revertra acetm qpcr rt master mix (Toyobo)
Toyobo is a verified supplier 
Toyobo manufactures this product 
99
Structured Review
Toyobo
revertra acetm qpcr rt master mix
Revertra Acetm Qpcr Rt Master Mix, supplied by Toyobo, used in various techniques. Bioz Stars score: 99/100, based on 3978 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genomics+suite+(software+analysis+microarray+data/ReverTra+Ace+qPCR+RT+Master+Mix+with+gDNA+Remover/pmc11506431-83-89-98
Average 99 stars, based on 3978 article reviews
Revertra Acetm Qpcr Rt Master Mix, supplied by Toyobo, used in various techniques. Bioz Stars score: 99/100, based on 3978 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genomics+suite+(software+analysis+microarray+data/ReverTra+Ace+qPCR+RT+Master+Mix+with+gDNA+Remover/pmc11506431-83-89-98
Average 99 stars, based on 3978 article reviews
revertra acetm qpcr rt master mix - by Bioz Stars,
2026-11
99/100 stars
Images
1) Product Images from "Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity"
Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity
Journal: Cells
doi: 10.3390/cells13201689
Figure Legend Snippet: Exploration of PCIF1 target genes by genome-wide gene expression analysis. ( A ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) or two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #2). ( B ) Immunoblotting analysis of total protein extracts from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #2) with anti-PCIF1 and anti-b-actin antibodies. ( C , D ) Venn diagrams showing the overlap between the two indicated siRNA-mediated downregulated ( C ) and upregulated ( D ) genes identified by the gene expression profile analyzed by DNA microarray using a Human Genome U133 Plus 2.0 Array (Affymetrix). The condition for selecting differentially expressed genes are as follows: (1) cut-off condition: expression > 100, (2) fold change: >2, (3) p -value < 0.05.
Techniques Used: Genome Wide, Gene Expression, Quantitative RT-PCR, Isolation, Control, Western Blot, Microarray, Expressing
Figure Legend Snippet: Expression of RAB23 and CNOT6 is regulated by PCIF1 at both the mRNA and protein levels. ( A – C ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3), using the specific primer set detecting PCIF1 ( A ), RAB23 ( B ), and CNOT6 ( C ) expression. ( D , E ) Immunoblotting analysis of total protein extracts from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3) with the indicated antibodies. Signal intensities obtained from immunoblotting were quantified using ImageJ software version 1.52. The y-axis represents the fold change relative to the levels in HeLa cells treated with control siRNA. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1-targeted siRNA (Student’s t -test, * p < 0.05, ** p < 0.01, *** p < 0.001).
Techniques Used: Expressing, Quantitative RT-PCR, Isolation, Control, Western Blot, Software, Standard Deviation
Figure Legend Snippet: Ectopic expression of siRNA-resistant PCIF1 restores the normal levels of target mRNA expression. ( A , B ) RT-qPCR analysis of total RNAs isolated from HeLa cells transfected with a control empty vector (Vec) or a vector expressing siRNA-resistant PCIF1 (PCIF1siR) under treatment with control siRNA (siNC) or PCIF1-targeted siRNAs (siPCIF1 #3), using the specific primer set detecting RAB23 ( A ) and CNOT6 ( B ) expression. The y -axis represents the fold change relative to the levels in HeLa cells treated with control siRNA. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between indicated pairs (Student’s t -test, *** p < 0.001).
Techniques Used: Expressing, Quantitative RT-PCR, Isolation, Transfection, Control, Plasmid Preparation, Standard Deviation
Figure Legend Snippet: PCIF1 does not regulate expression of its target genes at the transcriptional level. ( A , E ) Schematic illustrations of the RAB23 ( A ) and CNOT6 ( E ) genes. The transcription start sites are indicated by arrows, the exons are shown as black boxes, and the polyadenylation signals are indicated by arrowheads. The positions of the PCR primer set for RT-qPCR amplification of the precursor and mature mRNAs are indicated by arrows. ( B – D , F – H ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3) using the indicated primer sets. ( I , J ) ChIP analyses of the RAB23 ( I ) and CNOT6 ( J ) gene promoters (position 2 in ) using antibodies against Pol II in HeLa cells treated with control siRNA (siNC) and two distinct PCIF1 targeted siRNAs (siPCIF1 #1 and #3). Normal rabbit IgG was used as the negative control. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1 targeted siRNA (Student’s t -test, n.s. p > 0.05, *** p < 0.001).
Techniques Used: Expressing, Quantitative RT-PCR, Amplification, Isolation, Control, Negative Control, Standard Deviation
Figure Legend Snippet: PCIF1 regulates the stability of target gene mRNAs in opposite ways. After HeLa cells were treated with a negative control siRNA (siNC) and two PCIF1-targeted siRNAs (siPCIF1 #1 and #3) for 72 h, actinomycin D was added to inhibit transcription. Cells were harvested at 0, 2, 4, 8, and 12 h after treatment, and total RNA was isolated. The amount of residual mRNA was analyzed by RT-qPCR at each time point, using the specific primer set detecting PCIF1 ( A ), CRAB23 ( B ), and CNOT6 ( C ) mRNAs. The relative value was calculated using the expression level of β-actin mRNA (ACTB) as a normalizer. The relative values at each time point were calculated relative to time zero. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1-targeted siRNA (Student’s t -test, * p < 0.05, *** p < 0.001).
Techniques Used: Negative Control, Isolation, Quantitative RT-PCR, Expressing, Control
Figure Legend Snippet: Ectopic expression of siRNA-resistant wild-type but not methyltransferase-deficient mutant PCIF1 restored normal levels of target mRNA expression. ( A ) Immunoblotting analysis of total protein extracts from HeLa cells transfected with a control empty vector (Vec), a vector expressing siRNA-resistant wild-type PCIF1 (siR_wt), or methyltransferase-deficient mutant PCIF1 (siR_mut) under treatment with control siRNA (siNC) or PCIF1-targeted siRNAs (siPCIF1: siPCIF1 #3 was used for PCIF1 suppression) with the indicated antibodies. ( B , C ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated as in ( A ), using the specific primer set detecting RAB23 ( B ) and CNOT6 ( C ) expression. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the indicated pairs (Student’s t -test, n.s. p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001).
Techniques Used: Expressing, Mutagenesis, Western Blot, Transfection, Control, Plasmid Preparation, Quantitative RT-PCR, Isolation, Standard Deviation
Figure Legend Snippet: PCIF1 suppression resulted in a significant decrease in m 6 A levels of both RAB23 and CNOT6 mRNAs. MeRIP-qPCR analysis was performed using HeLa cells treated with control siRNA (siNC) or PCIF1-targeted siRNA (siPCIF1: siPCIF1 #3 was used for PCIF1 suppression). RT-qPCR analysis of RNAs purified from the immunoprecipitates of HeLa cell extracts using the anti-m 6 A antibody, using the specific primer set detecting RAB23 ( A ), CNOT6 ( B ), and ACTB ( C ) mRNAs. The y -axis represents the fold change relative to the RNA levels in the immunoprecipitate by anti-m 6 A antibody from HeLa cells treated with control siRNA (siNC). Normal rabbit IgG (IgG) was used as a negative control. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the indicated pairs (Student’s t -test, n.s. p > 0.05, *** p < 0.001).
Techniques Used: Control, Quantitative RT-PCR, Purification, Negative Control, Standard Deviation
Related Articles
Synthesized:Article Title: Heat-Killed Lactiplantibacillus plantarum DRC2509 Isolated from Kimchi Restores Immune Function After Cyclophosphamide-Induced Immunosuppression in Mice. Article Snippet: Total RNA was extracted from splenocytes and peritoneal macrophages using an RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol and quantified spectrophotometrically. .. Complementary DNA was synthesized with Article Title: LH2 Promotes Tumor Progression in Oral Squamous Cell Carcinoma via EPHA7-AKT-VEGF Signaling. Article Snippet: Quantitative reverse-transcription PCR (qRTPCR) analysis Total RNA was extracted from stable LH2 O/E and mock clones, derived from both MOC1 and Sq1979 cells, using TRIzol reagent (Thermo Fisher Scientific). .. First-strand cDNA was synthesized using Article Title: A Pyrrole-Imidazole Polyamide Targeting Human USF1 Binding Suppresses High Glucose-Induced TGF-β1 and Osteopontin Expression in Human Renal Mesangial Cells. Article Snippet: Total RNA was extracted from HRMCs using TRIzol reagent (15596018, Invitrogen, Carlsbad, CA, USA). .. cDNA was synthesized using ReverTra Ace qPCR RT Master Mix with Real-time Polymerase Chain Reaction:Article Title: Heat-Killed Lactiplantibacillus plantarum DRC2509 Isolated from Kimchi Restores Immune Function After Cyclophosphamide-Induced Immunosuppression in Mice. Article Snippet: Total RNA was extracted from splenocytes and peritoneal macrophages using an RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol and quantified spectrophotometrically. .. Complementary DNA was synthesized with Article Title: Cytochalasin D-induced cytoskeletal remodeling with MYH9 enhances release of extracellular vesicles for therapeutic application. Article Snippet: The concentration and purity of the extracted RNA were determined using a NanoDrop. .. A total of 100 ng of total RNA was reverse-transcribed into complementary DNA using the Article Title: Red Pitahaya Betacyanins Selectively Upregulate Proinflammatory Cytokines In Vitro During Influenza A Virus Infection Article Snippet: .. Complementary DNA (cDNA) synthesis was performed using the Article Title: Microbiota-Taurine Pathway Links Dietary Fiber to Mucosal Healing. Article Snippet: .. Gene Forward primer (5′–3′) Reverse primer (5′–3′) Source GAPDH TCGGAGTCAACGGATTTGGT TGAAGGGGTCATTGATGGCA This study CYP2C18 — — Bio-Rad, assay ID:qHsaCID0011374 ReverTra Ace qPCR RT Master Mix with Article Title: LH2 Promotes Tumor Progression in Oral Squamous Cell Carcinoma via EPHA7-AKT-VEGF Signaling. Article Snippet: Quantitative reverse-transcription PCR (qRTPCR) analysis Total RNA was extracted from stable LH2 O/E and mock clones, derived from both MOC1 and Sq1979 cells, using TRIzol reagent (Thermo Fisher Scientific). .. First-strand cDNA was synthesized using Article Title: A Pyrrole-Imidazole Polyamide Targeting Human USF1 Binding Suppresses High Glucose-Induced TGF-β1 and Osteopontin Expression in Human Renal Mesangial Cells. Article Snippet: Total RNA was extracted from HRMCs using TRIzol reagent (15596018, Invitrogen, Carlsbad, CA, USA). .. cDNA was synthesized using ReverTra Ace qPCR RT Master Mix with Article Title: Cellular availability of all-trans -retinoic acid in mice: a pilot study Article Snippet: .. For the quantitative reverse transcription (RT)-PCR experiment, RNA from the eye and colon of adult Gal4DBD-RaraLBD or wild-type male mice (n = 3 for each group, 9-47 weeks old) was purified using Isogen (Cat #: 317-02503, Fujifilm Wako), and cDNA was prepared using ReverTra Ace qPCR RT Master Mix with Reverse Transcription:Article Title: Cytochalasin D-induced cytoskeletal remodeling with MYH9 enhances release of extracellular vesicles for therapeutic application. Article Snippet: The concentration and purity of the extracted RNA were determined using a NanoDrop. .. A total of 100 ng of total RNA was reverse-transcribed into complementary DNA using the Article Title: Palmitoyltransferase DHHC13 controls lysosomal cholesterol egress through palmitoylating Niemann-Pick C1. Article Snippet: .. The isolated RNA was reverse transcribed into complementary DNA (cDNA) using a Article Title: Cellular availability of all-trans -retinoic acid in mice: a pilot study Article Snippet: .. For the quantitative reverse transcription (RT)-PCR experiment, RNA from the eye and colon of adult Gal4DBD-RaraLBD or wild-type male mice (n = 3 for each group, 9-47 weeks old) was purified using Isogen (Cat #: 317-02503, Fujifilm Wako), and cDNA was prepared using ReverTra Ace qPCR RT Master Mix with cDNA Synthesis:Article Title: Red Pitahaya Betacyanins Selectively Upregulate Proinflammatory Cytokines In Vitro During Influenza A Virus Infection Article Snippet: .. Complementary DNA (cDNA) synthesis was performed using the Isolation:Article Title: Palmitoyltransferase DHHC13 controls lysosomal cholesterol egress through palmitoylating Niemann-Pick C1. Article Snippet: .. The isolated RNA was reverse transcribed into complementary DNA (cDNA) using a Purification:Article Title: Cellular availability of all-trans -retinoic acid in mice: a pilot study Article Snippet: .. For the quantitative reverse transcription (RT)-PCR experiment, RNA from the eye and colon of adult Gal4DBD-RaraLBD or wild-type male mice (n = 3 for each group, 9-47 weeks old) was purified using Isogen (Cat #: 317-02503, Fujifilm Wako), and cDNA was prepared using ReverTra Ace qPCR RT Master Mix with |