Review



mruby lifeact  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc mruby lifeact
    Mruby Lifeact, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/mRuby-Lifeact-7+(Plasmid+%2354560)/us11360010-179-24-32
    Average 93 stars, based on 16 article reviews
    mruby lifeact - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Cell chirality reversal through tilted balance betweenpolymerization of radial bers and clockwise-swirling of transverse arcs
    Article Snippet: .. We used DNA plasmids, actin-GFP (a gift from Michael Davidson, Addgene 577 plasmid # 56421), mRuby-Lifeact (a gift from Dr. Cheng-Han Yu of the University of 578 Hong Kong), pCDNA_Lifeact-GFP_NLS-mCherry (Lifeact-GFP) (a gift from Olivier Pertz, 579 Addgene plasmid # 69058), pEFmEGFP-mDia2 (a gift from Arthur Alberts, Addgene 580 plasmid # 25407) and pEGFP-N1 alpha-actinin 1 (a gift from Carol Otey, Addgene 581 plasmid # 11908). .. The OPTIMEM medium (ThermoFisher) and Lipofectamine 3000 582 Assay (ThermoFisher) were used for transfection.

    Article Title: Dynamin-dependent entry of Chlamydia trachomatis is sequentially regulated by the effectors TarP and TmeA
    Article Snippet: .. pEGFP-Actin–C1 was a gift from Dr. Scott Grieshaber (University of Idaho), and mRuby-LifeAct-7 (Addgene plasmid #54560) was a gift from Michael Davidson. .. Dyn2-pmCherryN1 was a gift from Dr. Christien Merrifield (Addgene plasmid #27689), RFP Dynamin 2 K44A was a gift from Dr. Jennifer Lippincott-Schwartz (Addgene plasmid #128153), WT Dyn2 pEGFP was a gift from Dr. Sandra Schmid (Addgene plasmid #34686), and GFP-Dynamin 2 K44A was a gift from Dr. Pietro De Camilli (Addgene plasmid #22301).

    Article Title: Dynamin-dependent entry of Chlamydia trachomatis is sequentially regulated by the effectors TarP and TmeA
    Article Snippet: Monolayer 495 Z-stacks were transformed via Z-projecRon according to maximal fluorescence intensity in ImageJ prior to 496 quanRfying the percentage of elementary bodies which colocalize with fluorescent dextran, according to 497 the following equaRon: [ Dextran+ EBs (magenta/green) / Total EBs (green) ] x 100%. .. 498 499 Plasmids and DNA prepara.on 500 pEGFP-AcRn–C169 was a gir from Dr Sco' Grieshaber (University of Idaho), and mRuby-LifeAct-7 (Addgene 501 plasmid #54560) was a gir from Michael Davidson. .. Dyn2-pmCherryN1 was a gir from ChrisRen Merrifield 502 (Addgene plasmid #27689), RFP Dynamin2 K44A was a gir from Jennifer Lippinco'-Schwartz (Addgene 503 plasmid #128153), WT Dyn2 pEGFP was a gir from Sandra Schmid (Addgene plasmid #34686), and GFP-504 Dynamin 2 K44A was a gir from Pietro De Camilli (Addgene plasmid #22301).

    Article Title: TLNRD1 is a CCM complex component and regulates endothelial barrier integrity
    Article Snippet: Mouse antibodies were anti-CCM2 (1:1,000 for WB, MA5-25668; Thermo Fisher Scientific), anti-PECAM (1:200 for IF, 37-0700; Invitrogen), anti-Paxillin (1:200 for IF, ab32084; Abcam), and anti-GAPDH (1:1,000 for WB, 5G4; Hytest). .. The pMTS_mScarlet-i_N1 (mito-mScarlet) was a gift from Dorus Gadella (University of Amsterdam, Amsterdam, Netherlands; plasmid #85059; Addgene; RRID: Addgene_85059) ( ). mRuby-Lifeact-7 was a gift from Michael Davidson (plasmid #54560; Addgene; RRID:Addgene_54560). mScarlet-MYO10 was described previously and is available on Addgene (plasmid #145179; Addgene; RRID: Addgene_145179) ( ). ..

    Article Title: TLNRD1 is a CCM complex component and regulates endothelial barrier integrity.
    Article Snippet: Mouse antibodies were anti-CCM2 (1:1,000 for WB, MA5-25668; Thermo Fisher Scientific), anti-PECAM (1: 200 for IF, 37-0700; Invitrogen), anti-Paxillin (1:200 for IF, ab32084; Abcam), and anti-GAPDH (1:1,000 for WB, 5G4; Hytest). .. Plasmids used for cell studies The pMTS_mScarlet-i_N1 (mito-mScarlet) was a gift from Dorus Gadella (University of Amsterdam, Amsterdam, Netherlands; plasmid #85059; Addgene; RRID: Addgene_85059) (Bindels et al., 2017). mRuby-Lifeact-7 was a gift from Michael Davidson (plasmid #54560; Addgene; RRID:Addgene_54560). mScarlet-MYO10 was described previously and is available on Addgene (plasmid #145179; Addgene; RRID: Addgene_145179) (Jacquemet et al., 2019). ..

    Article Title: Dynamin-dependent entry of Chlamydia trachomatis is sequentially regulated by the effectors TarP and TmeA
    Article Snippet: Proposed model for Dyn2 525 oligomerizaRon (Figs. 1-6, S4) was assembled using BioRender (h'ps://app.biorender.com/). .. 526 527 Acknowledgements 528 The authors would like to acknowledge the following invesRgators for their generosity - Dr. Ken Fields 529 (University of Kentucky) for providing the mutant strains of C. trachomaRs described in this study; 530 pEGFP-AcRn–C169 from Dr. Sco' Grieshaber (University of Idaho), mRuby-LifeAct-7 (Addgene plasmid 531 #54560) from Dr. Michael Davidson; Dyn2-pmCherryN1 from Dr. ChrisRen Merrifield (Addgene plasmid 532 #27689); RFP Dynamin2 K44A from Dr. Jennifer Lippinco'-Schwartz (Addgene plasmid #128153), WT 533 Dyn2 pEGFP from Dr. Sandra Schmid (Addgene plasmid #34686), and GFP-Dynamin 2 K44A was from Dr. 534 Pietro De Camilli (Addgene plasmid #22301). ..

    Expressing:

    Article Title: Presynaptic filopodia form kinapses and modulate membrane mechanics for synchronous neurotransmission and seizure generation
    Article Snippet: .. The following expression vectors were used in this study and were obtained from the indicated sources: sypHy, L. Lagnado (University of Sussex); syp-mOr2, S. Takamori (Doshisha University, Kyoto, Japan); red fluorescent protein (RFP)–Bassoon, C. Garner (German Centre for Neurodegenerative Diseases, Berlin); pCAG:GPI-GFP (Addgene plasmid # 32601 ; http://n2t.net/addgene:32601 ; RRID:Addgene_32601) ( ); GPI-mApple (Addgene plasmid # 182868 ; http://n2t.net/addgene:182868 ; RRID:Addgene_182868) ( ); mRuby-Lifeact-7 (Addgene plasmid # 54560 ; http://n2t.net/addgene:54560 ; RRID:Addgene_54560); SF-iGluSnFR.A184S (Addgene plasmid # 106174 ; http://n2t.net/addgene:106174 ; RRID:Addgene_106174)( ); GCaMP6f (Addgene plasmid #40755; RRID: Addgene_40755)( ); an shRNA targeting mouse NHE1 (mSlc9a1), target sequence CCACAATTTGACCAACTTAAT, was cloned into a lentiviral vector, pLV[shRNA]-EGFP-U6>mSlc9a1[shRNA#2], VB900142-8600taz, by VectorBuilder. ..

    shRNA:

    Article Title: Presynaptic filopodia form kinapses and modulate membrane mechanics for synchronous neurotransmission and seizure generation
    Article Snippet: .. The following expression vectors were used in this study and were obtained from the indicated sources: sypHy, L. Lagnado (University of Sussex); syp-mOr2, S. Takamori (Doshisha University, Kyoto, Japan); red fluorescent protein (RFP)–Bassoon, C. Garner (German Centre for Neurodegenerative Diseases, Berlin); pCAG:GPI-GFP (Addgene plasmid # 32601 ; http://n2t.net/addgene:32601 ; RRID:Addgene_32601) ( ); GPI-mApple (Addgene plasmid # 182868 ; http://n2t.net/addgene:182868 ; RRID:Addgene_182868) ( ); mRuby-Lifeact-7 (Addgene plasmid # 54560 ; http://n2t.net/addgene:54560 ; RRID:Addgene_54560); SF-iGluSnFR.A184S (Addgene plasmid # 106174 ; http://n2t.net/addgene:106174 ; RRID:Addgene_106174)( ); GCaMP6f (Addgene plasmid #40755; RRID: Addgene_40755)( ); an shRNA targeting mouse NHE1 (mSlc9a1), target sequence CCACAATTTGACCAACTTAAT, was cloned into a lentiviral vector, pLV[shRNA]-EGFP-U6>mSlc9a1[shRNA#2], VB900142-8600taz, by VectorBuilder. ..

    Sequencing:

    Article Title: Presynaptic filopodia form kinapses and modulate membrane mechanics for synchronous neurotransmission and seizure generation
    Article Snippet: .. The following expression vectors were used in this study and were obtained from the indicated sources: sypHy, L. Lagnado (University of Sussex); syp-mOr2, S. Takamori (Doshisha University, Kyoto, Japan); red fluorescent protein (RFP)–Bassoon, C. Garner (German Centre for Neurodegenerative Diseases, Berlin); pCAG:GPI-GFP (Addgene plasmid # 32601 ; http://n2t.net/addgene:32601 ; RRID:Addgene_32601) ( ); GPI-mApple (Addgene plasmid # 182868 ; http://n2t.net/addgene:182868 ; RRID:Addgene_182868) ( ); mRuby-Lifeact-7 (Addgene plasmid # 54560 ; http://n2t.net/addgene:54560 ; RRID:Addgene_54560); SF-iGluSnFR.A184S (Addgene plasmid # 106174 ; http://n2t.net/addgene:106174 ; RRID:Addgene_106174)( ); GCaMP6f (Addgene plasmid #40755; RRID: Addgene_40755)( ); an shRNA targeting mouse NHE1 (mSlc9a1), target sequence CCACAATTTGACCAACTTAAT, was cloned into a lentiviral vector, pLV[shRNA]-EGFP-U6>mSlc9a1[shRNA#2], VB900142-8600taz, by VectorBuilder. ..

    Clone Assay:

    Article Title: Presynaptic filopodia form kinapses and modulate membrane mechanics for synchronous neurotransmission and seizure generation
    Article Snippet: .. The following expression vectors were used in this study and were obtained from the indicated sources: sypHy, L. Lagnado (University of Sussex); syp-mOr2, S. Takamori (Doshisha University, Kyoto, Japan); red fluorescent protein (RFP)–Bassoon, C. Garner (German Centre for Neurodegenerative Diseases, Berlin); pCAG:GPI-GFP (Addgene plasmid # 32601 ; http://n2t.net/addgene:32601 ; RRID:Addgene_32601) ( ); GPI-mApple (Addgene plasmid # 182868 ; http://n2t.net/addgene:182868 ; RRID:Addgene_182868) ( ); mRuby-Lifeact-7 (Addgene plasmid # 54560 ; http://n2t.net/addgene:54560 ; RRID:Addgene_54560); SF-iGluSnFR.A184S (Addgene plasmid # 106174 ; http://n2t.net/addgene:106174 ; RRID:Addgene_106174)( ); GCaMP6f (Addgene plasmid #40755; RRID: Addgene_40755)( ); an shRNA targeting mouse NHE1 (mSlc9a1), target sequence CCACAATTTGACCAACTTAAT, was cloned into a lentiviral vector, pLV[shRNA]-EGFP-U6>mSlc9a1[shRNA#2], VB900142-8600taz, by VectorBuilder. ..

    Mutagenesis:

    Article Title: Dynamin-dependent entry of Chlamydia trachomatis is sequentially regulated by the effectors TarP and TmeA
    Article Snippet: Proposed model for Dyn2 525 oligomerizaRon (Figs. 1-6, S4) was assembled using BioRender (h'ps://app.biorender.com/). .. 526 527 Acknowledgements 528 The authors would like to acknowledge the following invesRgators for their generosity - Dr. Ken Fields 529 (University of Kentucky) for providing the mutant strains of C. trachomaRs described in this study; 530 pEGFP-AcRn–C169 from Dr. Sco' Grieshaber (University of Idaho), mRuby-LifeAct-7 (Addgene plasmid 531 #54560) from Dr. Michael Davidson; Dyn2-pmCherryN1 from Dr. ChrisRen Merrifield (Addgene plasmid 532 #27689); RFP Dynamin2 K44A from Dr. Jennifer Lippinco'-Schwartz (Addgene plasmid #128153), WT 533 Dyn2 pEGFP from Dr. Sandra Schmid (Addgene plasmid #34686), and GFP-Dynamin 2 K44A was from Dr. 534 Pietro De Camilli (Addgene plasmid #22301). ..



    Similar Products

    mruby circ3xha nanoluc plasmid ppk001  (New England Biolabs)
    99
    New England Biolabs mruby circ3xha nanoluc plasmid ppk001
    Mruby Circ3xha Nanoluc Plasmid Ppk001, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/NEBuilder+HiFi+DNA+Assembly+Master+Mix/bio_rxiv__64898__2026__03__28__715045-256-9-22
    Average 99 stars, based on 1 article reviews
    mruby circ3xha nanoluc plasmid ppk001 - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    aav hsynflex mgfp 2a synaptophysin mruby  (Addgene inc)
    94
    Addgene inc aav hsynflex mgfp 2a synaptophysin mruby
    Aav Hsynflex Mgfp 2a Synaptophysin Mruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pm41746362-225-9-12
    Average 94 stars, based on 1 article reviews
    aav hsynflex mgfp 2a synaptophysin mruby - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    aav hsyn flex mgfp 2a synaptophysin mruby  (Addgene inc)
    94
    Addgene inc aav hsyn flex mgfp 2a synaptophysin mruby
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Aav Hsyn Flex Mgfp 2a Synaptophysin Mruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pmc12940476-140-9-12
    Average 94 stars, based on 1 article reviews
    aav hsyn flex mgfp 2a synaptophysin mruby - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    adeno associated virus aav based synaptophysin expression  (Addgene inc)
    94
    Addgene inc adeno associated virus aav based synaptophysin expression
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Adeno Associated Virus Aav Based Synaptophysin Expression, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pm41932937-404-1-9
    Average 94 stars, based on 1 article reviews
    adeno associated virus aav based synaptophysin expression - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    paav hsynflex mgfp 2a synaptophysin mruby  (Addgene inc)
    94
    Addgene inc paav hsynflex mgfp 2a synaptophysin mruby
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Paav Hsynflex Mgfp 2a Synaptophysin Mruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pm41932937-404-8-9
    Average 94 stars, based on 1 article reviews
    paav hsynflex mgfp 2a synaptophysin mruby - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    aav2 9 cag flex egfp wpre addgene  (Addgene inc)
    94
    Addgene inc aav2 9 cag flex egfp wpre addgene
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Aav2 9 Cag Flex Egfp Wpre Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pm41863797-674-173-175
    Average 94 stars, based on 1 article reviews
    aav2 9 cag flex egfp wpre addgene - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    mruby 3 galectin 8 fusion protein  (Galectin Therapeutics)
    86
    Galectin Therapeutics mruby 3 galectin 8 fusion protein
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Mruby 3 Galectin 8 Fusion Protein, supplied by Galectin Therapeutics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/lgals3/bio_rxiv__64898__2026__03__13__711661-70-16-16
    Average 86 stars, based on 1 article reviews
    mruby 3 galectin 8 fusion protein - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    paav1 hsyn dio mgfpsynaptophysin mruby  (Addgene inc)
    94
    Addgene inc paav1 hsyn dio mgfpsynaptophysin mruby
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Paav1 Hsyn Dio Mgfpsynaptophysin Mruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pm41611731-366-9-10
    Average 94 stars, based on 1 article reviews
    paav1 hsyn dio mgfpsynaptophysin mruby - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    plasmid plix403 capture1 apobec ha p2a mruby  (Addgene inc)
    96
    Addgene inc plasmid plix403 capture1 apobec ha p2a mruby
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Plasmid Plix403 Capture1 Apobec Ha P2a Mruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pLIX_403+(Plasmid+%2341395)/bio_rxiv__64898__2026__02__04__703776-231-1-8
    Average 96 stars, based on 1 article reviews
    plasmid plix403 capture1 apobec ha p2a mruby - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    paav1 hsyn dio mgfp synaptophysin mruby  (Addgene inc)
    94
    Addgene inc paav1 hsyn dio mgfp synaptophysin mruby
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Paav1 Hsyn Dio Mgfp Synaptophysin Mruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pmc12957525-370-10-11
    Average 94 stars, based on 1 article reviews
    paav1 hsyn dio mgfp synaptophysin mruby - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST neurons. The AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.

    Journal: The Journal of Experimental Medicine

    Article Title: Central neurons encode interleukin-1β signals and mediate stress-induced inflammation

    doi: 10.1084/jem.20252000

    Figure Lengend Snippet: BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST neurons. The AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.

    Article Snippet: For the tracing studies, either AAV-hSyn-DIO-EGFP (cat #50457; Addgene), AAV-hSyn-FLEx-mGFP-2A-Synaptophysin-mRuby (cat# 71760; Addgene), AAV-Ef1a-fDIO-EYFP (cat# 55641; Addgene), or AAV pEF1a-DIO-FLPo-WPRE-hGHpA (cat# 87306; Addgene) was utilized.

    Techniques: Anterograde Tracing, Injection, Expressing, Saline, Control