction with concomitant treatment of rNTF3 (5, 20 ng/ml) or vehicle. c Quantification of neuron number of shLuc and shNTF3 cells as described in b . All the percentages of neurons differentiated from shLuc and shNTF3 cells were compared to that of neurons differentiated from the vehicle-treated shLuc cells (to which a value of 100% was assigned). * p < 0.05; ** p < 0.01. d A suggested model of the POU3F2/NTF3 pathway that mediates the process of neuron differentiation. Values are presented as mean ± SEM of at least three independent experiments for a and c

Techniques Used: Recombinant, Knockdown, Control, Real-time Polymerase Chain Reaction, Expressing, Microscopy

Derivative Assay:

Article Title: Activation of estrogen receptor induces differential proteomic responses mainly involving migration, invasion, and tumor development pathways in human testicular embryonal carcinoma NT2/D1 cells.
Article Snippet: The aims of the present study were to investigate the global changes on proteome of human testicular embryonal carcinoma NT2/D1 cells treated with 17β-estradiol (E2), and the effects of this hormone on migration, invasion, and colony formation of these cells.. A quantitative proteomic analysis identified the presence of 1230 proteins in both E2-treated and control cells.. The analysis revealed 75 differentially abundant proteins (DAPs), out of which 43 proteins displayed a higher abundance and, 30 proteins showed a lower abundance in E2-treated NT2/D1 cancer cells.

Article Title: Estrogen receptor activates SRC and ERK1/2 and promotes tumorigenesis in human testicular embryonic carcinoma cells NT2/D1.
Article Snippet: Testicular germ cell tumors have the highest incidence in young men (between 15 and 44 years of age) and its etiology is still unclear, but its emergence on puberty suggests a hormone-dependent mechanism for the development of these tumors and their progression.. We previously identified the estrogen receptor ESR1, ESR2, GPER and an isoform of ESR1, the ESR1-36 in human testicular embryonic carcinoma NT2/D1 cells, and the activation of SRC induced by ESR1 and ESR2 in these cells.. Therefore, this study aimed to analyze the role of ER in the activation of ERK1/2, and the involvement of SRC and ERK1/2 on proliferation, migration, and invasion of the NT2/D1 cells.

Cloning:

Protease Inhibitor:

Article Title: Accessory subunits of PRC2 mimic H3K27me3 to restrict the spread of Polycomb domains.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER BSA Merck 10735078001 DAPI Sigma D9542-1MG Protease inhibitor cocktail Sigma 4693132001 Benzonase Merck 70746 4X LDS sample buffer Thermo Scientific NP0007 StartingBlockTM Blocking Buffer Thermo Scientific 37539 SuperSignalTM West Pico PLUS Chemiluminescent Substrate Thermo Scientific 34580 SuperSignalTM West Atto Ultimate Sensitivity Substrate Thermo Scientific A38554 SYBR Green I Thermo Scientific S7563 H3K27me3 peptide: SKAARK(me3)SAPSTY GL Biochem N/A JARID2 K116me3 peptide: RLQAQRK(me3)FAQSQY GL Biochem N/A PALI1 K1241me3 peptide: KKHLKK(me3)FPGATY GL Biochem N/A RNAse A Thermo Scientific EN0531 Critical commercial assays Qiashredder Qiagen 79654 RNeasy Qiagen 74106 MTase-GloTM Methyltransferase Assay Promega V7601 MinElute PCR Purification Kit Qiagen 28006 Deposited data ChIP-Rx data GEO GSE278724 RNAseq data GEO GSE278724 STED microscopy images Mendeley Data DOI: 10.17632/3h6hxgr g2f.2 Code used for analysing STED microscopy images Zenodo DOI: 10.5281/zenodo.185 88691 Uncropped Western blots Mendeley Data DOI: 10.17632/ymghxj82c c.1 Raw data for graphs Mendeley Data DOI: 10.17632/ymghxj82c c.1 Experimental models: Cell lines Bruce-4 mouse embryonic stem cells (wild type) Gifted to Monash Genome Modification Platform by Colin Stewart RRID: CVCL_K037 mESC (Bruce-4): Pali1 K1393R This paper N/A mESC (Bruce-4): Jarid2 K116R This paper N/A mESC (Bruce-4): Pali1 K1393R; Jarid2 K116R This paper N/A NTERA-2 cells ATCC CRL-1973 Experimental models: Organisms/strains Mouse: C57BL/6J Jackson Laboratory JAX: 000664 Mouse: C57BL/6J Pali1 K1393R This paper N/A Mouse: C57BL/6J Pali2 K1543R This paper N/A Mouse: C57BL/6J Jarid2 K116R This paper N/A Oligonucleotides PALI1 K1241 knock-in Repair Template 1: CCTTCCACCATGTACCCTAGTTCACT ACAGGCAGAA CGCTTGAAAAAACATTTA AAGAAATTCCCCGGGGCCATTCCTGCT AGGAATAATTGGAAGACACAGAAGCTA TGGGCTAAACTACGAGAGAATCCTGA IDT N/A (Continued on next page) e2 Molecular Cell 86, 1–14.e1–e10, March 19, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER PALI1 K1241 knock-in Repair Template 2: AGTTTCCTCCTTCCACCATGTACCCTA GTTCACTACA GGCAGAACGCTTGAAAA AACATTTAAAGCGCTTCCCCGGGGCCA TTCCTGCTAGGAATAATTGGAAGACAC AGAAGCTATGGGCTAAACTACGAGAGA ATCCTGA IDT N/A PALI2 K1558R knock-in Repair Template 1: TTTAAGAGTGGTGAGCCAACCATTTTA TGTAGTATAT GAAATTTCCCAGCTGGTT TTGAAGGAGAGCTCACTGCAAATTTTTT AAAGTGCTTCCTGAAGGGGCTGGCAT TAAATCCACAGCATTTCACCCCTAACT TAATGCCCT IDT N/A PALI2 K1558R knock-in Repair Template 2: TTTAAGAGTGGTGAGCCAACCATTTTA TGTAGTATAT GAAATTTCCCAGCTGGTT TTGAAGGAGAGCTCACTGCAAAACGTT TAAAGTGCT TCCTGAAGGGGCTGGCA TTAAATCCACAGCATTTCACCCCTAAC TTAATGCCCT IDT N/A JARID2 K116R knock-in Repair template 1: CTCCAGTCTCTGCTTAATTTAGTTTTAC ATTTCTTTTG TTGTTGCAGGCCCAGGC TGCAAGCACAGCGGAAGTTTGCTCAA TCTCAGCCG AATAGTCCCAGCACAACT CCAGTGAAGATAGTGGAGCCTTTG IDT N/A PALI1 sgRNA targeting TCCTAGCAGGAATGGCTCCA IDT N/A PALI2 sgRNA targeting AAGGAGAAGAGACTGCAAATT IDT N/A JARID2 sgRNA targeting GGCCCAGGCTGCAAGCACAA IDT N/A Software and algorithms EMBOSS needle Rice et al. 71 ; EMBOSS 72 https://www.ebi.ac.uk/jdispatcher/psa/em boss_ needle Zerene Stacker Zerene Systems https://www.zerenesystems.com/cms/stacker Imspector Pro 5.0 La Vision, Miltenyi Biotec Oxford Instruments Imaris 10.2 Bitplane, Oxford Instruments https://imaris.oxinst.com/ FlowJo FlowJo (BD) https://www.flowjo.com/ GraphPad Prism Graphpad https://www.graphpad.com/ ImageLab Biorad https://www.bio-rad.com/en-au/product/image- lab-software?ID=KRE6P5E8Z Ilastik 1.4.0 Berg et al. 73 https://www.ilastik.org/ CellProfiler 4.2.6 Stirling et al. 74 ; Carpenter et al. 75 https://cellprofiler.org/ Trim Galore 0.5.0 Babraham Institute https://github.com/FelixKrueger/TrimGalore Salmon 1.5.2 Patro et al. 76 https://combine-lab.github.io/salmon/ DESeq2 1.46.0 Love et al. 77 DOI: 10.18129/B9.bioc.DESeq2 org.Mm.eg.db 3.20.0 Bioconductor DOI: 10.18129/B9.bioc.org.Mm.eg.db Pheatmap 1.0.12 CRAN 10.32614/CRAN.package.pheatmap Bowtie2 Langmead and Salzberg 78 https://github.com/BenLangmead/bowtie2 SAMtools Li et al. 79 https://www.htslib.org/ deepTools suite 3.3.0 Ramı́rez 80 https://deeptools.readthedocs.io/en/latest/ MACS2 Zhang et al. 81 https://github.com/macs3project/MACS (Continued on next page) Molecular Cell 86, 1–14.e1–e10, March 19, 2026 e3

Blocking Assay:

SYBR Green Assay:

Polymerase Chain Reaction:

Purification:

Chromatin Immunoprecipitation:

RNA sequencing:

Microscopy:

Western Blot:

Modification:

Article Title: Comparative analysis of lipid-peptide nanoparticles prepared via microfluidics, reverse phase evaporation, and ouzo techniques for efficient plasmid DNA delivery.
Article Snippet: In the current “era of lipid carriers,” numerous strategies have been developed to manufacture lipid nanoparticles (LNPs).. Nevertheless, the potential impact of various preparation methods on the characteristics, use, and/or stability of these LNPs remains unclear.. In this work, we attempted to compare the effects of three different preparation methods: microfluidics (MF), reverse phase evaporation (RV), and ouzo (OZ) on lipid-peptide NPs (LPNPs) as plasmid DNA delivery carriers.

Review