drdi (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs drdi
Drdi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 45 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/r0530/DrdI/pm16849641-34-62-63
Average 94 stars, based on 45 article reviews

drdi - by Bioz Stars, 2026-10

94/100 stars

Images

Sequencing:

Article Title: Multiple overlapping binding sites determine transcription factor occupancy
Article Snippet: .. To remove any supercoiling, PADIT-seq reporter libraries were first linearized with DrdI (NEB), which cuts a 12-bp DNA sequence (GACNNNN/NNGTC) only once in the pGL4.23 vector. .. For every DBD tested, the following 30-μl PURExpress IVTT reactions (NEB) were assembled: 10 μl Solution A, 7.5 μl Solution B, 1 μl murine RNase inhibitor (NEB), 3 μl 100 mM rNTPs, 0.45 μl 1 M magnesium acetate, 3 μl previously purified nbALFA-T7-RNA-Polymerase, ~300 ng linearized PADIT-seq reporter plasmid library, and ‘pT7 -DBD-T7Term’.

Article Title: Overlapping binding sites underlie TF genomic occupancy
Article Snippet: .. To remove any supercoiling, PADIT-seq reporter libraries were first linearized with DrdI (NEB), which cuts a 12-bp DNA sequence (GACNNNN/NNGTC) only once in the pGL4.23 vector. .. For every DBD being tested, the following 30 ul PURExpress IVTT reactions (NEB) were assembled: 10 ul Solution A, 7.5 ul Solution B, 1 ul Murine RNase Inhibitor, 3 ul 100 mM rNTPs, 0.45 ul 1000 mM magnesium acetate, 3 ul previously purified nbALFA-T7-RNA-Polymerase, ∼300 ng linearized PADIT-seq reporter plasmid library, ‘pT7-ALFA-DBD-T7Term’.

Plasmid Preparation:

Polymerase Chain Reaction:

Article Title: Rare longevity-associated variants, including a reduced-function mutation in cGAS, identified in multigenerational long-lived families
Article Snippet: After transfecting the mESCs using Lipofectamine 3000 (Thermo Fisher Scientific, Massachusetts, United States), haploid and GFP-positive cells were single-cell-sorted using the BD FACSaria Fusion (BD Biosciences). .. After growing them for 10 days, the clone that showed a positive restriction digestion with DrdI (NEB) after PCR (details in Supplementary Table 9 ) was genotyped. .. The (transgenic) mESCs were maintained in a diploid state at 37°C with 5% CO2 in high glucose Dulbecco’s Modified Eagle Medium supplemented with 3.7 g/l Sodium bicarbonate, 13.7% FBS, 1% Pen-Strep, 1% L-Glutamate, 1% Sodium Pyruvate, 1% MEM Non-Essential amino acids, 0.1% beta-mercaptoethanol and 0.01% leukaemia inhibitory factor (Millipore).

Mutagenesis:

Article Title: The chaperonin TRiC component Cct3 is required for axonal transport, myelination, and neuromuscular junction refinement
Article Snippet: We extracted DNA from fin biopsy material in 100 μl and from whole larval tissue in 20 μl of lysis buffer, pH 8.3 (150 mM MgCl 2 , 1 M Tris pH 8.3, 1 M KCl, 0.1% Gelatin, 0.3% Tween20, 0.3% NP40 and 100 μg/ml Proteinase K) by incubating them at 55 °C for 6 to 18 h. We inactivated the proteinase K afterwards at 95 °C for 10 min. We used GoTaq® (Promega) Taq polymerase for DNA amplification using the following dCAPS primers and the respective restriction enzymes for digest. .. For the distinction between wild-type from both mutant alleles ( cct3p.G54Vfs*4 and cct3p.G55Sfs*3 ), forward primer CAGATGCTGCTGGATCCGACGG, reverse primer GGATGCTGGACCTGGATCTAAA, and DrdI restriction enzyme (New England Biolabs) were used. .. For distinguishing specifically the cct3p.G55Sfs*3 allele from the other two (wildtype and cct3p.G54Vfs*4 ) we used the dCAPS primers GATGCTGCTGGATCGAATGGGT (forward) and GGATGCTGGACCTGGATCTAAAGT (reverse) along with the XmnI restriction enzyme (New England Biolabs).

Article Title: The chaperonin TRiC component Cct3 is required for axonal transport, myelination, and neuromuscular junction refinement.
Article Snippet: We used GoTaq® (Promega) Taq polymerase for DNA amplification using the following dCAPS primers and the respective restriction enzymes for digest. .. For the distinction between wild-type from both mutant alleles (cct3p.G54Vfs*4 and cct3p.G55Sfs*3), forward primer CAGATGCTGCTGGATCCGACGG, reverse primer GGATGCTGGACCTGGATCTAAA, and DrdI restriction enzyme (New England Biolabs) were used. .. For distinguishing specifically the cct3p.G55Sfs*3 allele from the other two (wildtype and cct3p.G54Vfs*4) we used the dCAPS primers GATGCTGCTGGATCGAATGGGT (forward) and GGATGCTGGACCTGGATCTAAAGT (reverse) along with the XmnI restriction enzyme (New England Biolabs).

Review