pldr8 (ATCC)

ATCC is a verified supplier

ATCC manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

ATCC pldr8
Strains and plasmids

Pldr8, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lambda+fix+ii+xhoi+predigested+vector/pLDR8/pmc06201111-61-0-7
Average 90 stars, based on 6 article reviews

pldr8 - by Bioz Stars, 2026-09

90/100 stars

Images

1) Product Images from "Disrupting Gram-Negative Bacterial Outer Membrane Biosynthesis through Inhibition of the Lipopolysaccharide Transporter MsbA"

Article Title: Disrupting Gram-Negative Bacterial Outer Membrane Biosynthesis through Inhibition of the Lipopolysaccharide Transporter MsbA

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.01142-18

Figure Legend Snippet: Strains and plasmids

Techniques Used: Plasmid Preparation, Isolation, Knock-Out, Membrane, Expressing, Over Expression, Marker

Sequencing:

Article Title: Antibiotic-free plasmid
Article Snippet: .. The cI gene sequence from plasmid pLDR8 (ATCC Number #77357) produces a repressor protein cI857 mutant (NCBI: AB248924, Cloning vector pND707, Love, C. A. et al., Gene. ..

Article Title: Antibiotic-free plasmid
Article Snippet: The DNA fragment corresponding to the P1 weak promoter was obtained by PCR using primers PB1186 (SEQ ID NO:35) (TCATACCAGGCCTAGGTGATACGCCTATTTTTATAGGTTAATG) and PB1187 (SEQ ID NO:36) (AACACCCCTTGTATTACTGTTTATG), using pLL14 (see Merial patent application US2005/0164946) as a template and Phusion DNA polymerase. .. The DNA fragment corresponding to the cI gene (SEQ ID NO:1) was obtained by PCR using primers PB1188 (SEQ ID NO:37) (AATACAAGGGGTGTTATGAGCACAAAAAAGAAACCATTAACAC) [containing a complementary region of P1 sequence at 5′ end (underlined)] and PB1189 (SEQ ID NO:38) (CCGGAATTCGGCGCGTCAGCCAAACGTCTCTTCAGGCCACTG) using pLDR8 (ATCC #77357) as a template and Phusion DNA polymerase. .. The two PCR products (respectively 151 and 729 bp) were purified and used as template in a second PCR step with the PB1186 and PB1189 primers and the Phusion DNA polymerase (Finnzymes, Finland) (see FIG. 24).

Article Title: A broad-spectrum vibriophage with potential for phage therapy against Vibrio alginolyticus in shrimp aquaculture
Article Snippet: Phage therapy, a promising alternative to antibiotics, has gained traction in aquaculture for combating bacterial diseases.. This study investigated the potential application of a lytic phage, vB_ValS_R12Z (R12Z), against Vibrio alginolyticus ATCC 17749T, in aquaculture by characterizing its biological and genetic properties.. Phage R12Z displayed a siphovirus morphotype, characterized by a short latent period of 35 min and a large burst size of 105 ± 27 plaque forming units (PFU) per infected cell.

Plasmid Preparation:

Article Title: Production of activated TDP-deoxysugars in recombinant microorganisms
Article Snippet: Utilizing this type of plasmid with pLDR8 (E. coli integrating Kit ATCC 77371) we integrated genes into the chromosome of zucM61. .. Utilizing this type of plasmid with pLDR8 (E. coli integrating Kit ATCC 77371) we integrated genes into the chromosome of zucM61. ..

Article Title: Antibiotic-free plasmid
Article Snippet: .. PB1234 (SEQ ID NO: 8): (GACGACAAATTTGTAATCAGGCGAGAGCACCGCAAGGGATAAATATCTA ACACCG) The amplification of λPromoter (λPr) (SEQ ID NO:5) was performed using the pLDR8 plasmid (ATCC#77357) as DNA template. .. The sacB gene (SEQ ID NO:3) was amplified with the PB1192 (SEQ ID NO:9) (ATGGATATGAACATCAAAAAGTTTGC) and PB1193 (SEQ ID NO:10) (AAACAAATAGGGGTTCCGCGCACATTTATTTGTTAACTGTTAATTGTCCTTG) primers using the pNB350 (Merial proprietary property) as DNA template when the joining PCR was used for the engineering of the λPr::sacB Ωkan cassette (see FIG. 8A-B).

Mutagenesis:

Cloning:

Polymerase Chain Reaction:

Article Title: Antibiotic-free plasmid
Article Snippet: The DNA fragment corresponding to the P1 weak promoter was obtained by PCR using primers PB1186 and PB1187, the pLL14 as a template and Phusion DNA polymerase. .. The DNA fragment corresponding to the cI gene was obtained by PCR using primers PB1188 and PB1189, the pLDR8 (ATCC #77357) as a template and Phusion DNA polymerase (Finnzymes, Finland). .. The two PCR products (respectively 151 and 729 bp) were purified and used as templates in a second PCR step with the PB1186 and PB1189 primers and the Phusion DNA polymerase.

Amplification:

Expressing:

Article Title: Disrupting Gram-Negative Bacterial Outer Membrane Biosynthesis through Inhibition of the Lipopolysaccharide Transporter MsbA
Article Snippet: pLDR9 , Lambda att site integration vector , ATCC 77358. .. pLDR8 , Lambda integrase expression vector , ATCC 77357. .. pCDF-1b , IPTG-inducible expression vector with streptomycin resistance marker , Novagen.

Review