imagej microarray plugin (Optinav Inc)
90
Structured Review
Optinav Inc
imagej microarray plugin
Imagej Microarray Plugin, supplied by Optinav Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/microarray+profile+plugin+for+imagej/microarray+profile+plugin/pmc05786286-28-4-7
Average 90 stars, based on 1 article reviews
Imagej Microarray Plugin, supplied by Optinav Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/microarray+profile+plugin+for+imagej/microarray+profile+plugin/pmc05786286-28-4-7
Average 90 stars, based on 1 article reviews
imagej microarray plugin - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Microarray:Article Title: The humanized platelet glycoprotein VI Fab inhibitor EMA601 protects from arterial thrombosis and ischaemic stroke in mice Article Snippet: .. 189 Microarray binding intensities were quantified with FIJI using the Article Title: The MYCN oncoprotein is an RNA-binding accessory factor of the nuclear exosome targeting complex. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER mirE_shZFC3H1: TGCTGTTGACAG TGAGCGCCCAGGACATTCTGTCAT ATAATAGTGAAGCCACAGATGTATT ATATGACAGAATGTCCTGGATGCCT ACTGCCTCGGA Pelossof et al.51 ZFC3H1_196441_4002 mirE_shSF3B1: TGCTGTTGACAGTGAGCGAGCATTG CTTAATGATATACCATAGTGAAGCCA CAGATGTATGGTATATCATTAAGCAA TGCCTGCCTACTGCCTCGGA Pelossof et al.51 SF3B1_23451_314 mirE_XhoI_F: TACAATACTCGAGAAG GTATATTGCTGTTGACAGTGAGCG Papadopoulos et al.24 N/A mirE_EcoRI_R: TTAGATGAATTCTAG CC CCTTGAAGTCCGAGGCAGTAGGCA Papadopoulos et al.24 N/A mirE_seq: TGTTTGAATGAGGCTTCAGTAC Papadopoulos et al.24 N/A EXOSC5_sgRNA_F1 CACCGACGTGGG CTCGGCGCGATGG This paper N/A EXOSC5_sgRNA_R1 AAACCCATCGCG CCGAGCCCACGTC This paper N/A EXOSC5_sgRNA_F2 AAACCGTGCGGC TGCAGTTGTCACC This paper N/A EXOSC5_sgRNA_R2 CGCACCGGTCGC CATCTTGGCTAACAACC This paper N/A EXOSC5_HA1_Nterm_AgeI CGCACCGG TCGCCATCTTGGCTAACAACC This paper N/A EXOSC5_HA1_Nterm_MlU CGACGCGTC GCGCCGAGCTCACGTGCGG This paper N/A EXOSC5_HA2_Nterm_EcoRI CGGAATTC GAGGAGGAGACGCATACTGA This paper N/A EXOSC5_HA2_Nterm_SpeI GGACTAGTG GAGAGATGCAGTGAGGTAG This paper N/A NAID-EXOSC5_seq_fwd CAAACCACGGT TTAGCCGC This paper N/A NAID-EXOSC5_seq_rev TCCCCCATACTC CCCACAATC This paper N/A Cy5-RNA: UGGGCCUGGAAUAGUGGGGG CCCAGGGGAAGCUGCGAUGUGCUUCUG AGUGUUUGGAACGAG (50Cy5) GenScript N/A rand103Tr3 Library preparation, desalted, 200 mM /5Phos/NNNNNNNNNNAGATCG GAAGAGCACACGTCTG /3SpC3/ Van Nostrand et al.33 N/A AR17 Library preparation, desalted, 200 mM ACACGACGCTCTTCCGA Van Nostrand et al.33 N/A RiL19 Library preparation, desalted, 200 mM /5Phos/AGAUCGGAAGAGCG UCGUG/3SpC3/ Van Nostrand et al.33 N/A RNA_X1A Library preparation, desalted, 200 mM /5Phos/AUAUAGGNNNNNAGAU CGGAAGAGCGUCGUGUAG/3SpC3/ Van Nostrand et al.33 N/A RNA_X1B Library preparation, desalted, 200 mM /5Phos/AAUAGCANNNNNAGAUC GGAAGAGCGUCGUGUAG/3SpC3/ Van Nostrand et al.33 N/A RNA_X2A Library preparation, desalted, 200 mM /5Phos/AAGUAUANNNNNAGAU CGGAAGAGCGUCGUGUAG/3SpC3/ Van Nostrand et al.33 N/A (Continued on next page) Molecular Cell 84, 1–17.e1–e20, June 6, 2024 e6 .. Binding intensities were quantified using FIJI with the Article Title: CDK6-mediated endothelial cell cycle acceleration drives arteriovenous malformations in hereditary hemorrhagic telangiectasia Article Snippet: A high-throughput ELISA was performed per manufacturer’s recommendation (Full Moon Biosystems, ACC058). .. Array scans were analyzed using ImageJ via the Article Title: Glycine Receptor β–Targeting Autoantibodies Contribute to the Pathology of Autoimmune Diseases Article Snippet: The readout was detected with an Azure imaging system c400 using SuperSignal West Femto substrate (Thermo Scientific). .. Microarray binding intensities were quantified with FIJI using the Article Title: Recombinant Human Keratinocyte Growth Factor Ameliorates Cancer Treatment-Induced Oral Mucositis on a Chip. Article Snippet: Oral mucositis (OM) is a severe complication of cancer therapies caused by off-target cytotoxicity.. Palifermin, which is recombinant human keratinocyte growth factor (KGF), is currently the only mitigating treatment available to a subset of OM patients.. This study used a previously established model of oral mucositis on a chip (OM-OC) comprised of a confluent human gingival keratinocytes (GIE) layer attached to a basement membrane-lined subepithelial layer consisting of human gingival fibroblasts (HGF) and human dermal microvascular endothelial cells (HMEC) on a stable collagen I gel. Article Title: Inhibition of the YAP-MMB interaction and targeting NEK2 as potential therapeutic strategies for YAP-driven cancers. Article Snippet: Afterwards, slides were incubated with GST-YAP at 500 nM in 5% MP in 1× PBS for 15min before slides were washed with 3× 2.5 mL 1× PBS for 1 min. To label the protein for detection, the slides were incubated with 2.5 mL of a 1:5,000 diluted, HRP-conjugated anti-GST antibody (Sigma Aldrich, RPN1236) in 5% MP in 1× PBS for 15min, after which the slides were washed with 3× 2.5 mL 1 × PBS for 1 min. Peptide binding was detected through chemiluminescent detection (1× 1 binning, 1 s exposure time) after application of 200 μL of SuperSignal West Femto Maximum Sensitive Substrate (Thermo Scientific) per slide using an Amersham Image Quant 800 (GE Healthcare). .. Binding intensities were evaluated using FIJI including the Article Title: Induction of hepatitis B core protein aggregation targeting an unconventional binding site Article Snippet: The chemiluminescent readout was obtained using SuperSignal West Femto maximum sensitive substrate (Thermo Scientific GmbH, Schwerte, Germany) with a c400 Azure imaging system (lowest sensitivity, 90 s exposure time). .. Binding intensities were quantified with FIJI ( ) using the Article Title: Induction of Hepatitis B Core Protein Aggregation Targeting an Unconventional Binding Site Article Snippet: The chemiluminescent readout was obtained using SuperSignal West Femto maximum sensitive substrate (Thermo Scientific GmbH, Schwerte, Germany) with a c400 Azure imaging system (lowest sensitivity, 90 s exposure time). .. Binding intensities were quantified with FIJI (Schindelin et al., 2012) using the Binding Assay:Article Title: The humanized platelet glycoprotein VI Fab inhibitor EMA601 protects from arterial thrombosis and ischaemic stroke in mice Article Snippet: .. 189 Microarray binding intensities were quantified with FIJI using the Article Title: The MYCN oncoprotein is an RNA-binding accessory factor of the nuclear exosome targeting complex. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER mirE_shZFC3H1: TGCTGTTGACAG TGAGCGCCCAGGACATTCTGTCAT ATAATAGTGAAGCCACAGATGTATT ATATGACAGAATGTCCTGGATGCCT ACTGCCTCGGA Pelossof et al.51 ZFC3H1_196441_4002 mirE_shSF3B1: TGCTGTTGACAGTGAGCGAGCATTG CTTAATGATATACCATAGTGAAGCCA CAGATGTATGGTATATCATTAAGCAA TGCCTGCCTACTGCCTCGGA Pelossof et al.51 SF3B1_23451_314 mirE_XhoI_F: TACAATACTCGAGAAG GTATATTGCTGTTGACAGTGAGCG Papadopoulos et al.24 N/A mirE_EcoRI_R: TTAGATGAATTCTAG CC CCTTGAAGTCCGAGGCAGTAGGCA Papadopoulos et al.24 N/A mirE_seq: TGTTTGAATGAGGCTTCAGTAC Papadopoulos et al.24 N/A EXOSC5_sgRNA_F1 CACCGACGTGGG CTCGGCGCGATGG This paper N/A EXOSC5_sgRNA_R1 AAACCCATCGCG CCGAGCCCACGTC This paper N/A EXOSC5_sgRNA_F2 AAACCGTGCGGC TGCAGTTGTCACC This paper N/A EXOSC5_sgRNA_R2 CGCACCGGTCGC CATCTTGGCTAACAACC This paper N/A EXOSC5_HA1_Nterm_AgeI CGCACCGG TCGCCATCTTGGCTAACAACC This paper N/A EXOSC5_HA1_Nterm_MlU CGACGCGTC GCGCCGAGCTCACGTGCGG This paper N/A EXOSC5_HA2_Nterm_EcoRI CGGAATTC GAGGAGGAGACGCATACTGA This paper N/A EXOSC5_HA2_Nterm_SpeI GGACTAGTG GAGAGATGCAGTGAGGTAG This paper N/A NAID-EXOSC5_seq_fwd CAAACCACGGT TTAGCCGC This paper N/A NAID-EXOSC5_seq_rev TCCCCCATACTC CCCACAATC This paper N/A Cy5-RNA: UGGGCCUGGAAUAGUGGGGG CCCAGGGGAAGCUGCGAUGUGCUUCUG AGUGUUUGGAACGAG (50Cy5) GenScript N/A rand103Tr3 Library preparation, desalted, 200 mM /5Phos/NNNNNNNNNNAGATCG GAAGAGCACACGTCTG /3SpC3/ Van Nostrand et al.33 N/A AR17 Library preparation, desalted, 200 mM ACACGACGCTCTTCCGA Van Nostrand et al.33 N/A RiL19 Library preparation, desalted, 200 mM /5Phos/AGAUCGGAAGAGCG UCGUG/3SpC3/ Van Nostrand et al.33 N/A RNA_X1A Library preparation, desalted, 200 mM /5Phos/AUAUAGGNNNNNAGAU CGGAAGAGCGUCGUGUAG/3SpC3/ Van Nostrand et al.33 N/A RNA_X1B Library preparation, desalted, 200 mM /5Phos/AAUAGCANNNNNAGAUC GGAAGAGCGUCGUGUAG/3SpC3/ Van Nostrand et al.33 N/A RNA_X2A Library preparation, desalted, 200 mM /5Phos/AAGUAUANNNNNAGAU CGGAAGAGCGUCGUGUAG/3SpC3/ Van Nostrand et al.33 N/A (Continued on next page) Molecular Cell 84, 1–17.e1–e20, June 6, 2024 e6 .. Binding intensities were quantified using FIJI with the Article Title: Glycine Receptor β–Targeting Autoantibodies Contribute to the Pathology of Autoimmune Diseases Article Snippet: The readout was detected with an Azure imaging system c400 using SuperSignal West Femto substrate (Thermo Scientific). .. Microarray binding intensities were quantified with FIJI using the Article Title: Inhibition of the YAP-MMB interaction and targeting NEK2 as potential therapeutic strategies for YAP-driven cancers. Article Snippet: Afterwards, slides were incubated with GST-YAP at 500 nM in 5% MP in 1× PBS for 15min before slides were washed with 3× 2.5 mL 1× PBS for 1 min. To label the protein for detection, the slides were incubated with 2.5 mL of a 1:5,000 diluted, HRP-conjugated anti-GST antibody (Sigma Aldrich, RPN1236) in 5% MP in 1× PBS for 15min, after which the slides were washed with 3× 2.5 mL 1 × PBS for 1 min. Peptide binding was detected through chemiluminescent detection (1× 1 binning, 1 s exposure time) after application of 200 μL of SuperSignal West Femto Maximum Sensitive Substrate (Thermo Scientific) per slide using an Amersham Image Quant 800 (GE Healthcare). .. Binding intensities were evaluated using FIJI including the Article Title: Induction of hepatitis B core protein aggregation targeting an unconventional binding site Article Snippet: The chemiluminescent readout was obtained using SuperSignal West Femto maximum sensitive substrate (Thermo Scientific GmbH, Schwerte, Germany) with a c400 Azure imaging system (lowest sensitivity, 90 s exposure time). .. Binding intensities were quantified with FIJI ( ) using the Article Title: Induction of Hepatitis B Core Protein Aggregation Targeting an Unconventional Binding Site Article Snippet: The chemiluminescent readout was obtained using SuperSignal West Femto maximum sensitive substrate (Thermo Scientific GmbH, Schwerte, Germany) with a c400 Azure imaging system (lowest sensitivity, 90 s exposure time). .. Binding intensities were quantified with FIJI (Schindelin et al., 2012) using the |