ndei restriction enzymes (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs ndei restriction enzymes

Isolation of a KARRE from the upstream 3′ splice site of the exon 5a of Snap25 gene based on forskolin reduction <t>of</t> <t>5a/5b</t> ratios in PC12 cells during neuronal differentiation. ( A ) Forskolin-induced neuronal differentiation of PC12 cells. Shown are representative images of PC12 cells without or with forskolin addition for 18 h. ( B ) Diagram of the alternative splicing of the exons 5a and 5b of the Snap25 gene. Arrows: sites of restriction enzymes <t>NdeI</t> (5a) and AvaII (5b) used to digest the PCR products. Arrowheads: PCR primers. ( C ) RT-PCR products from untreated (−) and treated PC12 cells. ETOH: ethanol, vehicle for forskolin and Dex (dexamethasone); H89: a PKA-specific inhibitor; NC: PCR negative control; M: molecular size marker. ( D) Diagram of the deletion/replacement mutants of Snap25 splicing reporters and their exon inclusion levels in the presence of PKAm or active PKA. Asterisks: indicating P value levels in one tail, paired Student’s t -test (*** P < 0.001, * P < 0.05, n ≥ 3). ( E) An agarose gel showing the PKA response of the heterologous S175NK reporter containing the 17 nt Snap25a element upstream of a stronger exon (175NK, about 75% inclusion with PKAm coexpression).

Ndei Restriction Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4962 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/enzyme+kinetic+module+of+sigmaplot+program/NdeI/pmc03439897-37-41-47
Average 99 stars, based on 4962 article reviews

ndei restriction enzymes - by Bioz Stars, 2026-10

99/100 stars

Images

1) Product Images from "Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation"

Article Title: Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation

Journal: Nucleic Acids Research

doi: 10.1093/nar/gks504

Isolation of a KARRE from the upstream 3′ splice site of the exon 5a of Snap25 gene based on forskolin reduction of 5a/5b ratios in PC12 cells during neuronal differentiation. ( A ) Forskolin-induced neuronal differentiation of PC12 cells. Shown are representative images of PC12 cells without or with forskolin addition for 18 h. ( B ) Diagram of the alternative splicing of the exons 5a and 5b of the Snap25 gene. Arrows: sites of restriction enzymes NdeI (5a) and AvaII (5b) used to digest the PCR products. Arrowheads: PCR primers. ( C ) RT-PCR products from untreated (−) and treated PC12 cells. ETOH: ethanol, vehicle for forskolin and Dex (dexamethasone); H89: a PKA-specific inhibitor; NC: PCR negative control; M: molecular size marker. ( D) Diagram of the deletion/replacement mutants of Snap25 splicing reporters and their exon inclusion levels in the presence of PKAm or active PKA. Asterisks: indicating P value levels in one tail, paired Student’s t -test (*** P < 0.001, * P < 0.05, n ≥ 3). ( E) An agarose gel showing the PKA response of the heterologous S175NK reporter containing the 17 nt Snap25a element upstream of a stronger exon (175NK, about 75% inclusion with PKAm coexpression).

Figure Legend Snippet: Isolation of a KARRE from the upstream 3′ splice site of the exon 5a of Snap25 gene based on forskolin reduction of 5a/5b ratios in PC12 cells during neuronal differentiation. ( A ) Forskolin-induced neuronal differentiation of PC12 cells. Shown are representative images of PC12 cells without or with forskolin addition for 18 h. ( B ) Diagram of the alternative splicing of the exons 5a and 5b of the Snap25 gene. Arrows: sites of restriction enzymes NdeI (5a) and AvaII (5b) used to digest the PCR products. Arrowheads: PCR primers. ( C ) RT-PCR products from untreated (−) and treated PC12 cells. ETOH: ethanol, vehicle for forskolin and Dex (dexamethasone); H89: a PKA-specific inhibitor; NC: PCR negative control; M: molecular size marker. ( D) Diagram of the deletion/replacement mutants of Snap25 splicing reporters and their exon inclusion levels in the presence of PKAm or active PKA. Asterisks: indicating P value levels in one tail, paired Student’s t -test (*** P < 0.001, * P < 0.05, n ≥ 3). ( E) An agarose gel showing the PKA response of the heterologous S175NK reporter containing the 17 nt Snap25a element upstream of a stronger exon (175NK, about 75% inclusion with PKAm coexpression).

Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction, Negative Control, Marker, Agarose Gel Electrophoresis

Purification:

Article Title: Reply to: Overestimations in the cyclization efficiency of small, restriction enzyme-digested DNA fragments.
Article Snippet: In his Matters Arising, Dr. Leng claims that our publication substantially overestimated the circularization efficiency because he believes that: (1) such performance is theoretically impossible according to the Jacobson–Stockmayer J-factor; (2) T5 exonuclease would not digest linear DNA under the described reaction conditions; and (3) T4 DNA ligase cannot function efficiently under the described conditions.. Based on the above assumptions, Dr. Leng reinterpreted the published gel images.. Dr. Leng’s Matters Arising included no experimental evidence indicating that he tested our protocol.

Sequencing:

Polymerase Chain Reaction:

Article Title: Tailoring high-cell-density fed-batch fermentation strategies to produce Russell's viper venom-specific single-domain antibody in E. coli.
Article Snippet: 1 Department of Microbiology, University of Delhi South Campus, New Delhi 110021, India 2 Department of Biological Sciences, Indian Institute of Science Education and Research Mohali, Manauli-140306, Mohali, Punjab, India 3 Centre for Nanoscience & Nanotechnology, University Institute for Emerging Areas in Science and Technology (UIEAST), Panjab University, Chandigarh, India Abstract Attributes of camelid-derived single-domain antibodies (sdAbs), such as enhanced antigen specificity, improved solubility and stability, efficient tissue penetration, and superior biodistribution, make them preferable therapeutics for diverse applications, including the treatment of cancers, neurological disorders, infectious diseases, and intoxication.. Limited availability and high cost of antivenoms necessitate the discovery of alternative neutralizers.. This investigation presents a proof of concept for developing a cost-effective Escherichia coli-based platform to produce high yields of an sdAb specific to Russell’s viper venom, denoted as ‘FRV’.

Amplification:

Article Title: Pre-splicing factors associate with UpA-rich RNA and limit flavivirus replication.
Article Snippet: .. The NS2A region was amplified from pBeloBAC-WNV using primers (FW: 5'- GGCATATGTACAACGCCGACATGATTGATCCTTTTCA-3' and RV: 5'- GGGAATTCTAATCTCTAGACTGTACACATCAAGGTTTAGGCATTTTAGTCCA-3'), followed by digestion with NdeI and XbaI (New England Biolabs). .. The 3' UTR region was amplified using primers (FW: 5'- CCCCCCGGGGACACTGTTTTGTAAATAATAAAGCTGTATTGAGTAGT-3' and RV: 5'- CCCTCTAGAGATCCTGTGTTCTAGCACCAC-3') and subsequently digested with XbaI and XmaI (New England Biolabs).

Cloning:

Ligation:

Article Title: Cycloserine inhibits glutamate decarboxylase from Mycobacterium tuberculosis .
Article Snippet: .. Restriction sites were introduced using primers Ndei_f and Xhoi_R, followed by digestion with Ndei and Xhoi enzymes (New england Biolabs) and ligation into the vector. .. construct integrity was verified using sanger sequencing (eurofins Genomics).

Review