organisms (Charles River Laboratories)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Charles River Laboratories organisms
Organisms, supplied by Charles River Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/image-processing+code+scanip/organisms+strains/pm36493773-272-34-37
Average 86 stars, based on 1 article reviews

organisms - by Bioz Stars, 2026-09

86/100 stars

Images

Recombinant:

Article Title: Protocol for a murine transient middle cerebral artery occlusion model with local intra-arterial drug delivery.
Article Snippet: .. KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains Male C57BL/6 mice Charles River Laboratories Strain code: 027 Chemicals, peptides, and recombinant proteins Chlorhexidine Gluconate 4% w/v Hibiscrub N/A Isoflurane Zoetis N/A Gluture Zoetis N/A Viscotear Liquid Gel Bausch + Lomb N/A Buprevet (0.3 mg/mL) Virbac N/A Other Leica 3M Microscope Leica Microsystems N/A Polyimide catheter (ID: 172 ± 12 μm; OD: 216 ± 12 μm) Zeus PN Zeus PN: 270903 6-0 Surgical Nylon Monofilament Suture Ethicon Inc. N/A 6-0 Coated VICRYL Ethicon Inc. N/A PeriFlux System 5000 Perimed N/A TEC 3 Isoflurane Vaporiser +Mediquip LTD Model:98723N Occlusion suture Doccol 602223PK10RE TLAT-2LV Physitemp https://www.physitemp.com/animal- temperature-control_p130 PUMP 11 Elite Harvard Apparatus Item No: 70-4504 Needle 25G (0.5 3 16 mm) BD Microlance 3 N/A 3M Micropore (Tape) 3M N/A 2 STAR Protocols 7, 104618, June 19, 2026 ..

Article Title: SEPHS2 loss reprograms cancer metabolism from oxidative phosphorylation to gluconeogenesis via PCK1 stabilization.
Article Snippet: Upon arrival at the animal core facility of Southern University of Science and Technology, mice were acclimated for 1 week in a barrier facility to minimize the potential effects of .. REAGENT or RESOURCE SOURCE IDENTIFIER M&R HRP/DAB Detection IHC Kit Vazyme Cat#HC301-01; Lot#7E2762K4 Deposited data Transcriptomics: A-375 control and SEPHS2 knockout cells This paper GSE:324223 Proteomics:A-375 control and SEPHS2 knockout cells This paper PXD076137 Experimental models: Cell lines A-375 ATCC Cat#CRL-1619 HeLa ATCC Cat#CCL-2 A2058 CellCook Cat#CC1805 HEK-293FT CellCook Cat#CC4046 MCF-7 CellCook Cat#CC0302 Experimental models: Organisms/strains BALB/c nude mice Charles River Laboratories Cat401 NCG[(Prkdc)KO/KO∼(Il2rg)KO/KO] mice GemPharmatech Cat#T001475 Oligonucleotides See Table S1 for the shRNA and sgRNA for gene deficiency This paper N/A See Table S2 for the primers used for real-time qPCR This paper N/A Recombinant DNA pLKO.1-TCR Addgene Cat#10878 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 LentiCRISPR v2 Addgene Cat#52961 pCMV-HA-UB-Neo MiaoLing bio Cat#P51735 pCMV-PCK1(human)-3×Flag-Neo MiaoLing bio Cat#P49543 Software and algorithms Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ FIJI (ImageJ) NIH https://imagej.net/software/fiji/ FlowJo Software 10.10 TreeStar Inc https://www.flowjo.com/ BioRender.com BioRender https://www.biorender.com/ QuantStudioTM Design & Analysis Software real-time PCR https://www.thermofisher.cn/cn/zh/home/ technical-resources/software-downloads/ quantstudio-3-5-real-time-pcr-systems.html SnapGene 4.3.6 SnapGene https://www.snapgene.com/ TBtools-II Chen et al. https://apps.microsoft.com/detail/ 9nvr9lb426p2?hl=zh-cn&gl=CN R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ Wave Seahorse https://www.agilent.com.cn/zh-cn/product/cell- analysis/real-time-cell-metabolic-analysis/xfsoftware/software-download-for-seahorse-wavepro-software Cell Reports 45, 117297, May 26, 2026 17 transportation stress on experimental outcomes. ..

Article Title: Distinct supraspinal neural pathways underlie licking-induced alleviation of pain sensation and aversion in male mice.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Anti-Glutamate antibody Sigma-Aldrich Cat# G6642; RRID: AB_259946 Rabbit Anti-GABA antibody Sigma-Aldrich Cat# A2052; RRID: AB_477652 Rabbit Anti-TH antibody HUABIO Cat# ET1611-12; RRID: AB_3069989 Pig Anti-c-Fos antibody SYSY Cat# 226308; RRID: AB_2905595 Goat Anti-Rabbit IgG H&L (Alexa Fluor® 488) Abcam Cat# ab150077; RRID: AB_2630356 Goat Anti-Rabbit IgG H&L (Alexa Fluor® 555) Abcam Cat# ab150078; RRID: AB_2722519 Goat Anti-Rabbit IgG H&L (Alexa Fluor® 647) Abcam Cat# ab150079; RRID: AB_2722623 Goat Anti-Guinea pig IgG H&L (Alexa Fluor® 488) Abcam Cat# ab150185; RRID: AB_2736871 Bacterial and virus strains rAAV-Ef1α-DIO-N2cG Brain Case Cat# BC-0304 rAAV-Ef1α-DIO-mCherry-F2A-TVA Brain Case Cat# BC-0061 CVS-EnvA-ΔG-EGFP Brain Case Cat# BC-RV-CVS EnVA461 rAAV2/1-hSyn-Cre-WPRE-hGH-pA BrainVTA Cat# PT-0136 rAAV-Ef1α-DIO-mCherry-WPRE-hGH BrainVTA Cat# PT-0795 rAAV-Ef1α-DIO-hChR2 (H134R)-mCherry-WPRE-pA BrainVTA Cat# PT-0002 rAAV-Ef1α-DIO-hM4D(Gi)-EGFP-WPRE-pA BrainVTA Cat# PT-0043 rAAV-Ef1α-DIO-hM3D(Gq)-mCherry-WPRE-pA BrainVTA Cat# PT-0042 retro-rAAV-Ef1α-DIO-hM4D(Gi)-EGFP-WPRE-pA BrainVTA Cat# PT-0987 retro-rAAV-Ef1α-DIO-hM3D(Gq)-mCherry-WPRE-pA BrainVTA Cat# PT-0042 retro-rAAV-hSyn-CRE-WPRE-hGH BrainVTA Cat# PT-0136 retro-rAAV-Ef1α-DIO-EGFP-WPRE-hGH BrainVTA Cat# PT-0795 retro-rAAV-Ef1α-DIO-mCherry-WPRE-hGH BrainVTA Cat# PT-0013 rAAV-Ef1α-DIO-GCaMP6s-WPRE-pA BrainVTA Cat# PT-0071 retro-rAAV-Ef1α-DIO-GCaMP6s-WPRE-pA BrainVTA Cat# PT-0071 rAAV-CAG-DIO-WGA-FLP-WPRE-hGH-pA BrainVTA Cat# PT-0557 rAAV-EF1a-fDIO-mCherry-WPRE-hGH-pA BrainVTA Cat# PT-1046 rAAV-cfos-tTA-WPRE-hGH-pA BrainVTA Cat# PT-3022 rAAV-TRE-tight-EGFP-WPREs BrainVTA Cat# PT-9667 Chemicals, peptides, and recombinant proteins TTX Tauto Biotech Cat# E− 2968 4-AP MCE HY-B0604 CNQX Tocris Cat# 0190 Bicuculine Selleck Cat# S7071 Clozapine N-oxide TargetMol Cat# T4494 Experimental models: Organisms/strains Mouse: wild type C57BL/6J Charles River N/A Mouse: VgluT2-Cre Jackson Laboratory 016963 Mouse: Vgat-Cre Jackson Laboratory 028862 Software and algorithms Illustrator CS6 Adobe https://www.adobe.com/products/illustrator.html GraphPad Prism 8 GraphPad Software https://www.graphpad.com/scientific-software/ ZEN Zeiss https://www.zeiss.com/microscopy/int/products/ microscope-software/zen-lite.html (Continued on next page) 16 Cell Reports 45, 117363, May 26, 2026 ..

Microscopy:

other:

Article Title: A regulatory circuitry driving a noradrenergic to mesenchymal transition highlights YAP/TAZ as critical players in neuroblastoma plasticity.
Article Snippet: SK-N-SHm Thirant et al.12 N/A SH-SY5Y ATCC CRL-2266; RRID: CVCL_0019 SK-N-BE(2)C ATCC CRL-2268; RRID: CVCL_0529 5Y clone MES This paper, Louis-Brennetot, Peltier et al., in preparation N/A CLB-GA Boeva et al.3 RRID:CVCL_9529 SH-EP Boeva et al.3 RRID:CVCL_0524 Experimental models: Organisms/strains 8-week-old Swiss Nude (Crl:NU(Ico)-Foxn1nu Charles River Laboratories Cat#620 Oligonucleotides siCT: UGGUUUACAUGUCGACUAA Dharmacon D-001810-01 siYAP #1: GACAUCUUCUGGUCAGAGA Dharmacon custom siYAP #3: UGAGAACAAUGACGACCAA Dharmacon J-012200-06 siYAP #4: CCACCAAGCUAGAUAAAGA Dharmacon J-012200-08 siTAZ #2: AGGUACUUCCUCAAUCACA Dharmacon custom siTAZ #3: GGACAAACACCCAUGAACA Dharmacon J-009608-06 sgRNA #1: CATCAGATCGTGCACGTCCGCGG This paper N/A sgRNA #2: CGACTCCTTCTTCAAGCCGCCGG This paper N/A YAP1_1F: AAGGGAGTTGGAGGGAAAAA This paper N/A YAP1_1R: CCACCCCAGCTAGAGTTCC This paper N/A mCherry-T2A-YAP1 F: agacacagcaccggcggcatg gacgagctgtacaagGGCTCCGGCG AGGGCAGGGGAAGTCTTCTA ACATGCGGGGACGTGGAGGA AAATCCCGGCCCAATGGATCC CGGGCAGCA This paper N/A (Continued on next page) Cell Reports 45, 117351, May 26, 2026 17

Software:

Article Title: Giredestrant immobilizes the estrogen receptor to exert potent antitumor efficacy against ER-active breast cancers.
Article Snippet: ZR-75-1 ATCC ATCC® CRL-1500TM .. Experimental models: Organisms/strains HCC1419Mouse: NOD.CB17-Prkdcscid/NCrCr Charles River Laboratories Strain code: 394 Mouse: Crl:NU(NCr)-Foxn1nu Charles River Laboratories Strain code: 088 Software and algorithms R R Core Team, 2015 https://www.r-project.org/about.html BioConductor Huber et al.62 https://www.bioconductor.org/ (Continued on next page) ll OPEN ACCESSArticle Cell Chemical Biology 33, 1–14.e1–e11, July 16, 2026 e1 .. ER-expressing breast cancer cell lines were cultured using standard aseptic tissue culture techniques at 37◦C in RPMI medium supplemented with 10% FBS, 2mM L-Glutamine (Catalog 10440, Sigma), 1× Minimum Essential Media, Non-Essential Amino Acids (MEM NEAA, Catalog No. 11140–0500, Thermo Fisher) and 1× Antibiotic-Antimycotic (Catalog No.15240–112, Thermo Fisher).

Article Title: Aberrant prefrontal activity and arousal level correlate with action initiation and response vigor in rats
Article Snippet: .. 530 531 Key Resources Table 532 REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Data https://etsin.fairdata.fi / https://doi.org/10.2 3729/fd-fde5397bd01f-368a-9be1a750d5f4d589 Experimental models: Organisms/strains Rat (male, Lister-hooded, out-bred) Charles River (Germany) Software and algorithms Code https://etsin.fairdata.fi / https://doi.org/10.2 3729/fd-fde5397bd01f-368a-9be1a750d5f4d589 JASP (Bayesian statistical analysis) https://jasp-stats.org/ Version 0.19 (Intel) Jo urn al P e-p roo f 12 Other Multi-electrode probes Neuronexus A2x32 or Cambridge Neurotech H9x64 533 534 Declaration of generative AI and AI-assisted technologies 535 During the preparation of this work, the authors did not use an AI tools. ..

Article Title: Perinatal infection elicits clonally restricted T follicular helper cell responses that drive antibody-mediated viral control.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains Mus musculus: C57BL/6J (wt) Charles River JAX: 000664 Mus musculus: T11μMT (BCRres) mice Klein et al.41 N/A Mus musculus: MHCII-/- mice Madsen et al.93 N/A Mus musculus: CD40-/- mice Kawabe et al.94 N/A Mus musculus: IL21R-/- mice Fröhlich et al.95 N/A Mus musculus: CD8-/- mice Fung-Leung et al.55,96 N/A Mus musculus: KL25HL mice (HkiL-RAG-/-) Florova et al.45 N/A Mus musculus: KL25HL mice Fallet et al.97 N/A Mus musculus: AID-/- mice Muramatsu et al.98 N/A Mus musculus: sIgM-/- mice Tsiantoulas et al.99 N/A Mus musculus: Bcl6fl/flCD4Cre mice Kaji et al.100 N/A Mus musculus: SM1 mice Oxenius et al.20 N/A Mus musculus: Rag2-/- mice Hao and Rajewsky101 N/A Mus musculus: KL25HLxMHCII-/- mice This paper N/A Mus musculus: KL25HLxCD40-/- mice This paper N/A Mus musculus: sIgM-/-AID-/- mice This paper N/A Mus musculus: SM1xRag-/- mice This paper N/A Software and algorithms Prism 10.6.0 GraphPad Software RRID: SCR_002798 FlowJo 10.5.3 Becton Dickinson & Company RRID: SCR_008520 Adobe Illustrator CC 2022 Adobe Photoshop RRID:SCR_010279 Gen5 Agilent BioTek RRID: SCR_017317 STAR 2.7.0c Dobin et al.102 N/A R 4.2.2 R Core Team https://www.R-project.org/. ..

Article Title: Circuit and molecular mechanisms underlying incubation of methamphetamine craving in the prelimbic cortex.
Article Snippet: Article Circuit and molecular mechanisms underlying incubation of methamphetamine craving in the prelimbic cortex Highlights • SST and PV interneurons in the PL differentially regulate methamphetamine craving • LHGABA → PLSST and AMGlu → PLPV circuits drive stagespecific craving • KCNC2 upregulation in interneurons underlies distinct neuronal excitability changes • Specific knockdown of KCNC2 reduces craving during early and prolonged withdrawal Authors Sai Shi, Yi-Wen Sun, Jin-Jun Ding, ..., Fang Liu, Ti-Fei Yuan, Min Zhao Correspondence fang.liu@camh.ca (F.L.), ytf0707@126.com (T..-F.Y.), drminzhao@smhc.org.cn (M.Z.). In brief Shi et al. reveal that two distinct interneurons in the PL control the incubation of methamphetamine craving during different withdrawal stages.. They uncover a circuit-switch principle and propose a key molecular mediator, offering phase-specific therapeutic strategies to reduce relapse.

Review

organisms (Charles River Laboratories)

Structured Review

Images

Related Articles

Recombinant:

Microscopy:

other:

Software:

Immunohistochemistry:

Transcriptomics:

Control:

Knock-Out:

shRNA:

Real-time Polymerase Chain Reaction:

Virus:

SYBR Green Assay:

Multiplex Assay:

Protease Inhibitor:

Lysis:

Bicinchoninic Acid Protein Assay:

Similar Products

Image Search Results