Review



ns iga mp biomedical  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Addgene inc ns iga mp biomedical
    Ns Iga Mp Biomedical, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby2/mRuby2-MyosinIIA-C-18+(Plasmid+%2355906)/pm30995475-231-207-235
    Average 90 stars, based on 1 article reviews
    ns iga mp biomedical - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Virus:

    Article Title: CD89 Is a Potent Innate Receptor for Bacteria and Mediates Host Protection from Sepsis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-SHP-1 (C-19) Cliniscience Cat# sc-287; RRID:AB_2173829 Rabbit anti-Syk (4D10) Cliniscience Cat# sc-1240; RRID:AB_628308 Anti-human TLR1 PE eBioscience Cat# 12-9911-42; RRID:AB_1272081 Anti-human TLR2 FITC IMGENEX Cat# IMG-416C; RRID:AB_317469 Anti-human TLR3 PE Invitrogen Cat# MA5-16188; RRID:AB_2537707 Anti-human TLR4 FITC IMGENEX Cat# IMG-417C; RRID:AB_317490 Anti-human TLR5 PE IMGENEX Cat# IMG-663D; RRID:AB_614264 Anti-human TLR6 PE IMGENEX Cat# IMG-304D; RRID:AB_1152366 Anti-human TLR7 FITC IMGENEX Cat# IMG-665C; RRID:AB_1152384 Anti-human TLR8 PE IMGENEX Cat# IMG-321D; RRID:AB_317509 Anti-mouse CD16/CD32 APC/Cy7 BioLegend Cat# 101327; RRID:AB_1967102 Anti-mouse CD64 APC BioLegend Cat# 139305; RRID:AB_11219205 Anti- mouse CD16.2 PE (clone: 9E9) BioLegend Cat# 149504; RRID:AB_2565811 Mouse anti-CD89 PE (clone: A59) BD PharMingen Cat# 555686; RRID:AB_396037 Anti-human Mannose APC BioLegend Cat# 321110; RRID:AB_571885 Rabbit anti-Marco Santa-cruz Cat# sc-68913; RRID:AB_2140586 Goat anti-human IgA FITC Southern Biotech Cat# 2050-02; RRID:AB_2795702 Rat anti-mouse IgA FITC BD PharMingen Cat# 559354; RRID:AB_397235 Mouse anti-CD89 (MIP-8a) BIO-RAD Cat# MCA1824; RRID:AB_322934 Mouse anti-CD89 (clone A3) Home made N/A Mouse anti-CD89 (clone A77) Home made N/A Anti-mouse-CD11-c APC-Cy7 BD PharMingen Cat# 561241; RRID:AB_10611727 Mouse IgG1 isotype PE BD PharMingen Cat# 555749; RRID:AB_396091 Armenian Hamster IgG PE BioLegend Cat# 400907; RRID:AB_326593 Mouse IgG1 Alexa-647 BioLegend Cat# 400130; RRID:AB_400130 Mouse IgG APC BioLegend Cat# 400120 Armenian Hamster IgG1, l2 BD PharMingen Cat# 117309 Ns-IgA MP biomedical Cat# 55906 Pd-IgA CSL Behring N/A Goat anti–rabbit IgG HRP GE Healthcare Cat# 65-6120; RRID:AB_88384 Bacterial and Virus Strains E. coli K12 ATCC Cat# MG1655; RRID:Addgene_61440 S. pneumoniae ATCC Ca# 6303 S. aureus ATCC Cat# 25923 S. pyogenes Pasteur institut Cat# CIP 56.41T E. coli WzxE / Yale university N/A E. coli K12 Texas-red ThermoFisher Scientific Cat# E2863 E. coli K12 pHrodo ThermoFisher Scientific Cat# P35361 Biological Samples Blood from CVID patients Saint-Louis hospital N/A Chemicals, Peptides, and Recombinant Proteins Soluble CD89 (sCD89) Sigma aldrich KK5121 (Continued on next page) e1 Cell Reports 27, 762–775.e1–e5, April 16, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays Mouse IL-1 Elisa Kit R&D system Cat# DY401-05 Mouse IL-6 Elisa Kit R&D system Ca# DY406-05 Mouse TNF alpha Elisa Kit R&D system Cat# DY410 Human IL-1 Elisa Kit R&D system Cat# DY201 Human IL-6 Elisa Kit R&D system Cat# DY206 Human TNF alpha Elisa Kit R&D system Cat# DY210 Dynabeads Untouched Human Monocytes Kit ThermoFisher Scientific Cat# 11350D Oligonucleotides Il-1 (NM_008361) Forward Eurofins 50CAACCAACAAGTGATATTCTCCATG-30 Il-1 (NM_008361) Reverse Eurofins 50GATCCACACTCTCCAGCTGCA-30 Il-1 (NM_008361) Probe Eurofins 50CTGTGTAATGAAAGACGGCACACCCACC 30 Il-6 (NM_031168) Forward Eurofins 50TCCTACCCCAATTTCCAATGC-30 Il-6 (NM_031168) Reverse Eurofins 50TGAATTGGATGGTCTTGGTCCT 30 Il-6 (NM_031168) Probe Eurofins 50CAGATAAGCTGGAGTCACAGAAGGAGTGG 30 TNF-alpha (NM_013693) Forward Eurofins 50CATCTTCTCAAAATTCGAGTGACAA 30 TNF-alpha (NM_013693) Reverse Eurofins 50TGGGAGTAGACAAGGTACAACCC 30 TNF-alpha (NM_013693) Probe Eurofins 50CACGTCGTAGCAAACCACCAAGTGGA 30 Primer: ec1tgCD89 This paper 50GGGGAATTCGACGCAAACAAGGCAGGGCGC 3 Primer: Cy21tgCD89 This paper 50GGGGTCGACCTTGCAGACACTTGGTGTTCG 3 Software and Algorithms Fiji/ImageJ National Institutes of Health https://imagej.nih.gov/ij/docs/guide/146-2.html; RRID:SCR_002285; RRID:SCR_003070 GraphPad Prism GraphPad Software RRID:SCR_002798 FACSDiva Becton Dickinson N/A FlowJo Becton Dickinson RRID:SCR_008520 IDEAS v6 AMNIS N/A Other Todd Hewitt Broth media Becton Dickinson Cat# 221714 Luria-Bertani ThermoFisher Scientific Cat# 11758902 Columbia CNA agar Becton Dickinson Cat# PA257303.04 Drigalski agar Becton Dickinson Cat# PA256500.06 5,6-carboxyfluorescein succinimidyl ester ThermoFisher Scientific Cat# 46409 Yeast extract Becton Dickinson Cat# 212750 Mouse GM-CSF Peprotech Cat# 300-03 Mouse IL-4 Peprotech Cat# 200-04 Colony-stimulating factor1 R&D system Cat# Q3U4F9

    Recombinant:

    Article Title: CD89 Is a Potent Innate Receptor for Bacteria and Mediates Host Protection from Sepsis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-SHP-1 (C-19) Cliniscience Cat# sc-287; RRID:AB_2173829 Rabbit anti-Syk (4D10) Cliniscience Cat# sc-1240; RRID:AB_628308 Anti-human TLR1 PE eBioscience Cat# 12-9911-42; RRID:AB_1272081 Anti-human TLR2 FITC IMGENEX Cat# IMG-416C; RRID:AB_317469 Anti-human TLR3 PE Invitrogen Cat# MA5-16188; RRID:AB_2537707 Anti-human TLR4 FITC IMGENEX Cat# IMG-417C; RRID:AB_317490 Anti-human TLR5 PE IMGENEX Cat# IMG-663D; RRID:AB_614264 Anti-human TLR6 PE IMGENEX Cat# IMG-304D; RRID:AB_1152366 Anti-human TLR7 FITC IMGENEX Cat# IMG-665C; RRID:AB_1152384 Anti-human TLR8 PE IMGENEX Cat# IMG-321D; RRID:AB_317509 Anti-mouse CD16/CD32 APC/Cy7 BioLegend Cat# 101327; RRID:AB_1967102 Anti-mouse CD64 APC BioLegend Cat# 139305; RRID:AB_11219205 Anti- mouse CD16.2 PE (clone: 9E9) BioLegend Cat# 149504; RRID:AB_2565811 Mouse anti-CD89 PE (clone: A59) BD PharMingen Cat# 555686; RRID:AB_396037 Anti-human Mannose APC BioLegend Cat# 321110; RRID:AB_571885 Rabbit anti-Marco Santa-cruz Cat# sc-68913; RRID:AB_2140586 Goat anti-human IgA FITC Southern Biotech Cat# 2050-02; RRID:AB_2795702 Rat anti-mouse IgA FITC BD PharMingen Cat# 559354; RRID:AB_397235 Mouse anti-CD89 (MIP-8a) BIO-RAD Cat# MCA1824; RRID:AB_322934 Mouse anti-CD89 (clone A3) Home made N/A Mouse anti-CD89 (clone A77) Home made N/A Anti-mouse-CD11-c APC-Cy7 BD PharMingen Cat# 561241; RRID:AB_10611727 Mouse IgG1 isotype PE BD PharMingen Cat# 555749; RRID:AB_396091 Armenian Hamster IgG PE BioLegend Cat# 400907; RRID:AB_326593 Mouse IgG1 Alexa-647 BioLegend Cat# 400130; RRID:AB_400130 Mouse IgG APC BioLegend Cat# 400120 Armenian Hamster IgG1, l2 BD PharMingen Cat# 117309 Ns-IgA MP biomedical Cat# 55906 Pd-IgA CSL Behring N/A Goat anti–rabbit IgG HRP GE Healthcare Cat# 65-6120; RRID:AB_88384 Bacterial and Virus Strains E. coli K12 ATCC Cat# MG1655; RRID:Addgene_61440 S. pneumoniae ATCC Ca# 6303 S. aureus ATCC Cat# 25923 S. pyogenes Pasteur institut Cat# CIP 56.41T E. coli WzxE / Yale university N/A E. coli K12 Texas-red ThermoFisher Scientific Cat# E2863 E. coli K12 pHrodo ThermoFisher Scientific Cat# P35361 Biological Samples Blood from CVID patients Saint-Louis hospital N/A Chemicals, Peptides, and Recombinant Proteins Soluble CD89 (sCD89) Sigma aldrich KK5121 (Continued on next page) e1 Cell Reports 27, 762–775.e1–e5, April 16, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays Mouse IL-1 Elisa Kit R&D system Cat# DY401-05 Mouse IL-6 Elisa Kit R&D system Ca# DY406-05 Mouse TNF alpha Elisa Kit R&D system Cat# DY410 Human IL-1 Elisa Kit R&D system Cat# DY201 Human IL-6 Elisa Kit R&D system Cat# DY206 Human TNF alpha Elisa Kit R&D system Cat# DY210 Dynabeads Untouched Human Monocytes Kit ThermoFisher Scientific Cat# 11350D Oligonucleotides Il-1 (NM_008361) Forward Eurofins 50CAACCAACAAGTGATATTCTCCATG-30 Il-1 (NM_008361) Reverse Eurofins 50GATCCACACTCTCCAGCTGCA-30 Il-1 (NM_008361) Probe Eurofins 50CTGTGTAATGAAAGACGGCACACCCACC 30 Il-6 (NM_031168) Forward Eurofins 50TCCTACCCCAATTTCCAATGC-30 Il-6 (NM_031168) Reverse Eurofins 50TGAATTGGATGGTCTTGGTCCT 30 Il-6 (NM_031168) Probe Eurofins 50CAGATAAGCTGGAGTCACAGAAGGAGTGG 30 TNF-alpha (NM_013693) Forward Eurofins 50CATCTTCTCAAAATTCGAGTGACAA 30 TNF-alpha (NM_013693) Reverse Eurofins 50TGGGAGTAGACAAGGTACAACCC 30 TNF-alpha (NM_013693) Probe Eurofins 50CACGTCGTAGCAAACCACCAAGTGGA 30 Primer: ec1tgCD89 This paper 50GGGGAATTCGACGCAAACAAGGCAGGGCGC 3 Primer: Cy21tgCD89 This paper 50GGGGTCGACCTTGCAGACACTTGGTGTTCG 3 Software and Algorithms Fiji/ImageJ National Institutes of Health https://imagej.nih.gov/ij/docs/guide/146-2.html; RRID:SCR_002285; RRID:SCR_003070 GraphPad Prism GraphPad Software RRID:SCR_002798 FACSDiva Becton Dickinson N/A FlowJo Becton Dickinson RRID:SCR_008520 IDEAS v6 AMNIS N/A Other Todd Hewitt Broth media Becton Dickinson Cat# 221714 Luria-Bertani ThermoFisher Scientific Cat# 11758902 Columbia CNA agar Becton Dickinson Cat# PA257303.04 Drigalski agar Becton Dickinson Cat# PA256500.06 5,6-carboxyfluorescein succinimidyl ester ThermoFisher Scientific Cat# 46409 Yeast extract Becton Dickinson Cat# 212750 Mouse GM-CSF Peprotech Cat# 300-03 Mouse IL-4 Peprotech Cat# 200-04 Colony-stimulating factor1 R&D system Cat# Q3U4F9



    Similar Products

    86
    Twist Bioscience mito mruby2 pcare inserts
    Mito Mruby2 Pcare Inserts, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby2/inserts+mito+mruby2+pcare/us12552834-522-12-16
    Average 86 stars, based on 1 article reviews
    mito mruby2 pcare inserts - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    91
    Addgene inc aav1 flexpkialpha ires nls mruby2
    Aav1 Flexpkialpha Ires Nls Mruby2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby2/AAV-FLEX-PKIalpha-IRES-nls-mRuby2+(Plasmid+%2363059)/pm41906363-70-0-8
    Average 91 stars, based on 1 article reviews
    aav1 flexpkialpha ires nls mruby2 - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    88
    Addgene inc addgene 103031
    Addgene 103031, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby2/pLenti+CMV-MRLC1-mRuby2-IRES-PuroR+(Plasmid+%23103031)/bio_rxiv__64898__2026__03__13__711629-172-5-5
    Average 88 stars, based on 1 article reviews
    addgene 103031 - by Bioz Stars, 2026-09
    88/100 stars
      Buy from Supplier

    93
    Addgene inc addgene provided pcdna3 mruby2
    Addgene Provided Pcdna3 Mruby2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby2/pcDNA3-mRuby2+(Plasmid+%2340260)/bio_rxiv__64898__2026__03__11__711183-172-0-0
    Average 93 stars, based on 1 article reviews
    addgene provided pcdna3 mruby2 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    94
    Addgene inc plnt sffv mruby2
    Plnt Sffv Mruby2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby2/pLNT-SFFV-mRuby2+(Plasmid+%2387217)/bio_rxiv__64898__2026__03__09__710514-150-7-13
    Average 94 stars, based on 1 article reviews
    plnt sffv mruby2 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Addgene inc paav hsyn1 mruby2
    Paav Hsyn1 Mruby2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby2/pAAV-hSyn1-mRuby2+(Plasmid+%2399126)/bio_rxiv__64898__2026__02__27__708433-178-11-13
    Average 94 stars, based on 1 article reviews
    paav hsyn1 mruby2 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    93
    Addgene inc paav cag mruby2 addgene plasmid
    Paav Cag Mruby2 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby2/pAAV-CAG-mRuby2+(Plasmid+%2399123)/pm41713415-621-200-201
    Average 93 stars, based on 1 article reviews
    paav cag mruby2 addgene plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    92
    Addgene inc paav tre mruby2
    Paav Tre Mruby2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby2/pAAV-TRE-mRuby2+(Plasmid+%2399114)/bio_rxiv__64898__2026__02__08__704659-236-37-43
    Average 92 stars, based on 1 article reviews
    paav tre mruby2 - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    93
    Addgene inc mruby2
    a Schematic overview of the experimental procedure: Day 1: preparation of thin (250 μm) and flat PAA gels; Day 2: surface functionalization with Sulfo-SANPAH and collagen coating in acidic solution; Day 3: seeding of cells transiently transfected with VinTS plasmid; Day 4: live cell imaging. b Imaging and data acquisition protocol. Step 1: stressed state bead and cell image acquisition (TFM imaging); Step 2: FLIM data acquisition of donor (Clover) channel (FRET imaging); Step3: intensity data of acceptor <t>(mRuby2)</t> channel; Step 4: relaxed state bead image acquired after the removal of the cells and the relaxation of the gel using a mild SDS solution. c Data processing workflow. Displacement fields generated from the overlay images of stressed and relaxed state bead images are calculated and subsequently converted into tractions. FRET efficiency is derived from the FRET trajectory between τ D and τ BG in the phasor space. FA structural and molecular properties are quantified from the acceptor intensity data after applying a binary FA mask. Illustrations were created using BioRender.com.
    Mruby2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby2/pcDNA3-mRuby2+(Plasmid+%2340260)/pmc12902013-265-8-9
    Average 93 stars, based on 1 article reviews
    mruby2 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    a Schematic overview of the experimental procedure: Day 1: preparation of thin (250 μm) and flat PAA gels; Day 2: surface functionalization with Sulfo-SANPAH and collagen coating in acidic solution; Day 3: seeding of cells transiently transfected with VinTS plasmid; Day 4: live cell imaging. b Imaging and data acquisition protocol. Step 1: stressed state bead and cell image acquisition (TFM imaging); Step 2: FLIM data acquisition of donor (Clover) channel (FRET imaging); Step3: intensity data of acceptor (mRuby2) channel; Step 4: relaxed state bead image acquired after the removal of the cells and the relaxation of the gel using a mild SDS solution. c Data processing workflow. Displacement fields generated from the overlay images of stressed and relaxed state bead images are calculated and subsequently converted into tractions. FRET efficiency is derived from the FRET trajectory between τ D and τ BG in the phasor space. FA structural and molecular properties are quantified from the acceptor intensity data after applying a binary FA mask. Illustrations were created using BioRender.com.

    Journal: Communications Biology

    Article Title: Linking molecular tension and cellular tractions: a multiscale approach to focal adhesion mechanics

    doi: 10.1038/s42003-026-09514-0

    Figure Lengend Snippet: a Schematic overview of the experimental procedure: Day 1: preparation of thin (250 μm) and flat PAA gels; Day 2: surface functionalization with Sulfo-SANPAH and collagen coating in acidic solution; Day 3: seeding of cells transiently transfected with VinTS plasmid; Day 4: live cell imaging. b Imaging and data acquisition protocol. Step 1: stressed state bead and cell image acquisition (TFM imaging); Step 2: FLIM data acquisition of donor (Clover) channel (FRET imaging); Step3: intensity data of acceptor (mRuby2) channel; Step 4: relaxed state bead image acquired after the removal of the cells and the relaxation of the gel using a mild SDS solution. c Data processing workflow. Displacement fields generated from the overlay images of stressed and relaxed state bead images are calculated and subsequently converted into tractions. FRET efficiency is derived from the FRET trajectory between τ D and τ BG in the phasor space. FA structural and molecular properties are quantified from the acceptor intensity data after applying a binary FA mask. Illustrations were created using BioRender.com.

    Article Snippet: Plasmid DNA expressing free Clover (Addgene #40259) and mRuby2 (Addgene #40260) were gifts from Michael Lin .

    Techniques: Transfection, Plasmid Preparation, Live Cell Imaging, Imaging, Generated, Derivative Assay

    a Traction and FRET overlay images of representative cells on soft (4.5 kPa) and stiff (13 kPa) PAA substrate. Traction arrows are scaled with traction magnitude. b Comparison of cell surface area between soft and stiff PAA substrate. n = 93 and 85 cells. c Comparison of cell-averaged tractions between the soft and stiff substrate ( n = 51 and 38 cells, respectively). Each data point represents a single cell. d Illustration of the structure and working principle of Tension Sensing Module (TSMod) during donor excitation; Clover (C) and mRuby2 (R) FRET pair is separated with a synthetic flexible polypeptide (GGSGGS) 7 ; FRET efficiency remains high due to the module’s inability to support tension. e Illustration of the structure and working principle of Vinculin Tension Sensor (VinTS) used; TSMod is inserted between vinculin head domain (VinHD) and vinculin tail domain (VinTD); FRET efficiency decreases as a result of applied tension. f Averaged focal adhesion FRET efficiencies per cell for VinTS and force-insensitive control TSMod, compared on three different substrates ( n = 20, 93, 29, 85, 22, and 26 cells). Each data point represents a single cell. The middle line of violin plots represents the median, and the upper and lower lines indicate the 75th and 25th percentiles. Statistical analysis between two groups were performed using non-parametric Mann–Whitney U test (Wilcoxon rank-sum test) for ( b , c ), and unpaired two-tailed parametric Student’s t test for ( f ): * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Illustrations ( d , e ) were created using BioRender.com.

    Journal: Communications Biology

    Article Title: Linking molecular tension and cellular tractions: a multiscale approach to focal adhesion mechanics

    doi: 10.1038/s42003-026-09514-0

    Figure Lengend Snippet: a Traction and FRET overlay images of representative cells on soft (4.5 kPa) and stiff (13 kPa) PAA substrate. Traction arrows are scaled with traction magnitude. b Comparison of cell surface area between soft and stiff PAA substrate. n = 93 and 85 cells. c Comparison of cell-averaged tractions between the soft and stiff substrate ( n = 51 and 38 cells, respectively). Each data point represents a single cell. d Illustration of the structure and working principle of Tension Sensing Module (TSMod) during donor excitation; Clover (C) and mRuby2 (R) FRET pair is separated with a synthetic flexible polypeptide (GGSGGS) 7 ; FRET efficiency remains high due to the module’s inability to support tension. e Illustration of the structure and working principle of Vinculin Tension Sensor (VinTS) used; TSMod is inserted between vinculin head domain (VinHD) and vinculin tail domain (VinTD); FRET efficiency decreases as a result of applied tension. f Averaged focal adhesion FRET efficiencies per cell for VinTS and force-insensitive control TSMod, compared on three different substrates ( n = 20, 93, 29, 85, 22, and 26 cells). Each data point represents a single cell. The middle line of violin plots represents the median, and the upper and lower lines indicate the 75th and 25th percentiles. Statistical analysis between two groups were performed using non-parametric Mann–Whitney U test (Wilcoxon rank-sum test) for ( b , c ), and unpaired two-tailed parametric Student’s t test for ( f ): * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Illustrations ( d , e ) were created using BioRender.com.

    Article Snippet: Plasmid DNA expressing free Clover (Addgene #40259) and mRuby2 (Addgene #40260) were gifts from Michael Lin .

    Techniques: Comparison, Single Cell, Control, MANN-WHITNEY, Two Tailed Test