Review



primescript reverse transcriptase kit  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Promega primescript reverse transcriptase kit
    Primescript Reverse Transcriptase Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primescript+high+fidelity+reverse+transcriptase+kit/primescript+reverse+transcriptase+kit/pm32317186-64-9-13
    Average 90 stars, based on 1 article reviews
    primescript reverse transcriptase kit - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: EPIC-0628 abrogates HOTAIR/EZH2 interaction and enhances the temozolomide efficacy via promoting ATF3 expression and inhibiting DNA damage repair in glioblastoma.
    Article Snippet: The efficacy of temozolomide (TMZ) treatment in glioblastoma (GBM) is influenced by various mechanisms, mainly including the level of O6-methylguanine-DNA methyltransferase (MGMT) and the activity of DNA damage repair (DDR) pathways.. In our previous study, we had proved that long non-coding RNA HOTAIR regulated the GBM progression and mediated DDR by interacting with EZH2, the catalytic subunit of PRC2.. In this study, we developed a small-molecule inhibitor called EPIC-0628 that selectively disrupted the HOTAIREZH2 interaction and promoted ATF3 expression.

    Article Title: Knockdown of fibronectin extra domain B suppresses TGF-β1-mediated cell proliferation and collagen deposition in keloid fibroblasts via AKT/ERK signaling pathway.
    Article Snippet: Keloids represent a dermal fibrotic disease characterized by excess collagen deposition and invasion of normal skin beyond the wound boundary, similar to malignant tumor features.. Fibronectin extra domain B (EDB) is highly expressed in many tumors but has not been studied in keloids.. The present study aimed to investigate the expression and the influence of EDB on keloid and elucidate the putative signaling pathway.

    Quantitative RT-PCR:

    Article Title: Knockdown of fibronectin extra domain B suppresses TGF-β1-mediated cell proliferation and collagen deposition in keloid fibroblasts via AKT/ERK signaling pathway.
    Article Snippet: Keloids represent a dermal fibrotic disease characterized by excess collagen deposition and invasion of normal skin beyond the wound boundary, similar to malignant tumor features.. Fibronectin extra domain B (EDB) is highly expressed in many tumors but has not been studied in keloids.. The present study aimed to investigate the expression and the influence of EDB on keloid and elucidate the putative signaling pathway.

    SYBR Green Assay:

    Article Title: Knockdown of fibronectin extra domain B suppresses TGF-β1-mediated cell proliferation and collagen deposition in keloid fibroblasts via AKT/ERK signaling pathway.
    Article Snippet: Keloids represent a dermal fibrotic disease characterized by excess collagen deposition and invasion of normal skin beyond the wound boundary, similar to malignant tumor features.. Fibronectin extra domain B (EDB) is highly expressed in many tumors but has not been studied in keloids.. The present study aimed to investigate the expression and the influence of EDB on keloid and elucidate the putative signaling pathway.



    Similar Products

    primescript high fidelity reverse transcriptase kit  (TaKaRa)
    97
    TaKaRa primescript high fidelity reverse transcriptase kit
    Primescript High Fidelity Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primescript+high+fidelity+reverse+transcriptase+kit/PrimeScript+Reverse+Transcriptase/pm25249323-308-11-17
    Average 97 stars, based on 1 article reviews
    primescript high fidelity reverse transcriptase kit - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    prime script ii high fidelity reverse transcriptase polymerase chain reaction rt pcr kit  (TaKaRa)
    96
    TaKaRa prime script ii high fidelity reverse transcriptase polymerase chain reaction rt pcr kit
    Fibronectin deposition on the surface of gelatin material after co‐culture of MSCs and SCs. ECM accumulation is significant in gelatin sponge (GS) in the MSCs group (A), as evidenced by the rough surface (inset in A), while the surface of GS without MSCs is smooth (inset in B). FN, secreted by GFP positive MSCs (arrowheads in C), deposits onto the surface of gelatin material and displays thread‐like red fluorescence (arrows in C). Application of FN antibody decreases the deposition of FN onto the surface of gelatin material. Three dimensional reconstructive image shows that the surface of gelatin material is decorated by adherent FN (blue, in D). After adding FN blocking antibody (FNab) to the culture medium, deposition of FN (blue) onto the surface is obviously reduced as shown in (E). Green cells in D and E are MSCs. <t>RT‐PCR</t> and Western blot results indicate that, although the transcriptional level of FN decreases with the increase in duration of co‐culture (F), the amount of FN protein increases within the gelatin sponge (GS) scaffolds (G,H). Scale bars: 200 μm in (A,B), 20 μm in the inset of (A,B), and 20 μm in (C–E).
    Prime Script Ii High Fidelity Reverse Transcriptase Polymerase Chain Reaction Rt Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primescript+high+fidelity+reverse+transcriptase+kit/PrimeScript+High+Fidelity+RT-PCR+Kit/pmc05101622-85-11-22
    Average 96 stars, based on 1 article reviews
    prime script ii high fidelity reverse transcriptase polymerase chain reaction rt pcr kit - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    Fibronectin deposition on the surface of gelatin material after co‐culture of MSCs and SCs. ECM accumulation is significant in gelatin sponge (GS) in the MSCs group (A), as evidenced by the rough surface (inset in A), while the surface of GS without MSCs is smooth (inset in B). FN, secreted by GFP positive MSCs (arrowheads in C), deposits onto the surface of gelatin material and displays thread‐like red fluorescence (arrows in C). Application of FN antibody decreases the deposition of FN onto the surface of gelatin material. Three dimensional reconstructive image shows that the surface of gelatin material is decorated by adherent FN (blue, in D). After adding FN blocking antibody (FNab) to the culture medium, deposition of FN (blue) onto the surface is obviously reduced as shown in (E). Green cells in D and E are MSCs. RT‐PCR and Western blot results indicate that, although the transcriptional level of FN decreases with the increase in duration of co‐culture (F), the amount of FN protein increases within the gelatin sponge (GS) scaffolds (G,H). Scale bars: 200 μm in (A,B), 20 μm in the inset of (A,B), and 20 μm in (C–E).

    Journal: Journal of Biomedical Materials Research. Part a

    Article Title: Autocrine fibronectin from differentiating mesenchymal stem cells induces the neurite elongation in vitro and promotes nerve fiber regeneration in transected spinal cord injury

    doi: 10.1002/jbm.a.35720

    Figure Lengend Snippet: Fibronectin deposition on the surface of gelatin material after co‐culture of MSCs and SCs. ECM accumulation is significant in gelatin sponge (GS) in the MSCs group (A), as evidenced by the rough surface (inset in A), while the surface of GS without MSCs is smooth (inset in B). FN, secreted by GFP positive MSCs (arrowheads in C), deposits onto the surface of gelatin material and displays thread‐like red fluorescence (arrows in C). Application of FN antibody decreases the deposition of FN onto the surface of gelatin material. Three dimensional reconstructive image shows that the surface of gelatin material is decorated by adherent FN (blue, in D). After adding FN blocking antibody (FNab) to the culture medium, deposition of FN (blue) onto the surface is obviously reduced as shown in (E). Green cells in D and E are MSCs. RT‐PCR and Western blot results indicate that, although the transcriptional level of FN decreases with the increase in duration of co‐culture (F), the amount of FN protein increases within the gelatin sponge (GS) scaffolds (G,H). Scale bars: 200 μm in (A,B), 20 μm in the inset of (A,B), and 20 μm in (C–E).

    Article Snippet: Then, using each synthesized cDNA as a mould, PCR by using Prime Script II High Fidelity Reverse transcriptase‐polymerase chain reaction (RT‐PCR) Kit (Takara) was per formed with the FN primers with Forward strand: 5′‐GGCTCAATCCAAATGCCTCTAC‐3′ and Reverse strand: 5′‐CCCTCTGGTAAGGCCAGTCAG‐3′, while β‐actin with Forward strand: 5′‐AGAGGGAAATCGTGCGTGAC‐3′ and Reverse strand: 5′‐AGAGGTCTTTACGGATGTCAACG‐3′ as loading reference.

    Techniques: Co-Culture Assay, Fluorescence, Blocking Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot