pmscv puro ires gfp vector (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
pmscv puro ires gfp vector
Pmscv Puro Ires Gfp Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 77 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vector/pMSCV+PIG+(Puro+IRES+GFP+empty+vector)+(Plasmid+%2321654)/us09845471-459-17-22
Average 93 stars, based on 77 article reviews
Pmscv Puro Ires Gfp Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 77 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+vector/pMSCV+PIG+(Puro+IRES+GFP+empty+vector)+(Plasmid+%2321654)/us09845471-459-17-22
Average 93 stars, based on 77 article reviews
pmscv puro ires gfp vector - by Bioz Stars,
2026-10
93/100 stars
Images
Related Articles
Cloning:Article Title: PRPS activity tunes redox homeostasis in Myc-driven lymphoma Article Snippet: .. Prps1 cDNA (Horizon Discovery #MMM1013-202859297) and Prps2 cDNA (previously described [ ]) were subcloned into the Transformation Assay:Article Title: A TP53 Intron-Derived Peptide Promotes Tumor Survival Article Snippet: For the generation of shRNA-mediated stable IDP knockdown, pTRC2 vector was first edited to have a KpnI site and then digested with KpnI and EcoRI. shRNA oligonucleotides were obtained from Intergrated DNA Technologies (IDT, USA), annealed, and ligated with vector using T4 ligase. .. After transformation, clones were screened through DNA extraction and Sanger Sequencing. shRNA oligonucleotides can be found in Table S1. Clone Assay:Article Title: A TP53 Intron-Derived Peptide Promotes Tumor Survival Article Snippet: For the generation of shRNA-mediated stable IDP knockdown, pTRC2 vector was first edited to have a KpnI site and then digested with KpnI and EcoRI. shRNA oligonucleotides were obtained from Intergrated DNA Technologies (IDT, USA), annealed, and ligated with vector using T4 ligase. .. After transformation, clones were screened through DNA extraction and Sanger Sequencing. shRNA oligonucleotides can be found in Table S1. Article Title: The SAMD1 transcription factor coordinates hematopoietic lineage differentiation and H3K4 methylation status Article Snippet: Mice C57BL/6 congenic CD45.1 wild-type mice and C57BL/6 wild-type mice were obtained from Jackson labs. All mouse experiments were approved by the Institutional Animal Care and Use Committee of the University of Nebraska Medical Center in accordance with National Institutes of Health guidelines. .. Plasmids, shRNA, and single-guide constructs Samd1 knockdown shRNAs targeting exon 2 and a control shRNA targeting the luciferase gene were synthesized as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats, a 19-nt spacer, and restriction sites BglII/XhoI. shRNAs were cloned into the Article Title: Mitochondria protect against an intracellular pathogen by restricting access to folate Article Snippet: .. Human MTHFD2 cDNA amplified from ES-2 cells was cloned into Article Title: A Phosphoinositide Interacting Protein Coordinates Stress Precursor Activities Article Snippet: .. HA-tagged full-length Samd14, Samd14 lacking the SAM domain (S14ΔSAM), Samd14 lacking the capping protein binding (CPB) domain (Samd14 ΔCPB), and Samd14 lacking both SAM and CPB domains (S14ΔCS) ( Ray et al ., 2022 ) were cloned into mammalian Article Title: The Regulation of COX-2, ABCA1 and ABCG1 by the lncRNA PACERR links the inflammatory response and cholesterol homeostasis Article Snippet: Cells stably expressing the shRNAs were selected by using 5 μg ml −1 puromycin (Thermo Fisher Scientific). .. To create PACERR-overexpressing cell lines, PACERR gene block from IDT was cloned into the Article Title: A Stress-Induced PI3P Complex Controls Cell Autophagy in Erythroid Precursors Article Snippet: .. Plasmid Constructs 61 HA-tagged full-length Samd14, Samd14 lacking the SAM domain (S14ΔSAM), Samd14 lacking the capping 62 protein binding (CPB) domain (Samd14 ΔCPB), and Samd14 lacking both SAM and CPB domains 63 (S14ΔCS) (Ray et al., 2022) were cloned into mammalian DNA Extraction:Article Title: A TP53 Intron-Derived Peptide Promotes Tumor Survival Article Snippet: For the generation of shRNA-mediated stable IDP knockdown, pTRC2 vector was first edited to have a KpnI site and then digested with KpnI and EcoRI. shRNA oligonucleotides were obtained from Intergrated DNA Technologies (IDT, USA), annealed, and ligated with vector using T4 ligase. .. After transformation, clones were screened through DNA extraction and Sanger Sequencing. shRNA oligonucleotides can be found in Table S1. Sequencing:Article Title: A TP53 Intron-Derived Peptide Promotes Tumor Survival Article Snippet: For the generation of shRNA-mediated stable IDP knockdown, pTRC2 vector was first edited to have a KpnI site and then digested with KpnI and EcoRI. shRNA oligonucleotides were obtained from Intergrated DNA Technologies (IDT, USA), annealed, and ligated with vector using T4 ligase. .. After transformation, clones were screened through DNA extraction and Sanger Sequencing. shRNA oligonucleotides can be found in Table S1. Article Title: EMP1 safeguards hematopoietic stem cells by suppressing sphingolipid metabolism and alleviating endoplasmic reticulum stress Article Snippet: C57BL/6J mouse Cyagen, China NA CD45.1 mouse Cyagen, China NA Tie2-Cre mouse Cyagen, China NA Mx1-Cre mouse Cyagen, China NA Emp1fl/+ mouse Cyagen, China TOS170110KY1 .. shRNA targeting sequence: human EMP1-1#: CCGGCGCTACTGTTATTATGCTATTCTCGAGAATAGCATAATAACAGTAGC GTTTTTG Tsingke, China N/A shRNA targeting sequence: human EMP1-2#: CCGGCCACATCGCTACTGTTATTATCTCGAGATAATAACAGTAGCGATGTG GTTTTTG Tsingke, China N/A Primers for Real-time PCR, see Supplementary Table S5 Tsingke, China N/A Recombinant DNA pCMV-C-EGFP Beyotime D2626 pCMV-Emp1-EGFP Tsingke, shRNA:Article Title: A TP53 Intron-Derived Peptide Promotes Tumor Survival Article Snippet: For the generation of shRNA-mediated stable IDP knockdown, pTRC2 vector was first edited to have a KpnI site and then digested with KpnI and EcoRI. shRNA oligonucleotides were obtained from Intergrated DNA Technologies (IDT, USA), annealed, and ligated with vector using T4 ligase. .. After transformation, clones were screened through DNA extraction and Sanger Sequencing. shRNA oligonucleotides can be found in Table S1. Article Title: The SAMD1 transcription factor coordinates hematopoietic lineage differentiation and H3K4 methylation status Article Snippet: Mice C57BL/6 congenic CD45.1 wild-type mice and C57BL/6 wild-type mice were obtained from Jackson labs. All mouse experiments were approved by the Institutional Animal Care and Use Committee of the University of Nebraska Medical Center in accordance with National Institutes of Health guidelines. .. Plasmids, shRNA, and single-guide constructs Samd1 knockdown shRNAs targeting exon 2 and a control shRNA targeting the luciferase gene were synthesized as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats, a 19-nt spacer, and restriction sites BglII/XhoI. shRNAs were cloned into the Construct:Article Title: The SAMD1 transcription factor coordinates hematopoietic lineage differentiation and H3K4 methylation status Article Snippet: Mice C57BL/6 congenic CD45.1 wild-type mice and C57BL/6 wild-type mice were obtained from Jackson labs. All mouse experiments were approved by the Institutional Animal Care and Use Committee of the University of Nebraska Medical Center in accordance with National Institutes of Health guidelines. .. Plasmids, shRNA, and single-guide constructs Samd1 knockdown shRNAs targeting exon 2 and a control shRNA targeting the luciferase gene were synthesized as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats, a 19-nt spacer, and restriction sites BglII/XhoI. shRNAs were cloned into the Article Title: A Stress-Induced PI3P Complex Controls Cell Autophagy in Erythroid Precursors Article Snippet: .. Plasmid Constructs 61 HA-tagged full-length Samd14, Samd14 lacking the SAM domain (S14ΔSAM), Samd14 lacking the capping 62 protein binding (CPB) domain (Samd14 ΔCPB), and Samd14 lacking both SAM and CPB domains 63 (S14ΔCS) (Ray et al., 2022) were cloned into mammalian Knockdown:Article Title: The SAMD1 transcription factor coordinates hematopoietic lineage differentiation and H3K4 methylation status Article Snippet: Mice C57BL/6 congenic CD45.1 wild-type mice and C57BL/6 wild-type mice were obtained from Jackson labs. All mouse experiments were approved by the Institutional Animal Care and Use Committee of the University of Nebraska Medical Center in accordance with National Institutes of Health guidelines. .. Plasmids, shRNA, and single-guide constructs Samd1 knockdown shRNAs targeting exon 2 and a control shRNA targeting the luciferase gene were synthesized as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats, a 19-nt spacer, and restriction sites BglII/XhoI. shRNAs were cloned into the Control:Article Title: The SAMD1 transcription factor coordinates hematopoietic lineage differentiation and H3K4 methylation status Article Snippet: Mice C57BL/6 congenic CD45.1 wild-type mice and C57BL/6 wild-type mice were obtained from Jackson labs. All mouse experiments were approved by the Institutional Animal Care and Use Committee of the University of Nebraska Medical Center in accordance with National Institutes of Health guidelines. .. Plasmids, shRNA, and single-guide constructs Samd1 knockdown shRNAs targeting exon 2 and a control shRNA targeting the luciferase gene were synthesized as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats, a 19-nt spacer, and restriction sites BglII/XhoI. shRNAs were cloned into the Luciferase:Article Title: The SAMD1 transcription factor coordinates hematopoietic lineage differentiation and H3K4 methylation status Article Snippet: Mice C57BL/6 congenic CD45.1 wild-type mice and C57BL/6 wild-type mice were obtained from Jackson labs. All mouse experiments were approved by the Institutional Animal Care and Use Committee of the University of Nebraska Medical Center in accordance with National Institutes of Health guidelines. .. Plasmids, shRNA, and single-guide constructs Samd1 knockdown shRNAs targeting exon 2 and a control shRNA targeting the luciferase gene were synthesized as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats, a 19-nt spacer, and restriction sites BglII/XhoI. shRNAs were cloned into the Synthesized:Article Title: The SAMD1 transcription factor coordinates hematopoietic lineage differentiation and H3K4 methylation status Article Snippet: Mice C57BL/6 congenic CD45.1 wild-type mice and C57BL/6 wild-type mice were obtained from Jackson labs. All mouse experiments were approved by the Institutional Animal Care and Use Committee of the University of Nebraska Medical Center in accordance with National Institutes of Health guidelines. .. Plasmids, shRNA, and single-guide constructs Samd1 knockdown shRNAs targeting exon 2 and a control shRNA targeting the luciferase gene were synthesized as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats, a 19-nt spacer, and restriction sites BglII/XhoI. shRNAs were cloned into the Expressing:Article Title: The SAMD1 transcription factor coordinates hematopoietic lineage differentiation and H3K4 methylation status Article Snippet: Mice C57BL/6 congenic CD45.1 wild-type mice and C57BL/6 wild-type mice were obtained from Jackson labs. All mouse experiments were approved by the Institutional Animal Care and Use Committee of the University of Nebraska Medical Center in accordance with National Institutes of Health guidelines. .. Plasmids, shRNA, and single-guide constructs Samd1 knockdown shRNAs targeting exon 2 and a control shRNA targeting the luciferase gene were synthesized as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats, a 19-nt spacer, and restriction sites BglII/XhoI. shRNAs were cloned into the Article Title: A Phosphoinositide Interacting Protein Coordinates Stress Precursor Activities Article Snippet: .. HA-tagged full-length Samd14, Samd14 lacking the SAM domain (S14ΔSAM), Samd14 lacking the capping protein binding (CPB) domain (Samd14 ΔCPB), and Samd14 lacking both SAM and CPB domains (S14ΔCS) ( Ray et al ., 2022 ) were cloned into mammalian Article Title: A Stress-Induced PI3P Complex Controls Cell Autophagy in Erythroid Precursors Article Snippet: .. Plasmid Constructs 61 HA-tagged full-length Samd14, Samd14 lacking the SAM domain (S14ΔSAM), Samd14 lacking the capping 62 protein binding (CPB) domain (Samd14 ΔCPB), and Samd14 lacking both SAM and CPB domains 63 (S14ΔCS) (Ray et al., 2022) were cloned into mammalian Plasmid Preparation:Article Title: The SAMD1 transcription factor coordinates hematopoietic lineage differentiation and H3K4 methylation status Article Snippet: Mice C57BL/6 congenic CD45.1 wild-type mice and C57BL/6 wild-type mice were obtained from Jackson labs. All mouse experiments were approved by the Institutional Animal Care and Use Committee of the University of Nebraska Medical Center in accordance with National Institutes of Health guidelines. .. Plasmids, shRNA, and single-guide constructs Samd1 knockdown shRNAs targeting exon 2 and a control shRNA targeting the luciferase gene were synthesized as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats, a 19-nt spacer, and restriction sites BglII/XhoI. shRNAs were cloned into the Article Title: A Phosphoinositide Interacting Protein Coordinates Stress Precursor Activities Article Snippet: .. HA-tagged full-length Samd14, Samd14 lacking the SAM domain (S14ΔSAM), Samd14 lacking the capping protein binding (CPB) domain (Samd14 ΔCPB), and Samd14 lacking both SAM and CPB domains (S14ΔCS) ( Ray et al ., 2022 ) were cloned into mammalian Article Title: The Regulation of COX-2, ABCA1 and ABCG1 by the lncRNA PACERR links the inflammatory response and cholesterol homeostasis Article Snippet: Cells stably expressing the shRNAs were selected by using 5 μg ml −1 puromycin (Thermo Fisher Scientific). .. To create PACERR-overexpressing cell lines, PACERR gene block from IDT was cloned into the Article Title: A Stress-Induced PI3P Complex Controls Cell Autophagy in Erythroid Precursors Article Snippet: .. Plasmid Constructs 61 HA-tagged full-length Samd14, Samd14 lacking the SAM domain (S14ΔSAM), Samd14 lacking the capping 62 protein binding (CPB) domain (Samd14 ΔCPB), and Samd14 lacking both SAM and CPB domains 63 (S14ΔCS) (Ray et al., 2022) were cloned into mammalian Amplification:Article Title: Mitochondria protect against an intracellular pathogen by restricting access to folate Article Snippet: .. Human MTHFD2 cDNA amplified from ES-2 cells was cloned into Real-time Polymerase Chain Reaction:Article Title: EMP1 safeguards hematopoietic stem cells by suppressing sphingolipid metabolism and alleviating endoplasmic reticulum stress Article Snippet: C57BL/6J mouse Cyagen, China NA CD45.1 mouse Cyagen, China NA Tie2-Cre mouse Cyagen, China NA Mx1-Cre mouse Cyagen, China NA Emp1fl/+ mouse Cyagen, China TOS170110KY1 .. shRNA targeting sequence: human EMP1-1#: CCGGCGCTACTGTTATTATGCTATTCTCGAGAATAGCATAATAACAGTAGC GTTTTTG Tsingke, China N/A shRNA targeting sequence: human EMP1-2#: CCGGCCACATCGCTACTGTTATTATCTCGAGATAATAACAGTAGCGATGTG GTTTTTG Tsingke, China N/A Primers for Real-time PCR, see Supplementary Table S5 Tsingke, China N/A Recombinant DNA pCMV-C-EGFP Beyotime D2626 pCMV-Emp1-EGFP Tsingke, Recombinant:Article Title: EMP1 safeguards hematopoietic stem cells by suppressing sphingolipid metabolism and alleviating endoplasmic reticulum stress Article Snippet: C57BL/6J mouse Cyagen, China NA CD45.1 mouse Cyagen, China NA Tie2-Cre mouse Cyagen, China NA Mx1-Cre mouse Cyagen, China NA Emp1fl/+ mouse Cyagen, China TOS170110KY1 .. shRNA targeting sequence: human EMP1-1#: CCGGCGCTACTGTTATTATGCTATTCTCGAGAATAGCATAATAACAGTAGC GTTTTTG Tsingke, China N/A shRNA targeting sequence: human EMP1-2#: CCGGCCACATCGCTACTGTTATTATCTCGAGATAATAACAGTAGCGATGTG GTTTTTG Tsingke, China N/A Primers for Real-time PCR, see Supplementary Table S5 Tsingke, China N/A Recombinant DNA pCMV-C-EGFP Beyotime D2626 pCMV-Emp1-EGFP Tsingke, Software:Article Title: EMP1 safeguards hematopoietic stem cells by suppressing sphingolipid metabolism and alleviating endoplasmic reticulum stress Article Snippet: C57BL/6J mouse Cyagen, China NA CD45.1 mouse Cyagen, China NA Tie2-Cre mouse Cyagen, China NA Mx1-Cre mouse Cyagen, China NA Emp1fl/+ mouse Cyagen, China TOS170110KY1 .. shRNA targeting sequence: human EMP1-1#: CCGGCGCTACTGTTATTATGCTATTCTCGAGAATAGCATAATAACAGTAGC GTTTTTG Tsingke, China N/A shRNA targeting sequence: human EMP1-2#: CCGGCCACATCGCTACTGTTATTATCTCGAGATAATAACAGTAGCGATGTG GTTTTTG Tsingke, China N/A Primers for Real-time PCR, see Supplementary Table S5 Tsingke, China N/A Recombinant DNA pCMV-C-EGFP Beyotime D2626 pCMV-Emp1-EGFP Tsingke, Protein Binding:Article Title: A Phosphoinositide Interacting Protein Coordinates Stress Precursor Activities Article Snippet: .. HA-tagged full-length Samd14, Samd14 lacking the SAM domain (S14ΔSAM), Samd14 lacking the capping protein binding (CPB) domain (Samd14 ΔCPB), and Samd14 lacking both SAM and CPB domains (S14ΔCS) ( Ray et al ., 2022 ) were cloned into mammalian Article Title: A Stress-Induced PI3P Complex Controls Cell Autophagy in Erythroid Precursors Article Snippet: .. Plasmid Constructs 61 HA-tagged full-length Samd14, Samd14 lacking the SAM domain (S14ΔSAM), Samd14 lacking the capping 62 protein binding (CPB) domain (Samd14 ΔCPB), and Samd14 lacking both SAM and CPB domains 63 (S14ΔCS) (Ray et al., 2022) were cloned into mammalian Blocking Assay:Article Title: The Regulation of COX-2, ABCA1 and ABCG1 by the lncRNA PACERR links the inflammatory response and cholesterol homeostasis Article Snippet: Cells stably expressing the shRNAs were selected by using 5 μg ml −1 puromycin (Thermo Fisher Scientific). .. To create PACERR-overexpressing cell lines, PACERR gene block from IDT was cloned into the Transfection:Article Title: The Regulation of COX-2, ABCA1 and ABCG1 by the lncRNA PACERR links the inflammatory response and cholesterol homeostasis Article Snippet: Cells stably expressing the shRNAs were selected by using 5 μg ml −1 puromycin (Thermo Fisher Scientific). .. To create PACERR-overexpressing cell lines, PACERR gene block from IDT was cloned into the |
