pbluescript sk vector (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
pbluescript sk vector
Pbluescript Sk Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pbluescript+vector/pBluescript+SK+%2B%2F-+mTRF1+(Plasmid+%2312303)/pmc12595211-76-27-35
Average 93 stars, based on 39 article reviews
Pbluescript Sk Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pbluescript+vector/pBluescript+SK+%2B%2F-+mTRF1+(Plasmid+%2312303)/pmc12595211-76-27-35
Average 93 stars, based on 39 article reviews
pbluescript sk vector - by Bioz Stars,
2026-10
93/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: Harmonizing TREC Thresholds in Newborn Screening for SCID: Insights From Russian Validation Cohort. Article Snippet: .. Human albumin, δREC–ψJα T cell receptor, and kappa- deleting joint of KREC were PCR amplified from DNA obtained from the peripheral blood of a healthy donor and separately cloned into the Article Title: Harmonizing TREC Thresholds in Newborn Screening for SCID : Insights From Russian Validation Cohort Article Snippet: .. Human albumin, δREC–ψJα T cell receptor, and kappa‐deleting joint of KREC were PCR amplified from DNA obtained from the peripheral blood of a healthy donor and separately cloned into the Article Title: Article Snippet: .. A 2265-bp PCR fragment encompassing the locus was amplified by using the following oligonucleotides (SPfim3UP2: GAGCTCTTTACCGCGGCCGCCAGTTGTTCATCAATG (SEQ ID NO: 1) and ASPfim3LO2: GGATCCATCATCGAGACCGACTGG (SEQ ID NO: 2)) and cloned into the SacI and BamHI restriction sites of a Amplification:Article Title: Harmonizing TREC Thresholds in Newborn Screening for SCID: Insights From Russian Validation Cohort. Article Snippet: .. Human albumin, δREC–ψJα T cell receptor, and kappa- deleting joint of KREC were PCR amplified from DNA obtained from the peripheral blood of a healthy donor and separately cloned into the Article Title: Harmonizing TREC Thresholds in Newborn Screening for SCID : Insights From Russian Validation Cohort Article Snippet: .. Human albumin, δREC–ψJα T cell receptor, and kappa‐deleting joint of KREC were PCR amplified from DNA obtained from the peripheral blood of a healthy donor and separately cloned into the Article Title: Article Snippet: .. A 2265-bp PCR fragment encompassing the locus was amplified by using the following oligonucleotides (SPfim3UP2: GAGCTCTTTACCGCGGCCGCCAGTTGTTCATCAATG (SEQ ID NO: 1) and ASPfim3LO2: GGATCCATCATCGAGACCGACTGG (SEQ ID NO: 2)) and cloned into the SacI and BamHI restriction sites of a Clone Assay:Article Title: Harmonizing TREC Thresholds in Newborn Screening for SCID: Insights From Russian Validation Cohort. Article Snippet: .. Human albumin, δREC–ψJα T cell receptor, and kappa- deleting joint of KREC were PCR amplified from DNA obtained from the peripheral blood of a healthy donor and separately cloned into the Article Title: Harmonizing TREC Thresholds in Newborn Screening for SCID : Insights From Russian Validation Cohort Article Snippet: .. Human albumin, δREC–ψJα T cell receptor, and kappa‐deleting joint of KREC were PCR amplified from DNA obtained from the peripheral blood of a healthy donor and separately cloned into the Article Title: Article Snippet: .. A 2265-bp PCR fragment encompassing the locus was amplified by using the following oligonucleotides (SPfim3UP2: GAGCTCTTTACCGCGGCCGCCAGTTGTTCATCAATG (SEQ ID NO: 1) and ASPfim3LO2: GGATCCATCATCGAGACCGACTGG (SEQ ID NO: 2)) and cloned into the SacI and BamHI restriction sites of a Plasmid Preparation:Article Title: Harmonizing TREC Thresholds in Newborn Screening for SCID: Insights From Russian Validation Cohort. Article Snippet: .. Human albumin, δREC–ψJα T cell receptor, and kappa- deleting joint of KREC were PCR amplified from DNA obtained from the peripheral blood of a healthy donor and separately cloned into the Article Title: The SMC Hinge is a Selective Gate for Obstacle Bypass Article Snippet: .. A phagemid based on Article Title: Harmonizing TREC Thresholds in Newborn Screening for SCID : Insights From Russian Validation Cohort Article Snippet: .. Human albumin, δREC–ψJα T cell receptor, and kappa‐deleting joint of KREC were PCR amplified from DNA obtained from the peripheral blood of a healthy donor and separately cloned into the Article Title: Article Snippet: .. A 2265-bp PCR fragment encompassing the locus was amplified by using the following oligonucleotides (SPfim3UP2: GAGCTCTTTACCGCGGCCGCCAGTTGTTCATCAATG (SEQ ID NO: 1) and ASPfim3LO2: GGATCCATCATCGAGACCGACTGG (SEQ ID NO: 2)) and cloned into the SacI and BamHI restriction sites of a Article Title: A Repetitive Acipenser gueldenstaedtii Genomic Region Aligning with the Acipenser baerii IGLV Gene Cluster Suggests a Role as a Transcription Termination Element Across Several Sturgeon Species. Article Snippet: Plasmids pcDNA 3.1/V5-His-TOPO and pcDNA 3.1/V5-His-TOPO/LacZ were part of the pcDNA 3.1/V5-His-TOPO Expression Kit (ThermoFisher Scientific, Waltham, MA, USA). .. Article Title: A Repetitive Acipenser gueldenstaedtii Genomic Region Aligning with the Acipenser baerii IGLV Gene Cluster Suggests a Role as a Transcription Termination Element Across Several Sturgeon Species Article Snippet: Plasmids pcDNA 3.1/V5-His-TOPO and pcDNA 3.1/V5-His-TOPO/LacZ were part of the pcDNA 3.1/V5-His-TOPO Expression Kit (ThermoFisher Scientific, Waltham, MA, USA). .. Article Title: Quercetin suppresses endometrial cancer stem cells via ERα-mediated inhibition of STAT3 signaling Article Snippet: .. The ERα cDNA of the human species was bought from Addgene (Cambridge, MA, USA) and was further cultivated by cloning into the EcoRI restriction site of the Article Title: The SMC Hinge is a Selective Gate for Obstacle Bypass. Article Snippet: .. A phagemid based on Transformation Assay:Article Title: The SMC Hinge is a Selective Gate for Obstacle Bypass Article Snippet: .. A phagemid based on Article Title: The SMC Hinge is a Selective Gate for Obstacle Bypass. Article Snippet: .. A phagemid based on Subcloning:Article Title: A Repetitive Acipenser gueldenstaedtii Genomic Region Aligning with the Acipenser baerii IGLV Gene Cluster Suggests a Role as a Transcription Termination Element Across Several Sturgeon Species. Article Snippet: Plasmids pcDNA 3.1/V5-His-TOPO and pcDNA 3.1/V5-His-TOPO/LacZ were part of the pcDNA 3.1/V5-His-TOPO Expression Kit (ThermoFisher Scientific, Waltham, MA, USA). .. Article Title: A Repetitive Acipenser gueldenstaedtii Genomic Region Aligning with the Acipenser baerii IGLV Gene Cluster Suggests a Role as a Transcription Termination Element Across Several Sturgeon Species Article Snippet: Plasmids pcDNA 3.1/V5-His-TOPO and pcDNA 3.1/V5-His-TOPO/LacZ were part of the pcDNA 3.1/V5-His-TOPO Expression Kit (ThermoFisher Scientific, Waltham, MA, USA). .. Cloning:Article Title: Quercetin suppresses endometrial cancer stem cells via ERα-mediated inhibition of STAT3 signaling Article Snippet: .. The ERα cDNA of the human species was bought from Addgene (Cambridge, MA, USA) and was further cultivated by cloning into the EcoRI restriction site of the |