quantumtm prep miniprep kit (Bio-Rad)

Bio-Rad is a verified supplier

Bio-Rad manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Bio-Rad quantumtm prep miniprep kit
Quantumtm Prep Miniprep Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 95/100, based on 468 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quantustm+fluorometer+dsdna+quantification+kit/Quantum+Prep+Plasmid+Miniprep+Kit/us09487790-174-12-16
Average 95 stars, based on 468 article reviews

quantumtm prep miniprep kit - by Bioz Stars, 2026-11

95/100 stars

Images

Plasmid Preparation:

Article Title: The ArcAB two-component system is associated with the susceptibility of Aggregatibacter actinomycetemcomitans to superoxide and hydrogen peroxide
Article Snippet: To construct His-tagged recombinant ArcA, the arcA gene was cloned and inserted into pQE30 (Qiagen) using In-Fusion Snap Assembly Master Mix (Takara Bio). .. The resulting plasmid pQE30:: arcA was transformed into E. coli XL10-Gold and purified with a Quantum Prep Plasmid Kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA). .. For opsonization, the cells equivalent to 10 8 CFUs were incubated in AAGM broth containing 20% pooled human serum (Funakoshi Co., Ltd., Tokyo, Japan) at 37°C for 30 min.

Article Title: The ArcAB two-component system is associated with the susceptibility of Aggregatibacter actinomycetemcomitans to superoxide and hydrogen peroxide.
Article Snippet: Preparation of recombinant ArcA and antiserum To construct His-tagged recombinant ArcA, the arcA gene was cloned and inserted into pQE30 (Qiagen) using In-Fusion Snap Assembly Master Mix (Takara Bio). .. The resulting plasmid pQE30::arcA was transformed into E. coli XL10-Gold and purified with a Quantum Prep Plasmid Kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA). .. For protein purification, E. coli BL21 (DE3) transformed with both pREP4 (Qiagen) and pQE30::arcA was grown in LB broth supplemented with 100 μg/mL ampicillin and 25 μg/mL kanamycin at 37°C with shaking at 140 rpm until the OD660 reached 0.2.

Article Title: The outer membrane autotransporters Fap2 and CmpA facilitate specific coaggregation between Fusobacterium nucleatum and Aggregatibacter actinomycetemcomitans serotypes b and d.
Article Snippet: .. PCR using the primers shown in Table S1 and purified using the Quantum prep Plasmid Miniprep Kit (Bio-Rad Laboratories, Inc., San Francisco, CA, USA). .. To prepare F. nucleatum competent cells, F. nucleatum ATCC 23726 was cultured in 8 mL of TSPC at 37°C for 24 h under anaerobic conditions.

Article Title: CENP-A/CENP-B uncoupling in the evolutionary reshuffling of centromeres in equids.
Article Snippet: .. To identify horse chromosomes 9 and 10, two bacterial artificial chromosomes derived from the CHORI-241 BAC library (CH241-361E21, chr9:36,816,509–36,983,616 in EquCab3.0; CH241-403K5, chr10:28,469,205–28,662,312 in EquCab3.0) were extracted from 10 ml bacterial cultures with the Quantum Prep Plasmid miniprep kit (BioRad), according to supplier instructions. .. The probes were labeled by nick translation with Cy3-dUTP (Enzo Life Sciences), and FISH was performed as previously described [39].

Article Title: The outer membrane autotransporters Fap2 and CmpA facilitate specific coaggregation between Fusobacterium nucleatum and Aggregatibacter actinomycetemcomitans serotypes b and d
Article Snippet: The digested fragment and pJIR750 were ligated using T4 DNA ligase (Takara Bio Inc., Kusatsu, Japan) and transformed into chemically competent E. coli XL10-Gold cells. .. The constructed plasmid was validated by PCR using the primers shown in and purified using the Quantum prep Plasmid Miniprep Kit (Bio-Rad Laboratories, Inc., San Francisco, CA, USA). .. To prepare F. nucleatum competent cells, F. nucleatum ATCC 23726 was cultured in 8 mL of TSPC at 37°C for 24 h under anaerobic conditions.

Article Title: Genomic Sequencing to Detect Cross-Breeding Quality in Dogs: An Example Studying Disorders in Sexual Development
Article Snippet: .. DNA extraction from selected BACs was performed using the Quantum Prep Plasmid Miniprep Kit (Bio-Rad, Hercules, CA, USA). ..

Article Title: CENP-A/CENP-B uncoupling in the evolutionary reshuffling of centromeres in equids
Article Snippet: .. To identify horse chromosomes 9 and 10, two bacterial artificial chromosomes derived from the CHORI-241 BAC library (CH241-361E21, chr9:36,816,509–36,983,616 in EquCab3.0; CH241-403K5, chr10:28,469,205–28,662,312 in EquCab3.0) were extracted from 10 ml bacterial cultures with the Quantum Prep Plasmid miniprep kit (BioRad), according to supplier instructions. .. The probes were labeled by nick translation with Cy3-dUTP (Enzo Life Sciences), and FISH was performed as previously described [ ].

Transformation Assay:

Purification:

Article Title: The outer membrane autotransporters Fap2 and CmpA facilitate specific coaggregation between Fusobacterium nucleatum and Aggregatibacter actinomycetemcomitans serotypes b and d
Article Snippet: The digested fragment and pJIR750 were ligated using T4 DNA ligase (Takara Bio Inc., Kusatsu, Japan) and transformed into chemically competent E. coli XL10-Gold cells. .. The constructed plasmid was validated by PCR using the primers shown in and purified using the Quantum prep Plasmid Miniprep Kit (Bio-Rad Laboratories, Inc., San Francisco, CA, USA). .. To prepare F. nucleatum competent cells, F. nucleatum ATCC 23726 was cultured in 8 mL of TSPC at 37°C for 24 h under anaerobic conditions.

Fat:

Article Title: Detecting altered hepatic lipid oxidation by MRI in an animal model of MASLD
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CPT1 Primary Antibody Santa Cruz Biotechnology Cat#sc-393070; RRID:AB_3075326 COXI-V Primary Antibody Cell Signaling Technology Cat#4844; RRID:AB_2085427 GAPDH Primary Antibody Cell Signaling Technology Cat#2118; RRID:AB_561053 ACADL/LCAD Primary Antibody Abcam Cat#ab128566; RRID:AB_11141244 8-oxo-dG Primary Antibody R&D Systems Cat#4354-MC-050; RRID_AB1857195 TFAM Primary Antibody Invitrogen Cat#PA5-29571; RRID_AB2547047 4-Hydroxynonenal Primary Antibody Invitrogen Cat#MA5-27570; RRID_AB2735095 Goat Anti-Mouse Secondary Antibody (Alexa Fluor Plus 594) Invitrogen Cat#A32742; RRID_AB2762825 Goat Anti-Rabbit Secondary Antibody (Alexa Fluor Plus 647) Invitrogen Cat#A32733; RRID_AB2633282 Total OXPHOS Rodent WB Antibody Cocktail Abcam Cat#ab110413; RRID_AB2629281 Chemicals, peptides, and recombinant proteins Lidocaine Patterson Veterinary Cat#07-869-7525 Heparin McKesson Medical Surgical Cat#949512 [D15]octanoate Sigma Aldrich Cat#448214 O2 Gas Airgas Cat#OX USP200 95% O2/5% CO2 Gas Airgas Cat#Z02OX9511900099 D2O Cambridge Isotope Laboratories Cat#DLM-4 Acetonitrile Fisher Scientific Cat#A21 Isopropanol Fisher Scientific Cat#AC423830040 Methoxyamine HCl in Pyridine (MOX Reagent) Thermo Scientific Cat#TS-45950 MTBSTFA Fisher Scientific Cat#50-442-893 Hydroxylamine HCl in Pyridine Fisher Scientific Cat#AC170361000 Propionic Anhydride Sigma Aldrich Cat#240311 Ethyl Acetate Fisher Scientific Cat#E145 1x RIPA Lysis Buffer Thermo Fisher Scientific Cat#J62725.AP BSA Protein Standard Thermo Fisher Scientific Cat#23209 Bradford Reagent Bio-Rad Laboratories Cat#5000006 TRIzol Invitrogen Cat#15596026 SYBR Green PCR Master Mix Applied Biosystems Cat#4309155 Protease and Phosphatase Inhibitors Thermo Fisher Scientific Cat#78440 Bolt 8% Bis-tris Plus Gels Invitrogen Cat#NW00087BOX Nitrocellulose Membrane Bio-Rad Laboratories Cat#1620115 Mannitol Fisher Scientific Cat#AA3334236 Sucrose Fisher Scientific Cat#S5-500 HEPES Fisher Scientific Cat#AAA1477718 EDTA Fisher Scientific Cat#S311-500 Fatty Acid Free BSA Sigma Aldrich Cat#126575 KCl Fisher Scientific Cat#AA1159530 K2HPO4 Fisher Scientific Cat#01-337-798 MgCl2 Fisher Scientific Cat#M33-500 EGTA Fisher Scientific Cat#32-462-625GM ADP Fisher Scientific Cat#NC0623142 (Continued on next page) e1 Cell Reports Medicine 5, 101714, September 17, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER NaCl Fisher Scientific Cat#S271-500 Standard Rodent Maintenance Diet Teklad Global Cat#2918 High Fat Diet Research Diets Cat#D12492 Low Fat Diet Research Diets Cat#D12450J 4% Paraformaldehyde in PBS Fisher Scientific Cat#AAJ61899AK 70% Histological Grade Ethanol Fisher Scientific Cat#HC-1000-1GL IGEPAL CO-630 Sigma Aldrich Cat#542334 Xylenes Fisher Scientific Cat#X3P-1GAL Histo-Clear Fisher Scientific Cat#50-329-47 Citrate Millipore Sigma Cat#251275 PBS Fisher Scientific Cat#10-010-031 PBST Fisher Scientific Cat#50-195-825 ReadyProbesTM 2.5% Normal Goat Serum (1X) Thermo Fisher Scientific Cat#R37624 Critical commercial assays Miniprep Kit Bio-Rad Laboratories Cat7326100 cDNA Synthesis Kit Bio-Rad Laboratories Cat#1708890 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 Triglyceride Reagent Millipore Sigma Cat#T2449 ALT (SGPT) Liquid Reagents Pointe Scientific Cat#A7526625 AST (SGOT) Liquid Reagents Pointe Scientific Cat#A7561150 Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Cat#000664; RRID:IMSR_JAX:000664 Rat: Sprague Dawley Charles River Laboratory Cat#001 Oligonucleotides Hmgcs2 Integrated DNA Technologies Forward: GAC TTC CTG TCA TCC AGC Reverse: GGT GTA GGT TTC TTC CAG C Lcad Integrated DNA Technologies Forward:TCAATGGAAGCAAGGTGTTCA Reverse:GCCACGACGATCACGAGAT Software and algorithms ImageJ NIH v1.53k XCalibur Thermo Fisher Scientific v4.1 INCA Vanderbilt University v1.9 MATLAB Mathworks v9.11.0.1809720 Rstudio Posit, PBC v1.3.1073 Bruker Topspin Bruker v3.6.2 Paravision6 Bruker v6.0.1 Mestrenova Mestrelab Research v14.0.1–23284 Python The Python Software Foundation v3.8 Python Library: numpy The Python Software Foundation v1.19.2 Python Library: pandas The Python Software Foundation v1.1.3 Python Library: matplotlib The Python Software Foundation v3.3.2 Python Library: nmrglue The Python Software Foundation v0.8 Inkscape Inkscape v0.92.2 Article ll OPEN ACCESS .. Experiments involving mice (in bred strains used were C57BL/6J (Stock No. 000664, RRID:IMSR_JAX:000664)) were handled in compliance with University of Florida Institutional Animal Care and Use Committee (protocol number #201909320).

cDNA Synthesis:

Bicinchoninic Acid Protein Assay:

AST Assay:

Software:

Polymerase Chain Reaction:

Article Title: The outer membrane autotransporters Fap2 and CmpA facilitate specific coaggregation between Fusobacterium nucleatum and Aggregatibacter actinomycetemcomitans serotypes b and d
Article Snippet: The digested fragment and pJIR750 were ligated using T4 DNA ligase (Takara Bio Inc., Kusatsu, Japan) and transformed into chemically competent E. coli XL10-Gold cells. .. The constructed plasmid was validated by PCR using the primers shown in and purified using the Quantum prep Plasmid Miniprep Kit (Bio-Rad Laboratories, Inc., San Francisco, CA, USA). .. To prepare F. nucleatum competent cells, F. nucleatum ATCC 23726 was cultured in 8 mL of TSPC at 37°C for 24 h under anaerobic conditions.

Derivative Assay:

BAC Assay:

Construct:

Article Title: The outer membrane autotransporters Fap2 and CmpA facilitate specific coaggregation between Fusobacterium nucleatum and Aggregatibacter actinomycetemcomitans serotypes b and d
Article Snippet: The digested fragment and pJIR750 were ligated using T4 DNA ligase (Takara Bio Inc., Kusatsu, Japan) and transformed into chemically competent E. coli XL10-Gold cells. .. The constructed plasmid was validated by PCR using the primers shown in and purified using the Quantum prep Plasmid Miniprep Kit (Bio-Rad Laboratories, Inc., San Francisco, CA, USA). .. To prepare F. nucleatum competent cells, F. nucleatum ATCC 23726 was cultured in 8 mL of TSPC at 37°C for 24 h under anaerobic conditions.

Review