Review



gene exp hprt1 hs02800695 m1  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Thermo Fisher gene exp hprt1 hs02800695 m1

    Gene Exp Hprt1 Hs02800695 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+snp+genotype+data/Gene+Exp%2E+HPRT1%2C+Hs02800695_m1/pmc06477154-151-11-7
    Average 99 stars, based on 1 article reviews
    gene exp hprt1 hs02800695 m1 - by Bioz Stars, 2026-10
    99/100 stars

    Images

    1) Product Images from "Anti-commensal IgG Drives Intestinal Inflammation and Type 17 Immunity in Ulcerative Colitis"

    Article Title: Anti-commensal IgG Drives Intestinal Inflammation and Type 17 Immunity in Ulcerative Colitis

    Journal: Immunity

    doi: 10.1016/j.immuni.2019.02.006


    Figure Legend Snippet:

    Techniques Used: Virus, Control, Recombinant, Staining, SYBR Green Assay, Protease Inhibitor, Protein Extraction, Enzyme-linked Immunosorbent Assay, Bicinchoninic Acid Protein Assay, Chromatography, Library Quantification, SNP Genotyping Assay, Gene Expression, Microarray, Infection, Software, Transfection, Transferring

    Related Articles

    other:

    Article Title: Functional analysis of the human miRNome in non-small cell lung cancer unveils a novel miR-92b-3p/NOTCH3 axis that drives tumor progression.
    Article Snippet: Data were normalized using ESD1 (Hs00382667_m1), GUSB (Hs99999908_m1) and HPRT (Hs02800695_m1) as reference genes.

    Article Title: Comparison studies between Cesium-137 and X-ray irradiators in epithelial injury using in vitro and in vivo models
    Article Snippet: Commercially available TaqMan primers detecting mouse ChgA (Mm00514341-FAM), Alpi1 (Mm01285814-FAM), Olfm4 (Mm01320260-FAM), Cdkn1a (Mm00432448-FAM), Lgr5 (Mm00438890-FAM), Mki67 (Mm01278617-FAM), Actb (Mm04394036-VIC) and human CDKN1A (Hs00355782-FAM), KLF4 (Hs00358836-FAM), KLF5 (Hs0000000-FAM), BCL2 (Hs01048932-FAM), BAX (Hs00180269-FAM) and HPRT1 (Hs02800695-VIC) transcripts were used.

    Isolation:

    Article Title: Linkage modified oligomeric compounds and uses thereof
    Article Snippet: .. RNA was isolated and RNA expression was analyzed via RT-qPCR using primer probe set Hs02800695_m1(ThennoFisher). ..

    RNA Expression:

    Article Title: Linkage modified oligomeric compounds and uses thereof
    Article Snippet: .. RNA was isolated and RNA expression was analyzed via RT-qPCR using primer probe set Hs02800695_m1(ThennoFisher). ..

    Quantitative RT-PCR:

    Article Title: Linkage modified oligomeric compounds and uses thereof
    Article Snippet: .. RNA was isolated and RNA expression was analyzed via RT-qPCR using primer probe set Hs02800695_m1(ThennoFisher). ..

    Synthesized:

    Article Title: Quemliclustat and chemotherapy with or without zimberelimab in metastatic pancreatic adenocarcinoma: a randomized phase 1 trial
    Article Snippet: Cells were incubated in the presence of AMP (Thermo Fisher Scientific, J61643.06) and EHNA (Sigma-Aldrich, 324630) or NECA (Sigma-Aldrich, E2387) for 6 hours before RNA extraction. .. Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript IV First-Strand Synthesis System (Thermo Fisher Scientific, 18-091-050), and real-time PCR was carried out using TaqMan (Thermo Fisher Scientific) assays NR4A1 (Hs00374226_m1; cat. no. 4331182), NR4A2 (Hs01117527_g1; cat. no. 4331182), NR4A3 (Hs00545009_g1; cat. no. 4331182), HPRT1 (Hs02800695_m1; cat. no. 4448489) and ACTB (Hs01060665_g1; cat. no. 4448484). .. For RNA-seq, libraries were prepared using Illumina Stranded mRNA Prep.

    Real-time Polymerase Chain Reaction:

    Article Title: Quemliclustat and chemotherapy with or without zimberelimab in metastatic pancreatic adenocarcinoma: a randomized phase 1 trial
    Article Snippet: Cells were incubated in the presence of AMP (Thermo Fisher Scientific, J61643.06) and EHNA (Sigma-Aldrich, 324630) or NECA (Sigma-Aldrich, E2387) for 6 hours before RNA extraction. .. Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript IV First-Strand Synthesis System (Thermo Fisher Scientific, 18-091-050), and real-time PCR was carried out using TaqMan (Thermo Fisher Scientific) assays NR4A1 (Hs00374226_m1; cat. no. 4331182), NR4A2 (Hs01117527_g1; cat. no. 4331182), NR4A3 (Hs00545009_g1; cat. no. 4331182), HPRT1 (Hs02800695_m1; cat. no. 4448489) and ACTB (Hs01060665_g1; cat. no. 4448484). .. For RNA-seq, libraries were prepared using Illumina Stranded mRNA Prep.

    Article Title: CCL17 drives the expression of MMP9 and MMP13 expression via ERK1/2 and NF-κB signaling pathways in rheumatoid arthritis.
    Article Snippet: Total RNA was extracted using the ISOLATE II RNA Mini Kit (Bioline, London, UK) and reverse transcribed using Tetro reverse transcriptase (Bioline). .. Quantitative PCR (qPCR) was performed using the QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA) and pre-developed TaqMan probe/primer combinations for human MMP2 (Hs01548727_m1), MMP3 (Hs00968305_m1), MMP9 (Hs00957562_m1), MMP13 (Hs00942584_m1) and HPRT1 (Hs02800695_m1), as before [4,5,73]. .. The threshold cycle numbers were transformed to cycle threshold values and the results were plotted using GraphPad Prism version 10.4.2.

    Expressing:

    Article Title: Cell-specific DNA methylation in human alpha and beta cells regulates gene expression in type 2 diabetes
    Article Snippet: TaqMan assays were used to measure expression levels of human ADCY9 (Hs00181599_m1), human FBLL1 (Hs01584505_s1), ZNF431 (Hs00819968_m1), human ZSWIM9 (Hs00736775_m1), human ONECUT2 (Hs00191477_m1), human RHOT1 (Hs00430256_m1), human SNX1 (Hs00162052_m1), human TRAPPC13 (Hs01556088_m1), human GNAL (Hs00181836_m1), rat Adcy9 (Rn01424753_m1), rat Fbll1 (Rn06322963_s1), rat Zswim9 (Rn01753793_m1), rat Onecut2 (Rn01265320_m1), rat Snx1 (Rn01418446_m1), rat Trappc13 (Rn01493919_m1), rat Gnal (Rn01491898_m1) and rat Ins1 (Rn02121433_g1). .. Human PPIA (Hs04194521_s1) and human HPRT1 (Hs02800695_m1), as well as rat Ppia (Rn00690933_m1) and Hprt1 (Rn01527840_m1), were used as endogenous controls for normalizing mRNA expression. ..

    Article Title: Beyond the interferon score: neurofilament light chain and glial fibrillary acidic protein capture immune-mediated neuroinjury and response to JAK inhibition in Aicardi–Goutières syndrome
    Article Snippet: RNA was reverse-transcribed using the GoScript Reverse Transcription System (Promega). .. Gene expression was determined by quantitative real-time reverse transcription (RT)-PCR using the TaqMan Universal PCR Master Mix (Applied Biosystems) on an ABI7300 and normalized to GAPDH (forward: GAAGGTGAAGGTCGGAGTC; reverse: GAAGATGGTGATGGGATTTC) and hypoxanthine phosphoribosyltransferase 1 (Hs02800695_m1, Thermo Fisher Scientific) expression. ..

    Article Title: Cell-specific DNA methylation in human alpha and beta cells regulates gene expression in type 2 diabetes.
    Article Snippet: TaqMan assays were used to measure expression levels of human ADCY9 (Hs00181599_ m1), human FBLL1 (Hs01584505_s1), ZNF431 (Hs00819968_m1), human ZSWIM9 (Hs00736775_m1), human ONECUT2 (Hs00191477_m1), human RHOT1 (Hs00430256_m1), human SNX1 (Hs00162052_m1), human TRAPPC13 (Hs01556088_m1), human GNAL (Hs00181836_m1), rat Adcy9 (Rn01424753_m1), rat Fbll1 (Rn06322963_s1), rat Zswim9 (Rn01753793_ m1), rat Onecut2 (Rn01265320_m1), rat Snx1 (Rn01418446_m1), rat Trappc13 (Rn01493919_m1), rat Gnal (Rn01491898_m1) and rat Ins1 (Rn02121433_g1). .. Human PPIA (Hs04194521_s1) and human HPRT1 (Hs02800695_m1), as well as rat Ppia (Rn00690933_m1) and Hprt1 (Rn01527840_m1), were used as endogenous controls for normalizing mRNA expression. ..

    Gene Expression:

    Article Title: Beyond the interferon score: neurofilament light chain and glial fibrillary acidic protein capture immune-mediated neuroinjury and response to JAK inhibition in Aicardi–Goutières syndrome
    Article Snippet: RNA was reverse-transcribed using the GoScript Reverse Transcription System (Promega). .. Gene expression was determined by quantitative real-time reverse transcription (RT)-PCR using the TaqMan Universal PCR Master Mix (Applied Biosystems) on an ABI7300 and normalized to GAPDH (forward: GAAGGTGAAGGTCGGAGTC; reverse: GAAGATGGTGATGGGATTTC) and hypoxanthine phosphoribosyltransferase 1 (Hs02800695_m1, Thermo Fisher Scientific) expression. ..

    Reverse Transcription:

    Article Title: Beyond the interferon score: neurofilament light chain and glial fibrillary acidic protein capture immune-mediated neuroinjury and response to JAK inhibition in Aicardi–Goutières syndrome
    Article Snippet: RNA was reverse-transcribed using the GoScript Reverse Transcription System (Promega). .. Gene expression was determined by quantitative real-time reverse transcription (RT)-PCR using the TaqMan Universal PCR Master Mix (Applied Biosystems) on an ABI7300 and normalized to GAPDH (forward: GAAGGTGAAGGTCGGAGTC; reverse: GAAGATGGTGATGGGATTTC) and hypoxanthine phosphoribosyltransferase 1 (Hs02800695_m1, Thermo Fisher Scientific) expression. ..

    Polymerase Chain Reaction:

    Article Title: Beyond the interferon score: neurofilament light chain and glial fibrillary acidic protein capture immune-mediated neuroinjury and response to JAK inhibition in Aicardi–Goutières syndrome
    Article Snippet: RNA was reverse-transcribed using the GoScript Reverse Transcription System (Promega). .. Gene expression was determined by quantitative real-time reverse transcription (RT)-PCR using the TaqMan Universal PCR Master Mix (Applied Biosystems) on an ABI7300 and normalized to GAPDH (forward: GAAGGTGAAGGTCGGAGTC; reverse: GAAGATGGTGATGGGATTTC) and hypoxanthine phosphoribosyltransferase 1 (Hs02800695_m1, Thermo Fisher Scientific) expression. ..



    Similar Products

    microarray snp genotype data  (Illumina Inc)
    90
    Illumina Inc microarray snp genotype data
    Microarray Snp Genotype Data, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+snp+genotype+data/snp+genotypes/pm40563917-118-13-18
    Average 90 stars, based on 1 article reviews
    microarray snp genotype data - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    snp 6.0 microarray snp genotype data  (Thermo Fisher)
    90
    Thermo Fisher snp 6.0 microarray snp genotype data
    Mapping of the CFTR locus in a nonconsanguineous CEPH family (Pedigree 3, see the section Methods), using variant data derived either ( A ) from exome sequencing or ( B ) from microarray SNP genotyping (Affymetrix SNP 6.0). Display of Chromosome 7 haplotypes was performed using Phaser [Carr et al., ]. In this display, blue and pink vertical bars denote the haplotypes inherited by the first affected offspring from the father and mother, respectively. The disease locus must be located in a region where all affected individuals share the same combination of maternal (pink) and paternal (blue) haplotypes as this first individual. This is denoted by a purple color in the central vertical bar (region of overlap between the affected paternal and maternal haplotypes). Unaffected offspring should be discordant with their affected siblings at the disease locus (i.e., no purple bar). In this example, the actual position of the CFTR gene is marked by a horizontal red line. It can be seen that the candidate region containing CFTR is considerably smaller in ( B ), due to the superior resolution and distribution of the microarray SNPs.
    Snp 6.0 Microarray Snp Genotype Data, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+snp+genotype+data/TaqMan+Sample-to-SNP+Kit+(20+mL+sample+prep%2C+50+mL+PCR)/pmc04744743-48-12-11
    Average 90 stars, based on 1 article reviews
    snp 6.0 microarray snp genotype data - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    snp genotyping microarray data  (Illumina Inc)
    90
    Illumina Inc snp genotyping microarray data
    Mapping of the CFTR locus in a nonconsanguineous CEPH family (Pedigree 3, see the section Methods), using variant data derived either ( A ) from exome sequencing or ( B ) from microarray SNP genotyping (Affymetrix SNP 6.0). Display of Chromosome 7 haplotypes was performed using Phaser [Carr et al., ]. In this display, blue and pink vertical bars denote the haplotypes inherited by the first affected offspring from the father and mother, respectively. The disease locus must be located in a region where all affected individuals share the same combination of maternal (pink) and paternal (blue) haplotypes as this first individual. This is denoted by a purple color in the central vertical bar (region of overlap between the affected paternal and maternal haplotypes). Unaffected offspring should be discordant with their affected siblings at the disease locus (i.e., no purple bar). In this example, the actual position of the CFTR gene is marked by a horizontal red line. It can be seen that the candidate region containing CFTR is considerably smaller in ( B ), due to the superior resolution and distribution of the microarray SNPs.
    Snp Genotyping Microarray Data, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+snp+genotype+data/microarray+genotyping/10__5698_slash_1535___7511___13__s1__1-6716-8-35
    Average 90 stars, based on 1 article reviews
    snp genotyping microarray data - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    10k snp microarray genotype data  (Thermo Fisher)
    90
    Thermo Fisher 10k snp microarray genotype data
    Mapping of the CFTR locus in a nonconsanguineous CEPH family (Pedigree 3, see the section Methods), using variant data derived either ( A ) from exome sequencing or ( B ) from microarray SNP genotyping (Affymetrix SNP 6.0). Display of Chromosome 7 haplotypes was performed using Phaser [Carr et al., ]. In this display, blue and pink vertical bars denote the haplotypes inherited by the first affected offspring from the father and mother, respectively. The disease locus must be located in a region where all affected individuals share the same combination of maternal (pink) and paternal (blue) haplotypes as this first individual. This is denoted by a purple color in the central vertical bar (region of overlap between the affected paternal and maternal haplotypes). Unaffected offspring should be discordant with their affected siblings at the disease locus (i.e., no purple bar). In this example, the actual position of the CFTR gene is marked by a horizontal red line. It can be seen that the candidate region containing CFTR is considerably smaller in ( B ), due to the superior resolution and distribution of the microarray SNPs.
    10k Snp Microarray Genotype Data, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+snp+genotype+data/pmc02783450-136-8-7
    Average 90 stars, based on 1 article reviews
    10k snp microarray genotype data - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Mapping of the CFTR locus in a nonconsanguineous CEPH family (Pedigree 3, see the section Methods), using variant data derived either ( A ) from exome sequencing or ( B ) from microarray SNP genotyping (Affymetrix SNP 6.0). Display of Chromosome 7 haplotypes was performed using Phaser [Carr et al., ]. In this display, blue and pink vertical bars denote the haplotypes inherited by the first affected offspring from the father and mother, respectively. The disease locus must be located in a region where all affected individuals share the same combination of maternal (pink) and paternal (blue) haplotypes as this first individual. This is denoted by a purple color in the central vertical bar (region of overlap between the affected paternal and maternal haplotypes). Unaffected offspring should be discordant with their affected siblings at the disease locus (i.e., no purple bar). In this example, the actual position of the CFTR gene is marked by a horizontal red line. It can be seen that the candidate region containing CFTR is considerably smaller in ( B ), due to the superior resolution and distribution of the microarray SNPs.

    Journal: Human Mutation

    Article Title: Rapid Detection of Rare Deleterious Variants by Next Generation Sequencing with Optional Microarray SNP Genotype Data

    doi: 10.1002/humu.22818

    Figure Lengend Snippet: Mapping of the CFTR locus in a nonconsanguineous CEPH family (Pedigree 3, see the section Methods), using variant data derived either ( A ) from exome sequencing or ( B ) from microarray SNP genotyping (Affymetrix SNP 6.0). Display of Chromosome 7 haplotypes was performed using Phaser [Carr et al., ]. In this display, blue and pink vertical bars denote the haplotypes inherited by the first affected offspring from the father and mother, respectively. The disease locus must be located in a region where all affected individuals share the same combination of maternal (pink) and paternal (blue) haplotypes as this first individual. This is denoted by a purple color in the central vertical bar (region of overlap between the affected paternal and maternal haplotypes). Unaffected offspring should be discordant with their affected siblings at the disease locus (i.e., no purple bar). In this example, the actual position of the CFTR gene is marked by a horizontal red line. It can be seen that the candidate region containing CFTR is considerably smaller in ( B ), due to the superior resolution and distribution of the microarray SNPs.

    Article Snippet: Exome variant data were only available for two affected siblings, while Affymetrix SNP 6.0 microarray SNP genotype data were available for a third affected sibling and two unaffected siblings.

    Techniques: Variant Assay, Derivative Assay, Sequencing, Microarray