genomic dna from each sample and of pooled commercial reference (Promega)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Promega genomic dna from each sample and of pooled commercial reference
Genomic Dna From Each Sample And Of Pooled Commercial Reference, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pooled+reference+sample/reference+genomic+dna/pm28841710-71-7-16
Average 90 stars, based on 1 article reviews

genomic dna from each sample and of pooled commercial reference - by Bioz Stars, 2026-10

90/100 stars

Images

Mini Gene Assay:

Article Title: Combining a prioritization strategy and functional studies nominates 5’UTR variants underlying inherited retinal disease
Article Snippet: .. For the splicing minigene assay, a 284bp fragment of the PRPF31 (NM_015629.3) 5’UTR was amplified from commercially available reference genomic DNA (Promega) using either wild-type or variant-specific primers (Additional file : Table S4) using Phusion High Fidelity DNA Polymerase (NEB) according to manufacturer’s recommendations. .. The wild-type and mutant PRPF31 fragments were cloned into the SK3 plasmid (a derivative of the pSpliceExpress minigene splice reporter vector, gifted from Stefan Stamm, Addgene #32485) using the Gibson method.

Article Title: Combining a prioritization strategy and functional studies nominates 5'UTR variants underlying inherited retinal disease.
Article Snippet: To perform functional studies of the identified 5’UTR ARL3 variant, lymphocytes from affected carriers (n = 2) were isolated from EDTA blood using Lymphoprep (STEMCELL technologies). .. For the splicing minigene assay, a 284bp fragment of the PRPF31 (NM_015629.3) 5’UTR was amplified from commercially available reference genomic DNA (Promega) using either wild-type or variant-specific primers (Additional file 1: Table S4) using Phusion High Fidelity DNA Polymerase (NEB) according to manufacturer’s recommendations. .. The wild-type and mutant PRPF31 fragments were cloned into the SK3 plasmid (a derivative of the pSpliceExpress minigene splice reporter vector, gifted from Stefan Stamm, Addgene #32485) using the Gibson method.

Amplification:

Variant Assay:

other:

Article Title: Computer vision techniques for high-speed atomic force microscopy of DNA molecules
Article Snippet: Five micrograms of wild-type female genomic DNA (Promega) were treated with 10 U of HpyCH4V and 20 U of Mung Bean nuclease (both enzymes from New England Biolabs) in 50 μ l of 1× CutSmart buffer (New England Biolabs) for 1 h at 37 C followed by purification with MinElute purification kit (Qiagen). crRNA and tracRNA were obtained from Integrated DNA Technologies and gRNA were prepared according to protocol from the manufacturer (for sequences Guide RNA sequences: gRNA1-CCTGACTGAGGCCGAACCCC; gRNA2-CTCTTCAGCCCTGCTAGCGC; gRNA3-TCCACAACTACCCACACGAC).

Article Title: Computer Vision Techniques for High-Speed Atomic Force Microscopy of DNA Molecules.
Article Snippet: Five micrograms of wild-type female genomic DNA (Promega) were treated with 10 U of HpyCH4V and 20 U of Mung Bean nuclease (both enzymes from New England Biolabs) in 50 ul of 1x CutSmart buffer (New England Biolabs) for 1 hour at 37C followed by purification with MinElute purification kit (Qiagen). crRNA and tracRNA were obtained from Integrated DNA Technologies and gRNA were prepared according to protocol from the manufacturer (for sequences Guide RNA seqences: gRNA1-CCTGACTGAGGCCGAACCCC; gRNA2-CTCTTCAGCCCTGCTAGCGC; gRNA3TCCACAACTACCCACACGAC).

Negative Control:

Article Title: Fulvestrant and everolimus efficacy after CDK4/6 inhibitor: a prospective study with circulating tumor DNA analysis
Article Snippet: .. Genomic DNA from healthy donors purchased from Promega (Madison, WI, USA) was used as negative control. ..

Review