Review



i scripttm cdna synthesis kit  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Bio-Rad i scripttm cdna synthesis kit
    Figure 5. Expression of adhesion and differentiation-related genes in HGFs adhering on five different titanium surfaces after 24 h of culture. mRNA was extracted from cell pellets, and <t>cDNA</t> levels of VCL (A), FN (B), Col1A1 (C), and ITGB1 (D) were quantified by RT-PCR analysis. Results are expressed as fold changes vs. controls and are means ± SEM of 3 different experiments carried out in duplicate. Statistical analysis was performed by one-way ANOVA with Dunnett’s post hoc test: * p < 0.05, ** p < 0.01, *** p < 0.001 vs. control.
    I Scripttm Cdna Synthesis Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 48470 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/go+scripttm+reverse+transcriptase+kit/iScript+cDNA+Synthesis+Kit/pm36826858-89-32-36
    Average 99 stars, based on 48470 article reviews
    i scripttm cdna synthesis kit - by Bioz Stars, 2026-10
    99/100 stars

    Images

    1) Product Images from "Biocompatibility of Subperiosteal Dental Implants: Effects of Differently Treated Titanium Surfaces on the Expression of ECM-Related Genes in Gingival Fibroblasts."

    Article Title: Biocompatibility of Subperiosteal Dental Implants: Effects of Differently Treated Titanium Surfaces on the Expression of ECM-Related Genes in Gingival Fibroblasts.

    Journal: Journal of functional biomaterials

    doi: 10.3390/jfb14020059

    Figure 5. Expression of adhesion and differentiation-related genes in HGFs adhering on five different titanium surfaces after 24 h of culture. mRNA was extracted from cell pellets, and cDNA levels of VCL (A), FN (B), Col1A1 (C), and ITGB1 (D) were quantified by RT-PCR analysis. Results are expressed as fold changes vs. controls and are means ± SEM of 3 different experiments carried out in duplicate. Statistical analysis was performed by one-way ANOVA with Dunnett’s post hoc test: * p < 0.05, ** p < 0.01, *** p < 0.001 vs. control.
    Figure Legend Snippet: Figure 5. Expression of adhesion and differentiation-related genes in HGFs adhering on five different titanium surfaces after 24 h of culture. mRNA was extracted from cell pellets, and cDNA levels of VCL (A), FN (B), Col1A1 (C), and ITGB1 (D) were quantified by RT-PCR analysis. Results are expressed as fold changes vs. controls and are means ± SEM of 3 different experiments carried out in duplicate. Statistical analysis was performed by one-way ANOVA with Dunnett’s post hoc test: * p < 0.05, ** p < 0.01, *** p < 0.001 vs. control.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Control

    Related Articles

    Synthesized:

    Article Title: Metabolic profiling of retinal organoids reveals conserved core metabolites and alterations in glycolytic and amino acid metabolism.
    Article Snippet: RNA concentration and purity (A260/280 and A260/230 ratios) were assessed using a NanoDrop spectrophotometer (DeNovix), with RNase-free water as blank. .. Complementary DNA (cDNA) was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, #170-8891). ..

    Article Title: E. coli O157:H7 evades CD8 + T cell immunity through T3SS-dependent suppression and limited MHCI presentation of translocated proteins.
    Article Snippet: .. RNA was extracted from EBL cells using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), and cDNA was synthesized using the iScript cDNA Synthesis Kit (BIO-RAD, Hertfordshire, UK), both according to the manufacturers’ instructions. ..

    Article Title: Svep1 orchestrates distal airway patterning and alveolar differentiation in murine lung development
    Article Snippet: Total RNA was isolated from whole embryonic lungs at E18.5 using the RNeasy Mini Kit (QIAGEN, Valencia, CA, USA) according to the manufacturer’s instructions. .. Double-stranded cDNA was synthesized from total mouse lung RNA using the iScript cDNA Synthesis Kit from Bio-Rad following the manufacturer’s instructions. .. RNA samples were sent to Novogene Co. Ltd for sequencing on the Illumina platform (see Supplementary Methods).

    cDNA Synthesis:

    Article Title: Metabolic profiling of retinal organoids reveals conserved core metabolites and alterations in glycolytic and amino acid metabolism.
    Article Snippet: RNA concentration and purity (A260/280 and A260/230 ratios) were assessed using a NanoDrop spectrophotometer (DeNovix), with RNase-free water as blank. .. Complementary DNA (cDNA) was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, #170-8891). ..

    Article Title: E. coli O157:H7 evades CD8 + T cell immunity through T3SS-dependent suppression and limited MHCI presentation of translocated proteins.
    Article Snippet: .. RNA was extracted from EBL cells using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), and cDNA was synthesized using the iScript cDNA Synthesis Kit (BIO-RAD, Hertfordshire, UK), both according to the manufacturers’ instructions. ..

    Article Title: Glutamine from plasma-like medium fuels nitrogen metabolism and influences proliferation in Leptospira interrogans.
    Article Snippet: .. RNA was first reverse transcribed to cDNA with the iSCRIPT cDNA Synthesis Kit (Bio-Rad, 1708891) according to the manufacturer’s protocol and a Bio-Rad S1000 Thermal Cycler (Bio-Rad, 1852148). ..

    Article Title: A neuronal GPCR modifies neuropeptide signaling to suppress proteostasis in distal tissues
    Article Snippet: The RNA was quantified using a NanoDrop 2000c spectrophotometer. .. For qPCR: cDNA was prepared by reverse transcription of the total RNA samples via random-priming using the iScript cDNA Synthesis Kit (no. 170-8890; Bio-Rad, Hercules, CA, USA) as per the manufacturer’s protocol. ..

    Article Title: Svep1 orchestrates distal airway patterning and alveolar differentiation in murine lung development
    Article Snippet: Total RNA was isolated from whole embryonic lungs at E18.5 using the RNeasy Mini Kit (QIAGEN, Valencia, CA, USA) according to the manufacturer’s instructions. .. Double-stranded cDNA was synthesized from total mouse lung RNA using the iScript cDNA Synthesis Kit from Bio-Rad following the manufacturer’s instructions. .. RNA samples were sent to Novogene Co. Ltd for sequencing on the Illumina platform (see Supplementary Methods).

    Article Title: A co-evolved peptide-GPCR system senses host entry to drive fungal infection.
    Article Snippet: Cells were harvested by centrifugation and snap-frozen in liquidnitrogen, and totalRNAwas extracted using Trizol reagent (Invitrogen) according to the manufacturer’s instructions31. .. Residual DNA was digested with the Turbo DNA-free kit (Invitrogen), and 1 μg RNA was used for cDNA synthesis with the iScript cDNA Synthesis Kit (Bio-Rad). .. qRT-PCRwas performed with three independent biological replicates and two technical replicates each per strain using the Takyon No ROX SYBR 2X MasterMix blue (Eurogentec) on a Bio-Rad CFX Duet Real-Time PCR system.

    Article Title: Breed-related and stage-related differences in the immune response to Staphylococcus aureus carriage in sheep during the periparturient period.
    Article Snippet: .. The iScript cDNA Synthesis Kit (BioRad, Hercules, CA, USA) was used to synthesise complementary DNA (cDNA) using the isolated RNA as the template according to the manufacturer’s protocol. .. The reaction was initially carried out in a PTC-220 DNA Engine thermocycler (MJ Research, Waltham, MA, USA).

    Article Title: Astroviruses use mucus secretion as a novel form of viral egress.
    Article Snippet: Cells were harvested in RLT lysis buffer, and RNA was extracted with the RNeasy Plus Mini Kit (Qiagen). .. cDNA was generated with iScript cDNA Synthesis kit (Bio-Rad) and qPCR was conducted with QuantiTect primers (Qiagen) for human MUC2 (QT01004675) and GAPDH (QT00079247). .. HAstV1 genome copies were quantified using TaqMan Fast Virus 1-step Master Mix for qPCR (Applied Biosystems) with primers (F: CCAGRCTCACAGAAGAGCAAC, R: CTTGCTAGCCATCRCACTTCTT) and probe [(6-FAM)- CATCGCATTTGGAGGGGAGGACC - (MBGNFQ)] under the following conditions: 50°C for 5 min and 95°C for 20 s, followed by 40 cycles of 95°C for 3 s and 60°C for 30 s on a BioRad CFX Connect Real-Time System and compared to a g-block standard (Integrated DNA Technologies).

    Reverse Transcription:

    Article Title: Glutamine from plasma-like medium fuels nitrogen metabolism and influences proliferation in Leptospira interrogans.
    Article Snippet: .. RNA was first reverse transcribed to cDNA with the iSCRIPT cDNA Synthesis Kit (Bio-Rad, 1708891) according to the manufacturer’s protocol and a Bio-Rad S1000 Thermal Cycler (Bio-Rad, 1852148). ..

    Article Title: A neuronal GPCR modifies neuropeptide signaling to suppress proteostasis in distal tissues
    Article Snippet: The RNA was quantified using a NanoDrop 2000c spectrophotometer. .. For qPCR: cDNA was prepared by reverse transcription of the total RNA samples via random-priming using the iScript cDNA Synthesis Kit (no. 170-8890; Bio-Rad, Hercules, CA, USA) as per the manufacturer’s protocol. ..

    Real-time Polymerase Chain Reaction:

    Article Title: A neuronal GPCR modifies neuropeptide signaling to suppress proteostasis in distal tissues
    Article Snippet: The RNA was quantified using a NanoDrop 2000c spectrophotometer. .. For qPCR: cDNA was prepared by reverse transcription of the total RNA samples via random-priming using the iScript cDNA Synthesis Kit (no. 170-8890; Bio-Rad, Hercules, CA, USA) as per the manufacturer’s protocol. ..

    Article Title: Astroviruses use mucus secretion as a novel form of viral egress.
    Article Snippet: Cells were harvested in RLT lysis buffer, and RNA was extracted with the RNeasy Plus Mini Kit (Qiagen). .. cDNA was generated with iScript cDNA Synthesis kit (Bio-Rad) and qPCR was conducted with QuantiTect primers (Qiagen) for human MUC2 (QT01004675) and GAPDH (QT00079247). .. HAstV1 genome copies were quantified using TaqMan Fast Virus 1-step Master Mix for qPCR (Applied Biosystems) with primers (F: CCAGRCTCACAGAAGAGCAAC, R: CTTGCTAGCCATCRCACTTCTT) and probe [(6-FAM)- CATCGCATTTGGAGGGGAGGACC - (MBGNFQ)] under the following conditions: 50°C for 5 min and 95°C for 20 s, followed by 40 cycles of 95°C for 3 s and 60°C for 30 s on a BioRad CFX Connect Real-Time System and compared to a g-block standard (Integrated DNA Technologies).

    Isolation:

    Article Title: Breed-related and stage-related differences in the immune response to Staphylococcus aureus carriage in sheep during the periparturient period.
    Article Snippet: .. The iScript cDNA Synthesis Kit (BioRad, Hercules, CA, USA) was used to synthesise complementary DNA (cDNA) using the isolated RNA as the template according to the manufacturer’s protocol. .. The reaction was initially carried out in a PTC-220 DNA Engine thermocycler (MJ Research, Waltham, MA, USA).

    Generated:

    Article Title: Astroviruses use mucus secretion as a novel form of viral egress.
    Article Snippet: Cells were harvested in RLT lysis buffer, and RNA was extracted with the RNeasy Plus Mini Kit (Qiagen). .. cDNA was generated with iScript cDNA Synthesis kit (Bio-Rad) and qPCR was conducted with QuantiTect primers (Qiagen) for human MUC2 (QT01004675) and GAPDH (QT00079247). .. HAstV1 genome copies were quantified using TaqMan Fast Virus 1-step Master Mix for qPCR (Applied Biosystems) with primers (F: CCAGRCTCACAGAAGAGCAAC, R: CTTGCTAGCCATCRCACTTCTT) and probe [(6-FAM)- CATCGCATTTGGAGGGGAGGACC - (MBGNFQ)] under the following conditions: 50°C for 5 min and 95°C for 20 s, followed by 40 cycles of 95°C for 3 s and 60°C for 30 s on a BioRad CFX Connect Real-Time System and compared to a g-block standard (Integrated DNA Technologies).



    Similar Products

    go scripttm reverse transcriptase kit  (Promega)
    90
    Promega go scripttm reverse transcriptase kit
    Go Scripttm Reverse Transcriptase Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/go+scripttm+reverse+transcriptase+kit/goscripttm+reverse+transcription+system/pm37055986-132-12-17
    Average 90 stars, based on 1 article reviews
    go scripttm reverse transcriptase kit - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    go scripttm reverse transcriptase cdna synthesis kit  (Promega)
    90
    Promega go scripttm reverse transcriptase cdna synthesis kit
    Go Scripttm Reverse Transcriptase Cdna Synthesis Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/go+scripttm+reverse+transcriptase+kit/goscripttm+reverse+transcription+system/pmc09908614-84-21-27
    Average 90 stars, based on 1 article reviews
    go scripttm reverse transcriptase cdna synthesis kit - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results