5 α competent e coli (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
96
Structured Review
New England Biolabs
5 α competent e coli
5 α Competent E Coli, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 977 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/efficient+navigation+microscope+software/NEB+5-alpha+Competent+E%2E+coli/pmc10592515-34-1-0
Average 96 stars, based on 977 article reviews
5 α Competent E Coli, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 977 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/efficient+navigation+microscope+software/NEB+5-alpha+Competent+E%2E+coli/pmc10592515-34-1-0
Average 96 stars, based on 977 article reviews
5 α competent e coli - by Bioz Stars,
2026-10
96/100 stars
Images
1) Product Images from "Heat shock factor 1 (HSF1) specifically potentiates c-MYC-mediated transcription independently of the canonical heat shock response"
Article Title: Heat shock factor 1 (HSF1) specifically potentiates c-MYC-mediated transcription independently of the canonical heat shock response
Journal: Cell reports
doi: 10.1016/j.celrep.2023.112557
Figure Legend Snippet: KEY RESOURCES TABLE
Techniques Used: Control, In Situ, Virus, Recombinant, Protease Inhibitor, Transfection, SYBR Green Assay, Luciferase, Chromatin Immunoprecipitation, Quantitation Assay, Western Blot, Microscopy, Mutagenesis, shRNA, Plasmid Preparation, Software, Expressing, Magnetic Beads, Blocking Assay, Membrane
Related Articles
Plasmid Preparation:Article Title: Phenotypic Plasticity During Organofluorine Degradation Revealed by Adaptive Evolution Article Snippet: The DEF2 gene optimised for P. putida was synthesised with the same 5′ and 3′ additions as previously described for the DEF1 gene (Dodge et al. ) (codons for six histidine residues, a start codon, a ribosomal binding site, the T5 promoter sequence and sequences complementary to the upstream and downstream vector arms) to create an expression cassette that could be inserted into the pBBR1‐MCS2 backbone using an NEB HiFi assembly kit. .. Plasmid pBBR1‐MCS2 was cut with restriction enzymes AgeI and NsiI, purified using a QIAquick PCR purification kit (QIAGEN, Hilden, Germany) and combined with the synthetic expression cassette in an assembly reaction per the manufacturer's instructions, which was then used to transform Article Title: The C-terminal PHD V C5HCH tandem domain of NSD2 is a combinatorial reader of unmodified H3K4 and tri-methylated H3K27 that regulates transcription of cell adhesion genes in multiple myeloma Article Snippet: .. The primers were used to PCR-amplify the plasmid and the product was transformed into Article Title: Dynamics of neuropeptide release and activity post-bloodmeal in the female mosquito, Aedes aegypti Article Snippet: The amplified PCR products were purified using a Monarch PCR purification kit (New England Biolabs, Whitby, ON, Canada) and reamplified using modified primers containing restriction sites for subsequent directional cloning in mammalian expression plasmids. .. Products were A-tailed and cloned into a pGEM-T Easy vector (Promega, Madison, WI, USA) or pCE2 TA/Blunt-Zero vector (GeneBio Systems, Burlington, ON, Canada) and then transformed into Purification:Article Title: Phenotypic Plasticity During Organofluorine Degradation Revealed by Adaptive Evolution Article Snippet: The DEF2 gene optimised for P. putida was synthesised with the same 5′ and 3′ additions as previously described for the DEF1 gene (Dodge et al. ) (codons for six histidine residues, a start codon, a ribosomal binding site, the T5 promoter sequence and sequences complementary to the upstream and downstream vector arms) to create an expression cassette that could be inserted into the pBBR1‐MCS2 backbone using an NEB HiFi assembly kit. .. Plasmid pBBR1‐MCS2 was cut with restriction enzymes AgeI and NsiI, purified using a QIAquick PCR purification kit (QIAGEN, Hilden, Germany) and combined with the synthetic expression cassette in an assembly reaction per the manufacturer's instructions, which was then used to transform Polymerase Chain Reaction:Article Title: Phenotypic Plasticity During Organofluorine Degradation Revealed by Adaptive Evolution Article Snippet: The DEF2 gene optimised for P. putida was synthesised with the same 5′ and 3′ additions as previously described for the DEF1 gene (Dodge et al. ) (codons for six histidine residues, a start codon, a ribosomal binding site, the T5 promoter sequence and sequences complementary to the upstream and downstream vector arms) to create an expression cassette that could be inserted into the pBBR1‐MCS2 backbone using an NEB HiFi assembly kit. .. Plasmid pBBR1‐MCS2 was cut with restriction enzymes AgeI and NsiI, purified using a QIAquick PCR purification kit (QIAGEN, Hilden, Germany) and combined with the synthetic expression cassette in an assembly reaction per the manufacturer's instructions, which was then used to transform Article Title: The C-terminal PHD V C5HCH tandem domain of NSD2 is a combinatorial reader of unmodified H3K4 and tri-methylated H3K27 that regulates transcription of cell adhesion genes in multiple myeloma Article Snippet: .. The primers were used to PCR-amplify the plasmid and the product was transformed into Expressing:Article Title: Phenotypic Plasticity During Organofluorine Degradation Revealed by Adaptive Evolution Article Snippet: The DEF2 gene optimised for P. putida was synthesised with the same 5′ and 3′ additions as previously described for the DEF1 gene (Dodge et al. ) (codons for six histidine residues, a start codon, a ribosomal binding site, the T5 promoter sequence and sequences complementary to the upstream and downstream vector arms) to create an expression cassette that could be inserted into the pBBR1‐MCS2 backbone using an NEB HiFi assembly kit. .. Plasmid pBBR1‐MCS2 was cut with restriction enzymes AgeI and NsiI, purified using a QIAquick PCR purification kit (QIAGEN, Hilden, Germany) and combined with the synthetic expression cassette in an assembly reaction per the manufacturer's instructions, which was then used to transform other:Article Title: Electrical signaling and coordinated behavior in the closest relative of animals Article Snippet: The codon-optimized RGECO1 was cloned into the S. rosetta expression plasmid NK802 (Addgene; #166056) ( ) replacing the mCherry sequence. Article Title: A Linear Mixed Effects Model for Evaluating Synthetic Gene Circuits Article Snippet: Kanamycin sulfate (C18H38N4O15S, Growcells), anhydrotetracycline hydrochloride (aTc, Sigma-Aldrich), 3-oxohexanoyl-homoserine lactone (OC6, Sigma-Aldrich), NEB Article Title: Nucleophosmin mutations lead to abnormal, but reversible, nucleoli architecture and aggregate formation – Implications for NPM1-targeting therapies in AML Article Snippet: DNA oligonucleotides (Forward 5’ ACATGGACATGAGCCCCCTG 3’, Reverse 5’ GATAGTTCTGGGGCCTCAGG 3’) used for gRNA synthesis were designed using the Benchling CRISPR gRNA Design Tool available at ( www.benchling.com , accessed on 15 May 2022) and ordered through Sigma. Transformation Assay:Article Title: The C-terminal PHD V C5HCH tandem domain of NSD2 is a combinatorial reader of unmodified H3K4 and tri-methylated H3K27 that regulates transcription of cell adhesion genes in multiple myeloma Article Snippet: .. The primers were used to PCR-amplify the plasmid and the product was transformed into Article Title: Dynamics of neuropeptide release and activity post-bloodmeal in the female mosquito, Aedes aegypti Article Snippet: The amplified PCR products were purified using a Monarch PCR purification kit (New England Biolabs, Whitby, ON, Canada) and reamplified using modified primers containing restriction sites for subsequent directional cloning in mammalian expression plasmids. .. Products were A-tailed and cloned into a pGEM-T Easy vector (Promega, Madison, WI, USA) or pCE2 TA/Blunt-Zero vector (GeneBio Systems, Burlington, ON, Canada) and then transformed into Clone Assay:Article Title: Dynamics of neuropeptide release and activity post-bloodmeal in the female mosquito, Aedes aegypti Article Snippet: The amplified PCR products were purified using a Monarch PCR purification kit (New England Biolabs, Whitby, ON, Canada) and reamplified using modified primers containing restriction sites for subsequent directional cloning in mammalian expression plasmids. .. Products were A-tailed and cloned into a pGEM-T Easy vector (Promega, Madison, WI, USA) or pCE2 TA/Blunt-Zero vector (GeneBio Systems, Burlington, ON, Canada) and then transformed into |