other:Article Title: Pleiotropic role of PAX cyclolipopeptides in the Xenorhabdus bacterium mutualistically associated with entomopathogenic nematodes
Article Snippet: In addition to our analysis, the production of PAX peptides has already been confirmed in eight other strains, including X. nematophila ATCC 19061, Xenorhabdus stockiae DSM 17904, Xenorhabdus sp. KJ12.1, Xenorhabdus sp. PB62.4, X. doucetiae FRM16, Xenorhabdus khoisanae SB10, X. khoisanae J194 and X. doucetiae DSM 17909 ( , , , , ) .
Article Title: System for the assembly and modification of non-ribosomal peptide synthases
Article Snippet: 19 NRPS GxpS- GAAAGATAGCATGGCTAAAAAGG nema- 3 2-1 tophila ATCC 19061 AL- CCCAATCAACATATCGGTAAAAAAGCGAGTATGTTCCATCTGGCTCA 20 GxpS- CCCCCTGGTGGGCC 2-2 AL- CCCGTACCTTTCCGTAATCTGGTCGCTCAGGCCCACCAGGGGGTGA X.
Article Title: Quorum sensing regulators and non-ribosomal peptide synthetases govern antibacterial secretions in Xenorhabdus szentirmaii
Article Snippet: The following strains were used in this study: Xenorhabdus szentirmaii strain DSM16338 (nematode Steinernema Rerum ), Xenorhabdus nematophila strain ATCC19061 (nematode Steinernema carpocapsae), Staphylococcus saprophyticus , Escherichia coli DH5α, a clinical ESBL-producing uropathogenic E. coli MWDL6 strain , methicillin-resistant Staphylococcus aureus ATCC 43300, Enterococcus faecium ATCC 7171, Staphylococcus epidermidis , Klebsiella pneumoniae subsp. pneumoniae ATCC 33495, Neisseria flava , Streptococcus pneumoniae ATCC 6305, Acinetobacter baumannii ATCC 19606, and Candida albicans (ATCC 14053).
Article Title: Genomes of the Bacterial Endosymbionts of Carrot Psyllid Trioza apicalis Suggest Complementary Biosynthetic Capabilities
Article Snippet: 'morsitans' 0.00 46 0 G 29487 Photorhabdus 0.00 45 0 S 29488 Photorhabdus luminescens 0.00 45 0 0 141679 Photorhabdus luminescens subsp. laumondii 0.00 45 45 0 243265 Photorhabdus luminescens subsp. laumondii TTO1 0.00 1 1 S 291112 Photorhabdus asymbiotica 0.00 30 0 G 583 Proteus 0.00 30 0 S 584 Proteus mirabilis 0.00 30 30 0 1266738 Proteus mirabilis BB2000 0.00 16 6 G 570 Klebsiella 0.00 7 6 S 573 Klebsiella pneumoniae 0.00 1 1 0 1244085 Klebsiella pneumoniae CG43 0.00 2 0 S 244366 Klebsiella variicola 0.00 2 2 0 640131 Klebsiella variicola At-22 0.00 1 1 S 571 Klebsiella oxytoca 0.00 9 0 G 620 Shigella 0.00 9 9 S 624 Shigella sonnei 0.00 3 0 G 626 Xenorhabdus 0.00 3 0 S 628 Xenorhabdus nematophila 0.00 3 3 0 406817 Xenorhabdus nematophila ATCC 19061 0.00 2 0 G 590 Salmonella 0.00 1 0 S 28901 Salmonella enterica 0.00 1 0 0 59201 Salmonella enterica subsp. enterica 0.00 1 0 0 600 Salmonella enterica subsp. enterica serovar Thompson 0.00 1 1 0 1064551 Salmonella enterica subsp. enterica serovar Thompson str.
Virus:Article Title: Poly-immunity arrays associated with Rhs toxins confer wide protection against competitors.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli DH5α Lab stock N/A Photorhabdus laumondii TT01 Duchaud et al.52 N/A Xenorhabdus nematophila ATCC 19061 Thomas and Poinar53 N/A Xenorhabdus nematophila F1 Leclerc and Boemare54 N/A Xenorhabdus japonica DSM 16522T Nishimura et al.55 N/A Xenorhabdus bovienii CS03 Bisch et al.56 N/A Chemicals, peptides, and recombinant proteins Lysogeny Broth Difco Cat No. 244620 Nutrient Agar Difco Cat No. 269100 Ampicillin Sigma-Aldrich Cat No. A9518 Chloramphenicol Sigma-Aldrich Cat No. C0378 L-arabinose Sigma-Aldrich Cat No. A3256 Isopropyl β-d-1-thiogalactopyranoside (IPTG) Neo Biotech Cat No. NB-64-28601 Q5 DNA polymerase New England Biolabs Cat No. M0491L PrimeSTAR Max DNA Polymerase Takara Cat No. R045 Restriction endonuclease KpnI-HF New England Biolabs Cat No. R3142S Restriction endonuclease XhoI New England Biolabs Cat No. R0146S Restriction endonuclease SalI-HF New England Biolabs Cat No. R3138S Restriction endonuclease SphI-HF New England Biolabs Cat No. R3182S T4 DNA ligase New England Biolabs Cat No. M0202S T4 polynucleotide kinase New England Biolabs Cat No. M0201S RNAprotect reagent Qiagen Cat No. 76506 RNeasy Mini Kit Qiagen Cat No. 74104 DNase I Qiagen Cat No. 79254 Critical commercial assays NucleoSpin Gel and PCR Clean-up kit Macherey-Nagel Cat No. 740611.250 NucleoSpin Plasmid kit Macherey-Nagel Cat No. 740588.250 EconoTaq PLUS GREEN 2x Master Mix Biosearch technologies Cat No. F93481-1 Wizard Plus SV Miniprep kit Promega Cat No. A1460 SuperScript II RTase Kit Invitrogen Cat No. 18064014 QIAamp DNA Mini Kit Qiagen Cat No. 51304 Oligonucleotides Oligonucleotides used in this study: see Table S1 This paper N/A Recombinant DNA Plasmid: pNDM220 Gotfredsen and Gerdes57 N/A Plasmid: pNDM220-medRBS This paper N/A Plasmid: pBAD33 Guzman et al.27 N/A Plasmid: pNDM-medRBS-xnTox1 This paper N/A Plasmid: pNDM-medRBS-xnTox2 This paper N/A Plasmid: pNDM-medRBS-xjTox3 This paper N/A Plasmid: pNDM-medRBS-xbTox4 This paper N/A Plasmid: pBAD-xnImm1 This paper N/A Plasmid: pBAD-xnImm2 This paper N/A (Continued on next page) ll OPEN ACCESS Current Biology 36, 1–12.e1–e3, January 5, 2026 e1 Article ..
Recombinant:Article Title: Poly-immunity arrays associated with Rhs toxins confer wide protection against competitors.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli DH5α Lab stock N/A Photorhabdus laumondii TT01 Duchaud et al.52 N/A Xenorhabdus nematophila ATCC 19061 Thomas and Poinar53 N/A Xenorhabdus nematophila F1 Leclerc and Boemare54 N/A Xenorhabdus japonica DSM 16522T Nishimura et al.55 N/A Xenorhabdus bovienii CS03 Bisch et al.56 N/A Chemicals, peptides, and recombinant proteins Lysogeny Broth Difco Cat No. 244620 Nutrient Agar Difco Cat No. 269100 Ampicillin Sigma-Aldrich Cat No. A9518 Chloramphenicol Sigma-Aldrich Cat No. C0378 L-arabinose Sigma-Aldrich Cat No. A3256 Isopropyl β-d-1-thiogalactopyranoside (IPTG) Neo Biotech Cat No. NB-64-28601 Q5 DNA polymerase New England Biolabs Cat No. M0491L PrimeSTAR Max DNA Polymerase Takara Cat No. R045 Restriction endonuclease KpnI-HF New England Biolabs Cat No. R3142S Restriction endonuclease XhoI New England Biolabs Cat No. R0146S Restriction endonuclease SalI-HF New England Biolabs Cat No. R3138S Restriction endonuclease SphI-HF New England Biolabs Cat No. R3182S T4 DNA ligase New England Biolabs Cat No. M0202S T4 polynucleotide kinase New England Biolabs Cat No. M0201S RNAprotect reagent Qiagen Cat No. 76506 RNeasy Mini Kit Qiagen Cat No. 74104 DNase I Qiagen Cat No. 79254 Critical commercial assays NucleoSpin Gel and PCR Clean-up kit Macherey-Nagel Cat No. 740611.250 NucleoSpin Plasmid kit Macherey-Nagel Cat No. 740588.250 EconoTaq PLUS GREEN 2x Master Mix Biosearch technologies Cat No. F93481-1 Wizard Plus SV Miniprep kit Promega Cat No. A1460 SuperScript II RTase Kit Invitrogen Cat No. 18064014 QIAamp DNA Mini Kit Qiagen Cat No. 51304 Oligonucleotides Oligonucleotides used in this study: see Table S1 This paper N/A Recombinant DNA Plasmid: pNDM220 Gotfredsen and Gerdes57 N/A Plasmid: pNDM220-medRBS This paper N/A Plasmid: pBAD33 Guzman et al.27 N/A Plasmid: pNDM-medRBS-xnTox1 This paper N/A Plasmid: pNDM-medRBS-xnTox2 This paper N/A Plasmid: pNDM-medRBS-xjTox3 This paper N/A Plasmid: pNDM-medRBS-xbTox4 This paper N/A Plasmid: pBAD-xnImm1 This paper N/A Plasmid: pBAD-xnImm2 This paper N/A (Continued on next page) ll OPEN ACCESS Current Biology 36, 1–12.e1–e3, January 5, 2026 e1 Article ..
Polymerase Chain Reaction:Article Title: Poly-immunity arrays associated with Rhs toxins confer wide protection against competitors.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli DH5α Lab stock N/A Photorhabdus laumondii TT01 Duchaud et al.52 N/A Xenorhabdus nematophila ATCC 19061 Thomas and Poinar53 N/A Xenorhabdus nematophila F1 Leclerc and Boemare54 N/A Xenorhabdus japonica DSM 16522T Nishimura et al.55 N/A Xenorhabdus bovienii CS03 Bisch et al.56 N/A Chemicals, peptides, and recombinant proteins Lysogeny Broth Difco Cat No. 244620 Nutrient Agar Difco Cat No. 269100 Ampicillin Sigma-Aldrich Cat No. A9518 Chloramphenicol Sigma-Aldrich Cat No. C0378 L-arabinose Sigma-Aldrich Cat No. A3256 Isopropyl β-d-1-thiogalactopyranoside (IPTG) Neo Biotech Cat No. NB-64-28601 Q5 DNA polymerase New England Biolabs Cat No. M0491L PrimeSTAR Max DNA Polymerase Takara Cat No. R045 Restriction endonuclease KpnI-HF New England Biolabs Cat No. R3142S Restriction endonuclease XhoI New England Biolabs Cat No. R0146S Restriction endonuclease SalI-HF New England Biolabs Cat No. R3138S Restriction endonuclease SphI-HF New England Biolabs Cat No. R3182S T4 DNA ligase New England Biolabs Cat No. M0202S T4 polynucleotide kinase New England Biolabs Cat No. M0201S RNAprotect reagent Qiagen Cat No. 76506 RNeasy Mini Kit Qiagen Cat No. 74104 DNase I Qiagen Cat No. 79254 Critical commercial assays NucleoSpin Gel and PCR Clean-up kit Macherey-Nagel Cat No. 740611.250 NucleoSpin Plasmid kit Macherey-Nagel Cat No. 740588.250 EconoTaq PLUS GREEN 2x Master Mix Biosearch technologies Cat No. F93481-1 Wizard Plus SV Miniprep kit Promega Cat No. A1460 SuperScript II RTase Kit Invitrogen Cat No. 18064014 QIAamp DNA Mini Kit Qiagen Cat No. 51304 Oligonucleotides Oligonucleotides used in this study: see Table S1 This paper N/A Recombinant DNA Plasmid: pNDM220 Gotfredsen and Gerdes57 N/A Plasmid: pNDM220-medRBS This paper N/A Plasmid: pBAD33 Guzman et al.27 N/A Plasmid: pNDM-medRBS-xnTox1 This paper N/A Plasmid: pNDM-medRBS-xnTox2 This paper N/A Plasmid: pNDM-medRBS-xjTox3 This paper N/A Plasmid: pNDM-medRBS-xbTox4 This paper N/A Plasmid: pBAD-xnImm1 This paper N/A Plasmid: pBAD-xnImm2 This paper N/A (Continued on next page) ll OPEN ACCESS Current Biology 36, 1–12.e1–e3, January 5, 2026 e1 Article ..
Plasmid Preparation:Article Title: Poly-immunity arrays associated with Rhs toxins confer wide protection against competitors.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli DH5α Lab stock N/A Photorhabdus laumondii TT01 Duchaud et al.52 N/A Xenorhabdus nematophila ATCC 19061 Thomas and Poinar53 N/A Xenorhabdus nematophila F1 Leclerc and Boemare54 N/A Xenorhabdus japonica DSM 16522T Nishimura et al.55 N/A Xenorhabdus bovienii CS03 Bisch et al.56 N/A Chemicals, peptides, and recombinant proteins Lysogeny Broth Difco Cat No. 244620 Nutrient Agar Difco Cat No. 269100 Ampicillin Sigma-Aldrich Cat No. A9518 Chloramphenicol Sigma-Aldrich Cat No. C0378 L-arabinose Sigma-Aldrich Cat No. A3256 Isopropyl β-d-1-thiogalactopyranoside (IPTG) Neo Biotech Cat No. NB-64-28601 Q5 DNA polymerase New England Biolabs Cat No. M0491L PrimeSTAR Max DNA Polymerase Takara Cat No. R045 Restriction endonuclease KpnI-HF New England Biolabs Cat No. R3142S Restriction endonuclease XhoI New England Biolabs Cat No. R0146S Restriction endonuclease SalI-HF New England Biolabs Cat No. R3138S Restriction endonuclease SphI-HF New England Biolabs Cat No. R3182S T4 DNA ligase New England Biolabs Cat No. M0202S T4 polynucleotide kinase New England Biolabs Cat No. M0201S RNAprotect reagent Qiagen Cat No. 76506 RNeasy Mini Kit Qiagen Cat No. 74104 DNase I Qiagen Cat No. 79254 Critical commercial assays NucleoSpin Gel and PCR Clean-up kit Macherey-Nagel Cat No. 740611.250 NucleoSpin Plasmid kit Macherey-Nagel Cat No. 740588.250 EconoTaq PLUS GREEN 2x Master Mix Biosearch technologies Cat No. F93481-1 Wizard Plus SV Miniprep kit Promega Cat No. A1460 SuperScript II RTase Kit Invitrogen Cat No. 18064014 QIAamp DNA Mini Kit Qiagen Cat No. 51304 Oligonucleotides Oligonucleotides used in this study: see Table S1 This paper N/A Recombinant DNA Plasmid: pNDM220 Gotfredsen and Gerdes57 N/A Plasmid: pNDM220-medRBS This paper N/A Plasmid: pBAD33 Guzman et al.27 N/A Plasmid: pNDM-medRBS-xnTox1 This paper N/A Plasmid: pNDM-medRBS-xnTox2 This paper N/A Plasmid: pNDM-medRBS-xjTox3 This paper N/A Plasmid: pNDM-medRBS-xbTox4 This paper N/A Plasmid: pBAD-xnImm1 This paper N/A Plasmid: pBAD-xnImm2 This paper N/A (Continued on next page) ll OPEN ACCESS Current Biology 36, 1–12.e1–e3, January 5, 2026 e1 Article ..
|
ATCC is a verified supplier 
ATCC manufactures this product 