Review



-014850 whole human genome microarray 4 × 44k g4112f  (Agilent technologies)


Bioz Verified Symbol Agilent technologies is a verified supplier
Bioz Manufacturer Symbol Agilent technologies manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Agilent technologies -014850 whole human genome microarray 4 × 44k g4112f
    014850 Whole Human Genome Microarray 4 × 44k G4112f, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+44k+microarray/pmc11236722-58-7-7
    Average 90 stars, based on 1 article reviews
    -014850 whole human genome microarray 4 × 44k g4112f - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Expressing:

    Article Title: Identification of Four Potential Biomarkers Associated With Coronary Artery Disease in Non-diabetic Patients by Gene Co-expression Network Analysis
    Article Snippet: The platform was Agilent-014850 Whole Human Genome Microarray 4 × 44K G4112F (Agilent Technologies, Inc., Los Angeles, CA, United States).

    Article Title: Analysis of Omics Data Reveals Nucleotide Excision Repair-Related Genes Signature in Highly-Grade Serous Ovarian Cancer to Predict Prognosis.
    Article Snippet: Gene expression in GSE13876 was performed using Operon human v3 ~35 K 70- mer two-color oligonucleotide microarrays (GPL7759; N = 415); Gene expression in GSE49997 was performed using ABI Human Genome Survey Microarray Version 2 (GPL2986; N = 204); Gene expression in GSE17260 was performed using Agilent-014850 Whole Human Genome Microarray 4 × 44K G4112F (Probe Name version) (GPL6480; N = 110); Gene expression in GSE63885 was performed using Affymetrix Human Genome U133 Plus 2.0 Array (GPL570; N = 101).

    Article Title: Development and evaluation of a chronic kidney disease risk prediction model using random forest
    Article Snippet: The gene expression was analyzed using the Agilent-014850 Whole Human Genome Microarray 4 × 44K G4112F (Probe Name version).

    Microarray:

    Article Title: Identification of Four Potential Biomarkers Associated With Coronary Artery Disease in Non-diabetic Patients by Gene Co-expression Network Analysis
    Article Snippet: The platform was Agilent-014850 Whole Human Genome Microarray 4 × 44K G4112F (Agilent Technologies, Inc., Los Angeles, CA, United States).

    Article Title: Analysis of Omics Data Reveals Nucleotide Excision Repair-Related Genes Signature in Highly-Grade Serous Ovarian Cancer to Predict Prognosis.
    Article Snippet: Gene expression in GSE13876 was performed using Operon human v3 ~35 K 70- mer two-color oligonucleotide microarrays (GPL7759; N = 415); Gene expression in GSE49997 was performed using ABI Human Genome Survey Microarray Version 2 (GPL2986; N = 204); Gene expression in GSE17260 was performed using Agilent-014850 Whole Human Genome Microarray 4 × 44K G4112F (Probe Name version) (GPL6480; N = 110); Gene expression in GSE63885 was performed using Affymetrix Human Genome U133 Plus 2.0 Array (GPL570; N = 101).

    Article Title: Development and evaluation of a chronic kidney disease risk prediction model using random forest
    Article Snippet: The gene expression was analyzed using the Agilent-014850 Whole Human Genome Microarray 4 × 44K G4112F (Probe Name version).



    Similar Products

    014850 whole human genome microarray 4 × 44k g4112f  (Agilent technologies)
    90
    Agilent technologies 014850 whole human genome microarray 4 × 44k g4112f
    014850 Whole Human Genome Microarray 4 × 44k G4112f, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+44k+microarray/pm39199011-30-29-32
    Average 90 stars, based on 1 article reviews
    014850 whole human genome microarray 4 × 44k g4112f - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    rosetta merck human 44k microarray  (Merck & Co)
    86
    Merck & Co rosetta merck human 44k microarray
    Rosetta Merck Human 44k Microarray, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+44k+microarray/44k+human+merck+microarray+rosetta/10__3390_slash_app15158286-64-14-14
    Average 86 stars, based on 1 article reviews
    rosetta merck human 44k microarray - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    rosetta/merck human 44k 1.1 microarrays  (Merck & Co)
    90
    Merck & Co rosetta/merck human 44k 1.1 microarrays
    Rosetta/Merck Human 44k 1.1 Microarrays, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+44k+microarray/human+rsta+affymetrix2+0+microarray/pm39884058-137-15-14
    Average 90 stars, based on 1 article reviews
    rosetta/merck human 44k 1.1 microarrays - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    whole human genome microarray 4×44k g4112f  (Agilent technologies)
    90
    Agilent technologies whole human genome microarray 4×44k g4112f
    Whole Human Genome Microarray 4×44k G4112f, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+44k+microarray/bio_rxiv__2024__07__02__601689-175-3-3
    Average 90 stars, based on 1 article reviews
    whole human genome microarray 4×44k g4112f - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    whole human genome microarray 4×44k  (Agilent technologies)
    90
    Agilent technologies whole human genome microarray 4×44k
    Whole Human Genome Microarray 4×44k, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+44k+microarray/us12024717-280-12-20
    Average 90 stars, based on 1 article reviews
    whole human genome microarray 4×44k - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    -014850 whole human genome microarray 4 × 44k g4112f  (Agilent technologies)
    90
    Agilent technologies -014850 whole human genome microarray 4 × 44k g4112f
    014850 Whole Human Genome Microarray 4 × 44k G4112f, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+44k+microarray/pmc11236722-58-7-7
    Average 90 stars, based on 1 article reviews
    -014850 whole human genome microarray 4 × 44k g4112f - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    whole human genome dna microarray 4× 44k v2 slides  (Agilent technologies)
    90
    Agilent technologies whole human genome dna microarray 4× 44k v2 slides
    Points in time for sublingual vaccinations and assessments of anti-HA (hemagglutinin) antibodies, blood tests, plasma cytokines, quantitative reverse transcription PCR (RT-qPCR), and DNA <t>microarray</t> analyses. RT-qPCR and DNA microarray analyses were conducted with RNA isolated from white blood cells (WBC). Vaccinations were performed four times at 0 (1st), 6 (2nd), 18 (3rd), and 30 (4th) weeks. Arrows indicate sampling timepoints for each assay.
    Whole Human Genome Dna Microarray 4× 44k V2 Slides, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+44k+microarray/pmc11209156-124-22-31
    Average 90 stars, based on 1 article reviews
    whole human genome dna microarray 4× 44k v2 slides - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    dna microarray slides (44k whole human genome  (Agilent technologies)
    90
    Agilent technologies dna microarray slides (44k whole human genome
    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
    Dna Microarray Slides (44k Whole Human Genome, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+44k+microarray/pmc11106736-200-7-15
    Average 90 stars, based on 1 article reviews
    dna microarray slides (44k whole human genome - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    dna-microarray 44k whole human genome  (Agilent technologies)
    90
    Agilent technologies dna-microarray 44k whole human genome
    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
    Dna Microarray 44k Whole Human Genome, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+44k+microarray/pmc11106736-173-199-205
    Average 90 stars, based on 1 article reviews
    dna-microarray 44k whole human genome - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Points in time for sublingual vaccinations and assessments of anti-HA (hemagglutinin) antibodies, blood tests, plasma cytokines, quantitative reverse transcription PCR (RT-qPCR), and DNA microarray analyses. RT-qPCR and DNA microarray analyses were conducted with RNA isolated from white blood cells (WBC). Vaccinations were performed four times at 0 (1st), 6 (2nd), 18 (3rd), and 30 (4th) weeks. Arrows indicate sampling timepoints for each assay.

    Journal: Vaccines

    Article Title: Molecular Events in Immune Responses to Sublingual Influenza Vaccine with Hemagglutinin Antigen and Poly(I:C) Adjuvant in Nonhuman Primates, Cynomolgus Macaques

    doi: 10.3390/vaccines12060643

    Figure Lengend Snippet: Points in time for sublingual vaccinations and assessments of anti-HA (hemagglutinin) antibodies, blood tests, plasma cytokines, quantitative reverse transcription PCR (RT-qPCR), and DNA microarray analyses. RT-qPCR and DNA microarray analyses were conducted with RNA isolated from white blood cells (WBC). Vaccinations were performed four times at 0 (1st), 6 (2nd), 18 (3rd), and 30 (4th) weeks. Arrows indicate sampling timepoints for each assay.

    Article Snippet: The labeled cRNA was subsequently fragmented using the Gene Expression Hybridization Kit (Agilent Technologies, Santa Clara, CA, USA) and then set onto Whole Human Genome DNA Microarray 4× 44K v2 slides (Agilent Technologies, Santa Clara, CA, USA).

    Techniques: Reverse Transcription, Quantitative RT-PCR, Microarray, Isolation, Sampling

    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

    Journal: Radiation research

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

    doi: 10.1667/RADE-22-00206.1

    Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

    Article Snippet: Labeled cRNA samples were applied on the DNA microarray slides (44k whole human genome, G4112F, Agilent).

    Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Lysis, Concentration Assay, Sequencing, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

    Journal: Radiation research

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

    doi: 10.1667/RADE-22-00206.1

    Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop ™ qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Lysis, Concentration Assay, Sequencing, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction