human shroom3 cdna orf (OriGene)

OriGene is a verified supplier

OriGene manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

OriGene human shroom3 cdna orf

Introgression of the BN <t>Shroom3</t> gene onto FHH background improves glomerular and overall kidney function. ( A ) At 14 wk of age, both homozygous and heterozygous FHH.BN14a congenic animals showed a significantly lower degree of albuminuria compared to FHH ( n = 4, 7, 8, and 3, respectively). ( B ) Both heterozygous and homozygous FHH.BN14a demonstrated significantly improved glomerular permeability (Palb) compared to FHH. ( n = 4 animals/115 glomeruli, 3 animals/76 glomeruli, and 2 animals/70 glomeruli, respectively. Palb in BN was obtained from previously published data .) ( C ) FHH.BN14a kidney showed a decreased presence of glomerular sclerosis compared to FHH at 14 wk of age. A minimum of 30 glomeruli from three kidneys for each strain were scored for a percentage of sclerosis using a scale from 0 (no sclerosis) to 4 (complete sclerosis). ( D ) Representative trichrome-stained images of glomeruli from FHH and FHH.BN14a are shown. Fibrotic tissues are indicated by blue stain. Scale bars = 50 µm. ( E ) Electron microscopic images of glomeruli showed podocyte foot process fusion (indicated by arrow) in FHH compared to FHH.BN14a animals at 18 wk of age. Scale bars = 500 µm. (CL) Capillary lumen, (*) P < 0.05 vs. FHH, (#) P < 0.05 vs. BN.

Human Shroom3 Cdna Orf, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 277 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/origin+reference+frame+function/Atp6ap1+(BC048241)+Mouse+Tagged+ORF+Clone/pmc04317173-146-11-15
Average 96 stars, based on 277 article reviews

human shroom3 cdna orf - by Bioz Stars, 2026-09

96/100 stars

Images

1) Product Images from "Shroom3 contributes to the maintenance of the glomerular filtration barrier integrity"

Article Title: Shroom3 contributes to the maintenance of the glomerular filtration barrier integrity

Journal: Genome Research

doi: 10.1101/gr.182881.114

Introgression of the BN Shroom3 gene onto FHH background improves glomerular and overall kidney function. ( A ) At 14 wk of age, both homozygous and heterozygous FHH.BN14a congenic animals showed a significantly lower degree of albuminuria compared to FHH ( n = 4, 7, 8, and 3, respectively). ( B ) Both heterozygous and homozygous FHH.BN14a demonstrated significantly improved glomerular permeability (Palb) compared to FHH. ( n = 4 animals/115 glomeruli, 3 animals/76 glomeruli, and 2 animals/70 glomeruli, respectively. Palb in BN was obtained from previously published data .) ( C ) FHH.BN14a kidney showed a decreased presence of glomerular sclerosis compared to FHH at 14 wk of age. A minimum of 30 glomeruli from three kidneys for each strain were scored for a percentage of sclerosis using a scale from 0 (no sclerosis) to 4 (complete sclerosis). ( D ) Representative trichrome-stained images of glomeruli from FHH and FHH.BN14a are shown. Fibrotic tissues are indicated by blue stain. Scale bars = 50 µm. ( E ) Electron microscopic images of glomeruli showed podocyte foot process fusion (indicated by arrow) in FHH compared to FHH.BN14a animals at 18 wk of age. Scale bars = 500 µm. (CL) Capillary lumen, (*) P < 0.05 vs. FHH, (#) P < 0.05 vs. BN.

Figure Legend Snippet: Introgression of the BN Shroom3 gene onto FHH background improves glomerular and overall kidney function. ( A ) At 14 wk of age, both homozygous and heterozygous FHH.BN14a congenic animals showed a significantly lower degree of albuminuria compared to FHH ( n = 4, 7, 8, and 3, respectively). ( B ) Both heterozygous and homozygous FHH.BN14a demonstrated significantly improved glomerular permeability (Palb) compared to FHH. ( n = 4 animals/115 glomeruli, 3 animals/76 glomeruli, and 2 animals/70 glomeruli, respectively. Palb in BN was obtained from previously published data .) ( C ) FHH.BN14a kidney showed a decreased presence of glomerular sclerosis compared to FHH at 14 wk of age. A minimum of 30 glomeruli from three kidneys for each strain were scored for a percentage of sclerosis using a scale from 0 (no sclerosis) to 4 (complete sclerosis). ( D ) Representative trichrome-stained images of glomeruli from FHH and FHH.BN14a are shown. Fibrotic tissues are indicated by blue stain. Scale bars = 50 µm. ( E ) Electron microscopic images of glomeruli showed podocyte foot process fusion (indicated by arrow) in FHH compared to FHH.BN14a animals at 18 wk of age. Scale bars = 500 µm. (CL) Capillary lumen, (*) P < 0.05 vs. FHH, (#) P < 0.05 vs. BN.

Techniques Used: Permeability, Staining

FHH Shroom3 is defective and contributes to glomerular dysfunction. ( A ) Schematic representation of the rat Shroom3 protein is shown. Vertical lines represent the amino acid variants found in FHH Shroom3 . Variants predicted to be damaging by PolyPhen-2 are shown in red. ( B ) Co-injection of shroom3 + tp53 morpholino (MO) with full-length BN, but not FHH, Shroom3 mRNA rescued the edema phenotype. ([***] P < 0.001 vs. MO and MO + FHHmRNA) and ( C ) cell death induced by shroom3 + tp53 MO ([*] P < 0.05 vs. uninjected control). ( D ) Representative fluorescence images of individual dorsal aorta at 1, 24, and 48 h following 70-kDa dextran injection are shown. ( E ) Co-injection with BN but not FHH Shroom3 mRNA rescued the dextran leakage induced by knockdown of endogenous shroom3 in zebrafish. ( n = 35, 26, 23, and 22, respectively. [*] P < 0.05 vs. uninjected and MO + BNmRNA.)

Figure Legend Snippet: FHH Shroom3 is defective and contributes to glomerular dysfunction. ( A ) Schematic representation of the rat Shroom3 protein is shown. Vertical lines represent the amino acid variants found in FHH Shroom3 . Variants predicted to be damaging by PolyPhen-2 are shown in red. ( B ) Co-injection of shroom3 + tp53 morpholino (MO) with full-length BN, but not FHH, Shroom3 mRNA rescued the edema phenotype. ([***] P < 0.001 vs. MO and MO + FHHmRNA) and ( C ) cell death induced by shroom3 + tp53 MO ([*] P < 0.05 vs. uninjected control). ( D ) Representative fluorescence images of individual dorsal aorta at 1, 24, and 48 h following 70-kDa dextran injection are shown. ( E ) Co-injection with BN but not FHH Shroom3 mRNA rescued the dextran leakage induced by knockdown of endogenous shroom3 in zebrafish. ( n = 35, 26, 23, and 22, respectively. [*] P < 0.05 vs. uninjected and MO + BNmRNA.)

Techniques Used: Injection, Control, Fluorescence, Knockdown

The G1073S variant disrupts the function of the FHH Shroom3 gene. ( A ) Schematic of the different recombinant Shroom3 cDNAs, where a specific region of the BN Shroom3 sequence was replaced by FHH. ( B ) Co-injection of shroom3 + tp53 MO with Shroom3∆641–3044 or Shroom3∆4117–5966 mRNA, but not Shroom3∆3044–4117 mRNA, rescued dextran leakage induced by the MO ( n = 23, 9, 18, 28, and 15, respectively). ( C ) Schematic of Shroom3 single-amino acid mutants created by site-directed mutagenesis. ( D ) Co-injection of ∆Y1291C or ∆A1356V restored normal glomerular permeability, while ∆G1073S failed to exhibit functional rescue ( n = 17, 12, 17, 23, and 21, respectively). (*) P < 0.05, (**) P < 0.001 vs. uninjected.

Figure Legend Snippet: The G1073S variant disrupts the function of the FHH Shroom3 gene. ( A ) Schematic of the different recombinant Shroom3 cDNAs, where a specific region of the BN Shroom3 sequence was replaced by FHH. ( B ) Co-injection of shroom3 + tp53 MO with Shroom3∆641–3044 or Shroom3∆4117–5966 mRNA, but not Shroom3∆3044–4117 mRNA, rescued dextran leakage induced by the MO ( n = 23, 9, 18, 28, and 15, respectively). ( C ) Schematic of Shroom3 single-amino acid mutants created by site-directed mutagenesis. ( D ) Co-injection of ∆Y1291C or ∆A1356V restored normal glomerular permeability, while ∆G1073S failed to exhibit functional rescue ( n = 17, 12, 17, 23, and 21, respectively). (*) P < 0.05, (**) P < 0.001 vs. uninjected.

Techniques Used: Variant Assay, Recombinant, Sequencing, Injection, Mutagenesis, Permeability, Functional Assay

The G1073S variant decreases the actin-binding affinity of SHROOM3 protein. ( A ) FLAG-tagged BN, FHH, or ∆G1073S SHROOM3 proteins were overexpressed in HEK293 cells, followed by immunoprecipitation against FLAG. Immunoprecipitated lysates were immunoblotted using antibodies against FLAG, ROCK1, and ACTB. A representative Western blot of immunoprecipitated lysate is provided. ( B ) Quantification of the Western blot showed that FHH SHROOM3 and ∆G1073S mutant had significantly reduced actin-binding affinity compared to BN SHROOM3. ( n = 3 per group. [*] P < 0.05 vs. BN.) ( C ) ROCK1-binding affinity was not different among the three alleles ( n = 3 per group).

Figure Legend Snippet: The G1073S variant decreases the actin-binding affinity of SHROOM3 protein. ( A ) FLAG-tagged BN, FHH, or ∆G1073S SHROOM3 proteins were overexpressed in HEK293 cells, followed by immunoprecipitation against FLAG. Immunoprecipitated lysates were immunoblotted using antibodies against FLAG, ROCK1, and ACTB. A representative Western blot of immunoprecipitated lysate is provided. ( B ) Quantification of the Western blot showed that FHH SHROOM3 and ∆G1073S mutant had significantly reduced actin-binding affinity compared to BN SHROOM3. ( n = 3 per group. [*] P < 0.05 vs. BN.) ( C ) ROCK1-binding affinity was not different among the three alleles ( n = 3 per group).

Techniques Used: Variant Assay, Binding Assay, Immunoprecipitation, Western Blot, Mutagenesis

rs181194611 (p.P1244L) associated with nondiabetic ESKD impairs SHROOM3 function in vivo. ( A ) Proline at the amino acid position 1244 in SHROOM3 is evolutionarily conserved. ( B ) Representative images of dorsal aorta at 1, 24, and 48 h following 70-kDa dextran injection are shown. ( C ) Co-injection of nonmutated human SHROOM3 mRNA restored normal glomerular permeability, while ∆P1244L failed to show functional rescue. (*) P < 0.05 vs. uninjected.

Figure Legend Snippet: rs181194611 (p.P1244L) associated with nondiabetic ESKD impairs SHROOM3 function in vivo. ( A ) Proline at the amino acid position 1244 in SHROOM3 is evolutionarily conserved. ( B ) Representative images of dorsal aorta at 1, 24, and 48 h following 70-kDa dextran injection are shown. ( C ) Co-injection of nonmutated human SHROOM3 mRNA restored normal glomerular permeability, while ∆P1244L failed to show functional rescue. (*) P < 0.05 vs. uninjected.

Techniques Used: In Vivo, Injection, Permeability, Functional Assay

Podocyte-specific disruption of shroom3 causes increased glomerular permeability and podocyte effacement in zebrafish. ( A ) Specific transgenic (TG) lines were crossed to obtain embryos expressing podocin:Gal4 and podocin:Gal4;UAS:shrm3DN . The control and mutants were injected with 70-kDa FITC-labeled dextran at 4.5–5 d post-fertilization (dpf) and analyzed for dextran clearance at 24 and 48 h post-injection (hpi). (DA) Dorsal aorta. ( B ) Representative fluorescence images of individual dorsal aorta at 1, 24, and 48 hpi are shown. ( C ) podocin:Gal4;UAS:shrm3DN mutants had significantly decreased FITC signal at 24 and 48 hpi compared to control, indicating that the glomerular filtration barrier was disrupted. ( n = 20 and 25, respectively. [***] P < 0.001.) ( D ) Electron micrograph revealed intact podocyte foot processes (indicated by arrowhead) in podocin:Gal4 animals. Foot process effacement (indicated by arrow) was observed in the podocin:Gal4;UAS:shrm3DN mutants. Scale bars = 500 µm. (CL) Capillary lumen. ( E ) podocin:Gal4;UAS:shrm3DN had a significantly reduced number of foot processes contacting glomerular basement membrane (GBM) and increased foot process diameter compared to the control. ( n = 3 per group. [**] P = 0.01, [***] P = 0.0008.)

Figure Legend Snippet: Podocyte-specific disruption of shroom3 causes increased glomerular permeability and podocyte effacement in zebrafish. ( A ) Specific transgenic (TG) lines were crossed to obtain embryos expressing podocin:Gal4 and podocin:Gal4;UAS:shrm3DN . The control and mutants were injected with 70-kDa FITC-labeled dextran at 4.5–5 d post-fertilization (dpf) and analyzed for dextran clearance at 24 and 48 h post-injection (hpi). (DA) Dorsal aorta. ( B ) Representative fluorescence images of individual dorsal aorta at 1, 24, and 48 hpi are shown. ( C ) podocin:Gal4;UAS:shrm3DN mutants had significantly decreased FITC signal at 24 and 48 hpi compared to control, indicating that the glomerular filtration barrier was disrupted. ( n = 20 and 25, respectively. [***] P < 0.001.) ( D ) Electron micrograph revealed intact podocyte foot processes (indicated by arrowhead) in podocin:Gal4 animals. Foot process effacement (indicated by arrow) was observed in the podocin:Gal4;UAS:shrm3DN mutants. Scale bars = 500 µm. (CL) Capillary lumen. ( E ) podocin:Gal4;UAS:shrm3DN had a significantly reduced number of foot processes contacting glomerular basement membrane (GBM) and increased foot process diameter compared to the control. ( n = 3 per group. [**] P = 0.01, [***] P = 0.0008.)

Techniques Used: Disruption, Permeability, Transgenic Assay, Expressing, Control, Injection, Labeling, Fluorescence, Filtration, Membrane

Recombinant:

Article Title: Polθ activity modulates sensitivity to standard therapies in DNMT3A-deficient leukemia.
Article Snippet: Female NRGS (NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav/J); (10-week-old) Inotiv/Envigo Jackson Laboratory Jackson Laboratory Cat#182; RRID: IMSR_ENV:HSD-182 Cat#007799; RRID: IMSR_JAX:007799 Cat#024099; RRID: IMSR_JAX:024099 Oligonucleotides MxCre_1: GCGGTCTGGCAGTAAAAACTATC This paper N/A MxCre_2: GTGAAACAGCATTGCTGTCACTT This paper N/A MxCre_3: CTAGGCCACAGAATTGAAAGATCT This paper N/A MxCre_4: GTAGGTGGAAATTCTAGCATCATCC This paper N/A FLT3_Fwd1: AGGTACGAGAGTCAGCTGCAGATG This paper N/A FLT3_Rev1: TGTAAAGATGGAGTAAGTGCGGGT This paper N/A hEx23_Rev1: GAGACGTCTGTGTAGTGGACG This paper N/A Dnmt3a5-F1: CCTGCACTTTTCTGTAGCTGG This paper N/A Dnmt3a5-F1: CCTGCACTTTTCTGTAGCTGG This paper N/A (Continued on next page) Cell Reports Medicine 7, 102687, March 17, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Enr2: GGGCAAGAACATAAAGTGACC This paper N/A Polq1-F: CGGGAGGCCTATGGGACTGT This paper N/A Polq1-R: GTGCACAGGCTCCAGAGATCC This paper N/A Polq2-F: CATCGAAGGAGCCTTCCGTC This paper N/A Polq2-R: CTATGCCTCGCTCTGCATCTG This paper N/A Polq3-F: CTGGCAAGGGCTTATCTGCAAG This paper N/A Polq3-R: GACTGGAGCGCCTCTATTGATG This paper N/A Polq4-F: GCTGGTAGTAGTTATGTGGCCA This paper N/A Polq4-R: AGCACTGCTGGCTTTCTGACG This paper N/A Polq5-F: TGGGGACAGTTCAGAGAACTTC This paper N/A Polq5-R: CCTGGTAAAGGATGCAAGCCCT This paper N/A Polq6-F: AGTACTGCCTGGCCTTGCTAGA This paper N/A Polq6-R: GCTCTGGGGATCTGGTTAACTGT This paper N/A Polq7-F: TGAGGATCCTGGCTCACTTGTC This paper N/A Polq7-R: CAGGCACTAAGGGGCTAGCTAG This paper N/A Recombinant DNA pCL-ECO Addgene Cat#12371; RRID: Addgene_12371 psPAX2 Addgene Cat#12260; RRID: Addgene_12260 pMD2.G Addgene Cat#12259; RRID: Addgene_12259 pCMMP-MCS-IRES-mRFP Addgene Cat#36972; RRID: Addgene_36972 pCDH-EF1-FHC-POLQ Addgene Cat#64875; RRID: Addgene_64875 pCDH-EF1-FHC-POLQ-DY2230AA Addgene Cat#64878; RRID: Addgene_64878 pCMMP-MCS-IRES-mRFP-POLQ This paper N/A pCMMP-MCS-IRES-mRFP-POLQ-DY2230AA This paper N/A pMIGR1 Addgene Cat#27490; RRID: Addgene_27490 pMIGR1-FLT3(ITD) This paper N/A pMIGR1-JAK2(V617F) This paper N/A pMIGR1-BCR-ABL1(p210) This paper N/A PARP1 mouse shRNA Origene Cat#TL509117 PARP1 mouse ORF Origene Cat# MR211449L4 HUWE1 mouse shRNA Origene Cat#TL503398 MSH2 mouse shRNA Dharmacon Cat# V3SM11241-234501644 UBE2O mouse siRNA Dharmacon Cat#L-064151-01-0020, (J-064151-09, J-0654151-10,J-065151-11,J-064151-12) Software and algorithms GraphPad Prism v10 GraphPad https://www.graphpad.com/ scientific-software/prism/; RRID: SCR_002798 ImageJ NIH https://ImageJ.nih.gov/ij/; RRID: SCR_003070 FlowJo BD Biosciences https://www.flowjo.com/ solutions/flowjo; RRID: SCR_008520 Microsoft Excel Windows https://www.microsoft.com/en-gb/; RRID: SCR_016137 Bowtie2 John Hopkins University http://bowtie-bio.sourceforge.net/ bowtie2/index.shtm; RRID: SCR_016368 (Continued on next page) e5 Cell Reports Medicine 7, 102687, March 17, 2026 .. Primary human cells and cell lines Somatic mutations in Lin-CD34+ AML patient cells obtained at diagnosis are listed in the Key resources table and were described before.19,25,38 Lin− CD34+ cells were obtained from mononuclear fractions by magnetic sorting using the EasySep Lin negative selection followed by CD34 positive selection cocktail as described before.74 Human AML primary cells (n = 10 patients) and bone marrow cells from healthy donors (n = 3) were incubated in StemSpanSFEM medium (Stem Cell Technologies, Vancouver, Canada) supplemented with the cocktail of growth factors (100 ng/mL SCF, 20 ng/mL IL-3, 100 ng/mL FLT-3 ligand, 20 ng/mL G-CSF, 20 ng/mL IL-6) as described before.74 AML samples were allocated to experimental groups based on the presence or absence of DNMT3A and TET2 mutations.

shRNA:

Software:

Transfection:

Article Title: Phosphorothioate antisense oligonucleotide induced innate immune activation is attenuated by tryptophan oxidation products
Article Snippet: .. 2.5 μg of IL4I1 ( NM_152899 ) Human Tagged ORF clone (OriGene Tech, RC210310) was transfected into cells using Lipofectamine 3000 (ThermoFisher, L3000015) according to the manufacturer’s instructions. ..

Article Title: Synaptophysin autoantibodies mediate synaptic dysfunction in cerebellar ataxia.
Article Snippet: .. In order to determine reactivity of patients’ sample to human SYP, HeLa cells were transfected with mCer-hSYP (human SYP), kindly provided by Prof. Mike Cousin (University of Edinburgh),59 rSYP-YFP (rattus SYP), kindly supplied by Dr. Hisashi Umemori (Harvard Medical School) or CD2-EmGFP (Lenti ORF clone of Human CD2 molecule, Origene), separately, using lipofectamine 2000 (Thermo Fisher) according to manufacturer’s instructuion. ..

Construct:

Article Title: DNA hypermethylation of nonspecific cytotoxic cell receptor protein 1 and poor prognosis of pancreatic cancer
Article Snippet: .. To construct the expression vector of the NCCRP1 gene, a DNA fragment encoding the full‐length ORF (OriGene Technologies, Rockville, MD, USA) was used as a template, and the NCCRP1 gene was ampli‐ fied with polymerase chain reaction (PCR) using Primestar (Takara Bio, Shiga, Japan). .. The NCCRP1 fragment was ligated into the pIRES2‐EGFP vector (CLONTECH, Palo Alto, CA, USA) using an In‐Fusion HD Cloning Kit (CLONTECH).

Expressing:

Plasmid Preparation:

Article Title: Neuroendocrine tumour morphology and platelet derived growth factor receptor alpha expression.
Article Snippet: To express human PDGFRA complementary DNA, we used a doxycycline-inducible retrovirus system (Retro-X Tet-On Advanced Inducible Expression System; Clontech Laboratories, Inc., Mountain View, CA, USA). .. The full PDGFRA ORF was purchased OriGene (OriGene Technologies, Rockville, MD, USA) and subcloned into the retroviral response vector pRetroX-Tight-Pur (Supplementary Fig. 1). ..

Polymerase Chain Reaction:

Generated:

Article Title: High-dose irradiation promotes macrophage-mediated engulfment of triple-negative breast cancer through M1 polarization via the IKZF1-CCL5 axis
Article Snippet: .. IKZF1-overexpressing cells were generated by lentiviral transduction using a mouse Ikzf1 ( NM_009578 ) tagged ORF clone (OriGene Technologies, Rockville, MD, USA). .. Cells were infected for 4 days and subsequently selected with puromycin (1 μg/mL; InvivoGen, Waltham, MA, USA) for 2 weeks to establish stable cell lines.

Review