Review



native page analysis  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Thermo Fisher native page analysis
    Native Page Analysis, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/native+sample+buffer/TRIS-glycine+native+sample+buffer/pm39419029-449-1-14
    Average 95 stars, based on 1 article reviews
    native page analysis - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    Isolation:

    Article Title: Intracellular aggregation of the transthyretin protein is limited by Hsp70 chaperones
    Article Snippet: .. Lysates were isolated in 1X Tris-Glycine Native Sample Buffer (Invitrogen LC2673) containing 1% digitonin, supplemented with protease inhibitor cocktail and PMSF (Sigma-Aldrich P7626). .. Cultures were lysed using either glass bead lysis or a Cryolyser (Bertin Technologies) and precleared at 2,300 rpm for 1 minute.

    Protease Inhibitor:

    Article Title: Intracellular aggregation of the transthyretin protein is limited by Hsp70 chaperones
    Article Snippet: .. Lysates were isolated in 1X Tris-Glycine Native Sample Buffer (Invitrogen LC2673) containing 1% digitonin, supplemented with protease inhibitor cocktail and PMSF (Sigma-Aldrich P7626). .. Cultures were lysed using either glass bead lysis or a Cryolyser (Bertin Technologies) and precleared at 2,300 rpm for 1 minute.

    other:

    Article Title: Protocol to reconstitute motor protein clustering on vesicle membranes using a DNA scaffold-based system in vitro
    Article Snippet: NovexTM Tris-Glycine Native Sample Buffer (2×) , Invitrogen , Cat#: LC2673.

    Clear Native PAGE:

    Article Title: APOE3 astrocytes can rescue lipid abnormalities and dystrophic neurites of APOE4 human neurons
    Article Snippet: .. Media samples were mixed with Native Sample Buffer (Bio-Rad, #1610738) supplemented with G-250 Sample Additive (Invitrogen, #BN2004) and run on 4–20% polyacrylamide tris-glycine gels in the absence of sodium dodecyl sulfate, reducing agents or sample boiling, in tris-glycine buffer supplemented with 1:20 native PAGE Cathode Buffer Additive (Invitrogen, #BN2002), at 150 V for 15 min. ..

    Purification:

    Article Title:
    Article Snippet: Native polyacrylamide gel electrophoresis was performed using Novex Tris-Glycine Gels (Cat# XP00100BOX, Thermofisher). .. Purified rhGNS was mixed with Novex Tris-Glycine Native Sample Buffer (Cat# LC2673, Thermofisher), 0.5 μg protein was loaded into each lane. ..

    Produced:

    Article Title: Protocol to reconstitute motor protein clustering on vesicle membranes using a DNA scaffold-based system in vitro.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal anti-β-tubulin antibody produced in mouse (1:50) Sigma Cat#: T4026 Bacterial and Virus Strains Tuner (DE3) competent cells Novagen N/A Chemicals, Peptides, and Recombinant Proteins K406GFP-SNAP Jiang et al 1 N/A Bovine brain tubulin Uppalapati et al 4 N/A NeutrAvidin Thermo Fisher Cat#: 31000 BG-GLA-NHS New England Biolabs Cat#: S9151S SYBR Green I nucleic acid gel stain Lonza Cat#: 50513 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) Avanti Polar Lipids Cat#: 850457 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N[biotinyl(polyethylene glycol)-2000] (ammonium salt) (DSPE-PEG(2000) Biotin) Avanti Polar Lipids Cat#: 880129 Atto 647N DOPE Sigma Cat#: 42247-1MG Sodium borate (0.5 M), pH 8.5 Alfa Aesar Cat#: J62902 PBS (13) Corning Cat#: 21040CV 1,4-Piperazinediethanesulfonic acid (PIPES) Sigma Cat#: P6757 Ethylene Glycol bis (2-aminoethyl ether)-N,N,N ′ , N ′ -tetraacetic acid (EGTA) Millipore Cat#: 4100 Magnesium Chloride (MgCl 2 , 2M) Sigma Cat#: 68475-100ML-F Imidazole Sigma Cat#: 792527-1KG Adenosine 5 ′ -triphosphate disodium salt hydrate (ATP) Sigma Cat#: A2383-25G Adenosine-5’-[(β,γ)-imido]triphosphate, Tetralithium salt (AMPPNP) Jena Bioscience Cat#: NU-407-50 Guanosine 5 ′ -triphosphate, Disodium salt trihydrate (GTP) Jena Bioscience Cat#: NU-1012-10G Paclitaxel (taxol) Sigma Cat#: T7191 Dimethyl sulfoxide (DMSO) VWR Cat#: N182-5X10ML Casein Sigma Cat#: C-7078 BSA, Fraction V Millipore Cat#: 2930-100GM Dextrose (D-glucose) Sigma Cat#: DX0145-1 Glucose oxidase, Aspergillus Sigma Cat#: 345386-10KU Catalase from bovine liver Sigma Cat#: C1345-1G Dithiothreitol (DTT) Thermo Scientific Cat#: 20290 NovexTM Tris-Glycine Native Sample Buffer (23) Invitrogen Cat#: LC2673 NovexTM Tris-Glycine Native Running Buffer (103) Invitrogen Cat#: LC2672 73 Cleaning Solution MP Biomedicals Cat#: 097667093 1H,1H,2H,2H-Perfluorodecyltrichlorosilane, 96% Alfa Aesar Cat#: L16584 Pluronic F-127 Sigma Cat#: P2443-250G Oligonucleotides Motor oligo IDT /5AmMC6/GTCAATAATACGATAGAGAT GGCAGAAGGGAGAGGAGTAGTGGAG GTAGAGTCAGGGCGAGAT/3Bio/ Clustering oligo IDT CCACTACTCCTCTCCCTTCTGCCCAACCA CGACAAATCCCACTACTCCTCTCCCTTCTGCCC AACCACGACAAATCCCACTACTCCTCTCCCTTCTGCC Cy3-clustering oligo IDT CCACTACTCCTCTCCCTTCTGCCCAACCACG ACAAATCCCACTACTCCTCTCCCTTCTGCCC AACCACGACAAATCCCACTACTCCTCTC CCTTCTGCC/3Cy3Sp/ Software and algorithms Fiji https://imagej.net/Fiji N/A (Continued on next page) 10 STAR Protocols 7, 104409, March 20, 2026 ..

    Virus:

    Article Title: Protocol to reconstitute motor protein clustering on vesicle membranes using a DNA scaffold-based system in vitro.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal anti-β-tubulin antibody produced in mouse (1:50) Sigma Cat#: T4026 Bacterial and Virus Strains Tuner (DE3) competent cells Novagen N/A Chemicals, Peptides, and Recombinant Proteins K406GFP-SNAP Jiang et al 1 N/A Bovine brain tubulin Uppalapati et al 4 N/A NeutrAvidin Thermo Fisher Cat#: 31000 BG-GLA-NHS New England Biolabs Cat#: S9151S SYBR Green I nucleic acid gel stain Lonza Cat#: 50513 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) Avanti Polar Lipids Cat#: 850457 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N[biotinyl(polyethylene glycol)-2000] (ammonium salt) (DSPE-PEG(2000) Biotin) Avanti Polar Lipids Cat#: 880129 Atto 647N DOPE Sigma Cat#: 42247-1MG Sodium borate (0.5 M), pH 8.5 Alfa Aesar Cat#: J62902 PBS (13) Corning Cat#: 21040CV 1,4-Piperazinediethanesulfonic acid (PIPES) Sigma Cat#: P6757 Ethylene Glycol bis (2-aminoethyl ether)-N,N,N ′ , N ′ -tetraacetic acid (EGTA) Millipore Cat#: 4100 Magnesium Chloride (MgCl 2 , 2M) Sigma Cat#: 68475-100ML-F Imidazole Sigma Cat#: 792527-1KG Adenosine 5 ′ -triphosphate disodium salt hydrate (ATP) Sigma Cat#: A2383-25G Adenosine-5’-[(β,γ)-imido]triphosphate, Tetralithium salt (AMPPNP) Jena Bioscience Cat#: NU-407-50 Guanosine 5 ′ -triphosphate, Disodium salt trihydrate (GTP) Jena Bioscience Cat#: NU-1012-10G Paclitaxel (taxol) Sigma Cat#: T7191 Dimethyl sulfoxide (DMSO) VWR Cat#: N182-5X10ML Casein Sigma Cat#: C-7078 BSA, Fraction V Millipore Cat#: 2930-100GM Dextrose (D-glucose) Sigma Cat#: DX0145-1 Glucose oxidase, Aspergillus Sigma Cat#: 345386-10KU Catalase from bovine liver Sigma Cat#: C1345-1G Dithiothreitol (DTT) Thermo Scientific Cat#: 20290 NovexTM Tris-Glycine Native Sample Buffer (23) Invitrogen Cat#: LC2673 NovexTM Tris-Glycine Native Running Buffer (103) Invitrogen Cat#: LC2672 73 Cleaning Solution MP Biomedicals Cat#: 097667093 1H,1H,2H,2H-Perfluorodecyltrichlorosilane, 96% Alfa Aesar Cat#: L16584 Pluronic F-127 Sigma Cat#: P2443-250G Oligonucleotides Motor oligo IDT /5AmMC6/GTCAATAATACGATAGAGAT GGCAGAAGGGAGAGGAGTAGTGGAG GTAGAGTCAGGGCGAGAT/3Bio/ Clustering oligo IDT CCACTACTCCTCTCCCTTCTGCCCAACCA CGACAAATCCCACTACTCCTCTCCCTTCTGCCC AACCACGACAAATCCCACTACTCCTCTCCCTTCTGCC Cy3-clustering oligo IDT CCACTACTCCTCTCCCTTCTGCCCAACCACG ACAAATCCCACTACTCCTCTCCCTTCTGCCC AACCACGACAAATCCCACTACTCCTCTC CCTTCTGCC/3Cy3Sp/ Software and algorithms Fiji https://imagej.net/Fiji N/A (Continued on next page) 10 STAR Protocols 7, 104409, March 20, 2026 ..

    Recombinant:

    Article Title: Protocol to reconstitute motor protein clustering on vesicle membranes using a DNA scaffold-based system in vitro.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal anti-β-tubulin antibody produced in mouse (1:50) Sigma Cat#: T4026 Bacterial and Virus Strains Tuner (DE3) competent cells Novagen N/A Chemicals, Peptides, and Recombinant Proteins K406GFP-SNAP Jiang et al 1 N/A Bovine brain tubulin Uppalapati et al 4 N/A NeutrAvidin Thermo Fisher Cat#: 31000 BG-GLA-NHS New England Biolabs Cat#: S9151S SYBR Green I nucleic acid gel stain Lonza Cat#: 50513 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) Avanti Polar Lipids Cat#: 850457 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N[biotinyl(polyethylene glycol)-2000] (ammonium salt) (DSPE-PEG(2000) Biotin) Avanti Polar Lipids Cat#: 880129 Atto 647N DOPE Sigma Cat#: 42247-1MG Sodium borate (0.5 M), pH 8.5 Alfa Aesar Cat#: J62902 PBS (13) Corning Cat#: 21040CV 1,4-Piperazinediethanesulfonic acid (PIPES) Sigma Cat#: P6757 Ethylene Glycol bis (2-aminoethyl ether)-N,N,N ′ , N ′ -tetraacetic acid (EGTA) Millipore Cat#: 4100 Magnesium Chloride (MgCl 2 , 2M) Sigma Cat#: 68475-100ML-F Imidazole Sigma Cat#: 792527-1KG Adenosine 5 ′ -triphosphate disodium salt hydrate (ATP) Sigma Cat#: A2383-25G Adenosine-5’-[(β,γ)-imido]triphosphate, Tetralithium salt (AMPPNP) Jena Bioscience Cat#: NU-407-50 Guanosine 5 ′ -triphosphate, Disodium salt trihydrate (GTP) Jena Bioscience Cat#: NU-1012-10G Paclitaxel (taxol) Sigma Cat#: T7191 Dimethyl sulfoxide (DMSO) VWR Cat#: N182-5X10ML Casein Sigma Cat#: C-7078 BSA, Fraction V Millipore Cat#: 2930-100GM Dextrose (D-glucose) Sigma Cat#: DX0145-1 Glucose oxidase, Aspergillus Sigma Cat#: 345386-10KU Catalase from bovine liver Sigma Cat#: C1345-1G Dithiothreitol (DTT) Thermo Scientific Cat#: 20290 NovexTM Tris-Glycine Native Sample Buffer (23) Invitrogen Cat#: LC2673 NovexTM Tris-Glycine Native Running Buffer (103) Invitrogen Cat#: LC2672 73 Cleaning Solution MP Biomedicals Cat#: 097667093 1H,1H,2H,2H-Perfluorodecyltrichlorosilane, 96% Alfa Aesar Cat#: L16584 Pluronic F-127 Sigma Cat#: P2443-250G Oligonucleotides Motor oligo IDT /5AmMC6/GTCAATAATACGATAGAGAT GGCAGAAGGGAGAGGAGTAGTGGAG GTAGAGTCAGGGCGAGAT/3Bio/ Clustering oligo IDT CCACTACTCCTCTCCCTTCTGCCCAACCA CGACAAATCCCACTACTCCTCTCCCTTCTGCCC AACCACGACAAATCCCACTACTCCTCTCCCTTCTGCC Cy3-clustering oligo IDT CCACTACTCCTCTCCCTTCTGCCCAACCACG ACAAATCCCACTACTCCTCTCCCTTCTGCCC AACCACGACAAATCCCACTACTCCTCTC CCTTCTGCC/3Cy3Sp/ Software and algorithms Fiji https://imagej.net/Fiji N/A (Continued on next page) 10 STAR Protocols 7, 104409, March 20, 2026 ..

    SYBR Green Assay:

    Article Title: Protocol to reconstitute motor protein clustering on vesicle membranes using a DNA scaffold-based system in vitro.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal anti-β-tubulin antibody produced in mouse (1:50) Sigma Cat#: T4026 Bacterial and Virus Strains Tuner (DE3) competent cells Novagen N/A Chemicals, Peptides, and Recombinant Proteins K406GFP-SNAP Jiang et al 1 N/A Bovine brain tubulin Uppalapati et al 4 N/A NeutrAvidin Thermo Fisher Cat#: 31000 BG-GLA-NHS New England Biolabs Cat#: S9151S SYBR Green I nucleic acid gel stain Lonza Cat#: 50513 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) Avanti Polar Lipids Cat#: 850457 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N[biotinyl(polyethylene glycol)-2000] (ammonium salt) (DSPE-PEG(2000) Biotin) Avanti Polar Lipids Cat#: 880129 Atto 647N DOPE Sigma Cat#: 42247-1MG Sodium borate (0.5 M), pH 8.5 Alfa Aesar Cat#: J62902 PBS (13) Corning Cat#: 21040CV 1,4-Piperazinediethanesulfonic acid (PIPES) Sigma Cat#: P6757 Ethylene Glycol bis (2-aminoethyl ether)-N,N,N ′ , N ′ -tetraacetic acid (EGTA) Millipore Cat#: 4100 Magnesium Chloride (MgCl 2 , 2M) Sigma Cat#: 68475-100ML-F Imidazole Sigma Cat#: 792527-1KG Adenosine 5 ′ -triphosphate disodium salt hydrate (ATP) Sigma Cat#: A2383-25G Adenosine-5’-[(β,γ)-imido]triphosphate, Tetralithium salt (AMPPNP) Jena Bioscience Cat#: NU-407-50 Guanosine 5 ′ -triphosphate, Disodium salt trihydrate (GTP) Jena Bioscience Cat#: NU-1012-10G Paclitaxel (taxol) Sigma Cat#: T7191 Dimethyl sulfoxide (DMSO) VWR Cat#: N182-5X10ML Casein Sigma Cat#: C-7078 BSA, Fraction V Millipore Cat#: 2930-100GM Dextrose (D-glucose) Sigma Cat#: DX0145-1 Glucose oxidase, Aspergillus Sigma Cat#: 345386-10KU Catalase from bovine liver Sigma Cat#: C1345-1G Dithiothreitol (DTT) Thermo Scientific Cat#: 20290 NovexTM Tris-Glycine Native Sample Buffer (23) Invitrogen Cat#: LC2673 NovexTM Tris-Glycine Native Running Buffer (103) Invitrogen Cat#: LC2672 73 Cleaning Solution MP Biomedicals Cat#: 097667093 1H,1H,2H,2H-Perfluorodecyltrichlorosilane, 96% Alfa Aesar Cat#: L16584 Pluronic F-127 Sigma Cat#: P2443-250G Oligonucleotides Motor oligo IDT /5AmMC6/GTCAATAATACGATAGAGAT GGCAGAAGGGAGAGGAGTAGTGGAG GTAGAGTCAGGGCGAGAT/3Bio/ Clustering oligo IDT CCACTACTCCTCTCCCTTCTGCCCAACCA CGACAAATCCCACTACTCCTCTCCCTTCTGCCC AACCACGACAAATCCCACTACTCCTCTCCCTTCTGCC Cy3-clustering oligo IDT CCACTACTCCTCTCCCTTCTGCCCAACCACG ACAAATCCCACTACTCCTCTCCCTTCTGCCC AACCACGACAAATCCCACTACTCCTCTC CCTTCTGCC/3Cy3Sp/ Software and algorithms Fiji https://imagej.net/Fiji N/A (Continued on next page) 10 STAR Protocols 7, 104409, March 20, 2026 ..

    Staining:

    Article Title: Protocol to reconstitute motor protein clustering on vesicle membranes using a DNA scaffold-based system in vitro.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal anti-β-tubulin antibody produced in mouse (1:50) Sigma Cat#: T4026 Bacterial and Virus Strains Tuner (DE3) competent cells Novagen N/A Chemicals, Peptides, and Recombinant Proteins K406GFP-SNAP Jiang et al 1 N/A Bovine brain tubulin Uppalapati et al 4 N/A NeutrAvidin Thermo Fisher Cat#: 31000 BG-GLA-NHS New England Biolabs Cat#: S9151S SYBR Green I nucleic acid gel stain Lonza Cat#: 50513 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) Avanti Polar Lipids Cat#: 850457 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N[biotinyl(polyethylene glycol)-2000] (ammonium salt) (DSPE-PEG(2000) Biotin) Avanti Polar Lipids Cat#: 880129 Atto 647N DOPE Sigma Cat#: 42247-1MG Sodium borate (0.5 M), pH 8.5 Alfa Aesar Cat#: J62902 PBS (13) Corning Cat#: 21040CV 1,4-Piperazinediethanesulfonic acid (PIPES) Sigma Cat#: P6757 Ethylene Glycol bis (2-aminoethyl ether)-N,N,N ′ , N ′ -tetraacetic acid (EGTA) Millipore Cat#: 4100 Magnesium Chloride (MgCl 2 , 2M) Sigma Cat#: 68475-100ML-F Imidazole Sigma Cat#: 792527-1KG Adenosine 5 ′ -triphosphate disodium salt hydrate (ATP) Sigma Cat#: A2383-25G Adenosine-5’-[(β,γ)-imido]triphosphate, Tetralithium salt (AMPPNP) Jena Bioscience Cat#: NU-407-50 Guanosine 5 ′ -triphosphate, Disodium salt trihydrate (GTP) Jena Bioscience Cat#: NU-1012-10G Paclitaxel (taxol) Sigma Cat#: T7191 Dimethyl sulfoxide (DMSO) VWR Cat#: N182-5X10ML Casein Sigma Cat#: C-7078 BSA, Fraction V Millipore Cat#: 2930-100GM Dextrose (D-glucose) Sigma Cat#: DX0145-1 Glucose oxidase, Aspergillus Sigma Cat#: 345386-10KU Catalase from bovine liver Sigma Cat#: C1345-1G Dithiothreitol (DTT) Thermo Scientific Cat#: 20290 NovexTM Tris-Glycine Native Sample Buffer (23) Invitrogen Cat#: LC2673 NovexTM Tris-Glycine Native Running Buffer (103) Invitrogen Cat#: LC2672 73 Cleaning Solution MP Biomedicals Cat#: 097667093 1H,1H,2H,2H-Perfluorodecyltrichlorosilane, 96% Alfa Aesar Cat#: L16584 Pluronic F-127 Sigma Cat#: P2443-250G Oligonucleotides Motor oligo IDT /5AmMC6/GTCAATAATACGATAGAGAT GGCAGAAGGGAGAGGAGTAGTGGAG GTAGAGTCAGGGCGAGAT/3Bio/ Clustering oligo IDT CCACTACTCCTCTCCCTTCTGCCCAACCA CGACAAATCCCACTACTCCTCTCCCTTCTGCCC AACCACGACAAATCCCACTACTCCTCTCCCTTCTGCC Cy3-clustering oligo IDT CCACTACTCCTCTCCCTTCTGCCCAACCACG ACAAATCCCACTACTCCTCTCCCTTCTGCCC AACCACGACAAATCCCACTACTCCTCTC CCTTCTGCC/3Cy3Sp/ Software and algorithms Fiji https://imagej.net/Fiji N/A (Continued on next page) 10 STAR Protocols 7, 104409, March 20, 2026 ..

    Software:

    Article Title: Protocol to reconstitute motor protein clustering on vesicle membranes using a DNA scaffold-based system in vitro.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal anti-β-tubulin antibody produced in mouse (1:50) Sigma Cat#: T4026 Bacterial and Virus Strains Tuner (DE3) competent cells Novagen N/A Chemicals, Peptides, and Recombinant Proteins K406GFP-SNAP Jiang et al 1 N/A Bovine brain tubulin Uppalapati et al 4 N/A NeutrAvidin Thermo Fisher Cat#: 31000 BG-GLA-NHS New England Biolabs Cat#: S9151S SYBR Green I nucleic acid gel stain Lonza Cat#: 50513 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) Avanti Polar Lipids Cat#: 850457 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N[biotinyl(polyethylene glycol)-2000] (ammonium salt) (DSPE-PEG(2000) Biotin) Avanti Polar Lipids Cat#: 880129 Atto 647N DOPE Sigma Cat#: 42247-1MG Sodium borate (0.5 M), pH 8.5 Alfa Aesar Cat#: J62902 PBS (13) Corning Cat#: 21040CV 1,4-Piperazinediethanesulfonic acid (PIPES) Sigma Cat#: P6757 Ethylene Glycol bis (2-aminoethyl ether)-N,N,N ′ , N ′ -tetraacetic acid (EGTA) Millipore Cat#: 4100 Magnesium Chloride (MgCl 2 , 2M) Sigma Cat#: 68475-100ML-F Imidazole Sigma Cat#: 792527-1KG Adenosine 5 ′ -triphosphate disodium salt hydrate (ATP) Sigma Cat#: A2383-25G Adenosine-5’-[(β,γ)-imido]triphosphate, Tetralithium salt (AMPPNP) Jena Bioscience Cat#: NU-407-50 Guanosine 5 ′ -triphosphate, Disodium salt trihydrate (GTP) Jena Bioscience Cat#: NU-1012-10G Paclitaxel (taxol) Sigma Cat#: T7191 Dimethyl sulfoxide (DMSO) VWR Cat#: N182-5X10ML Casein Sigma Cat#: C-7078 BSA, Fraction V Millipore Cat#: 2930-100GM Dextrose (D-glucose) Sigma Cat#: DX0145-1 Glucose oxidase, Aspergillus Sigma Cat#: 345386-10KU Catalase from bovine liver Sigma Cat#: C1345-1G Dithiothreitol (DTT) Thermo Scientific Cat#: 20290 NovexTM Tris-Glycine Native Sample Buffer (23) Invitrogen Cat#: LC2673 NovexTM Tris-Glycine Native Running Buffer (103) Invitrogen Cat#: LC2672 73 Cleaning Solution MP Biomedicals Cat#: 097667093 1H,1H,2H,2H-Perfluorodecyltrichlorosilane, 96% Alfa Aesar Cat#: L16584 Pluronic F-127 Sigma Cat#: P2443-250G Oligonucleotides Motor oligo IDT /5AmMC6/GTCAATAATACGATAGAGAT GGCAGAAGGGAGAGGAGTAGTGGAG GTAGAGTCAGGGCGAGAT/3Bio/ Clustering oligo IDT CCACTACTCCTCTCCCTTCTGCCCAACCA CGACAAATCCCACTACTCCTCTCCCTTCTGCCC AACCACGACAAATCCCACTACTCCTCTCCCTTCTGCC Cy3-clustering oligo IDT CCACTACTCCTCTCCCTTCTGCCCAACCACG ACAAATCCCACTACTCCTCTCCCTTCTGCCC AACCACGACAAATCCCACTACTCCTCTC CCTTCTGCC/3Cy3Sp/ Software and algorithms Fiji https://imagej.net/Fiji N/A (Continued on next page) 10 STAR Protocols 7, 104409, March 20, 2026 ..



    Similar Products

    novex tris glycine buffer  (Thermo Fisher)
    95
    Thermo Fisher novex tris glycine buffer
    Novex Tris Glycine Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/native+sample+buffer/TRIS-glycine+native+sample+buffer+(4X)%2C+pH+8%2E6/pm42361162-306-23-27
    Average 95 stars, based on 1 article reviews
    novex tris glycine buffer - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    5x native sample loading buffer 697  (Sangon Biotech)
    86
    Sangon Biotech 5x native sample loading buffer 697
    5x Native Sample Loading Buffer 697, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/native+sample+buffer/buffer+lysis+ripa/pm42298820-329-12-18
    Average 86 stars, based on 1 article reviews
    5x native sample loading buffer 697 - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    novextm tris glycine native sample buffer 2x  (Thermo Fisher)
    95
    Thermo Fisher novextm tris glycine native sample buffer 2x
    Novextm Tris Glycine Native Sample Buffer 2x, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/native+sample+buffer/TRIS-glycine+native+sample+buffer+(4X)%2C+pH+8%2E6/pm42248716-286-10-16
    Average 95 stars, based on 1 article reviews
    novextm tris glycine native sample buffer 2x - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    novex tris glycine native sample buffer 2  (Thermo Fisher)
    94
    Thermo Fisher novex tris glycine native sample buffer 2
    Novex Tris Glycine Native Sample Buffer 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/native+sample+buffer/TRIS-glycine-native+running+buffer+(10X)%2C+pH+8%2E5/us12644895-582-4-12
    Average 94 stars, based on 1 article reviews
    novex tris glycine native sample buffer 2 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    native sample loading buffer  (Sangon Biotech)
    86
    Sangon Biotech native sample loading buffer
    Native Sample Loading Buffer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/native+sample+buffer/buffer+lysis+ripa/pm42107692-191-5-10
    Average 86 stars, based on 1 article reviews
    native sample loading buffer - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    nativepage sample buffer  (Thermo Fisher)
    95
    Thermo Fisher nativepage sample buffer
    Nativepage Sample Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/native+sample+buffer/TRIS-glycine+native+sample+buffer+(4X)%2C+pH+8%2E6/pmc13137049-25-48-51
    Average 95 stars, based on 1 article reviews
    nativepage sample buffer - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    page electrophoresis buffer  (Bio-Rad)
    95
    Bio-Rad page electrophoresis buffer
    Page Electrophoresis Buffer, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/native+sample+buffer/Native+PAGE+Sample+Buffer/pmc13109725-120-14-24
    Average 95 stars, based on 1 article reviews
    page electrophoresis buffer - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    native sample buffer  (Bio-Rad)
    95
    Bio-Rad native sample buffer
    Native Sample Buffer, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/native+sample+buffer/Native+PAGE+Sample+Buffer/bio_rxiv__64898__2026__04__27__721037-302-5-8
    Average 95 stars, based on 1 article reviews
    native sample buffer - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    native protein  (Bio-Rad)
    95
    Bio-Rad native protein
    Native Protein, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/native+sample+buffer/Native+Sample+Buffer+for+Protein+Gels/pmc13168115-69-15-19
    Average 95 stars, based on 1 article reviews
    native protein - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    gel  (Thermo Fisher)
    95
    Thermo Fisher gel
    Gel, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/native+sample+buffer/TRIS-glycine+native+sample+buffer+(4X)%2C+pH+8%2E6/pm42052638-52-4-8
    Average 95 stars, based on 1 article reviews
    gel - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier

    Image Search Results