Review




Structured Review

OpenEye Scientific Software Inc fred docking program
Fred Docking Program, supplied by OpenEye Scientific Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/docking+program+fred/fred+docking+program/pmc06556414-301-39-43
Average 90 stars, based on 1 article reviews
fred docking program - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Binding Assay:

Article Title: A novel colistin adjuvant identified by virtual screening for ArnT inhibitors
Article Snippet: .. BBN149 corresponds to ent -beyer-15-en-18- O -oxalate, a natural diterpenoid featuring an oxalate side chain (Figure a and Table )., The binding mode of BBN149 within the catalytic site of ArnT was investigated by molecular docking simulations carried out with the FRED docking program (OpenEye). ..

Nuclear Magnetic Resonance:

Article Title: Synthesis of distal and proximal fleximer base analogues and evaluation in the nucleocapsid protein of HIV-1
Article Snippet: .. Molecular modeling study was performed as described in previous studies.14, 38 Briefly, the NMR structure of the NC in complex with a small molecule inhibitor was used as rigid receptor in molecular docking simulations,37 which were carried out by the FRED docking program from OpenEye, version 3.0.1.39, 40 Ligand conformational analysis was performed with OMEGA from OpenEye.52, 53 Nucleocapsid NMR Studies Expression and purification of recombinant HIV-1 NC protein.54 The HIV-1 NC coding region in pNL4-355 was PCR amplified using the 5’-primer CCAGCTACCATACATATGCAGAAAGGC (NdeI site underlined) and the 3’-primer GGCCGGATCCTCCCTAACTAATTAGCCTGTC-TCTC (BamHI and stop codon underlined). .. The expression vector pET-3a (Novagen, Madison, WI) was doubly digested with NdeI and BamHI and treated with calf intestinal alkaline phosphate.

Article Title: Synthesis of distal and proximal fleximer base analogues and evaluation in the nucleocapsid protein of HIV-1
Article Snippet: .. Molecular modeling study was performed as described in previous studies., Briefly, the NMR structure of the NC in complex with a small molecule inhibitor was used as rigid receptor in molecular docking simulations, which were carried out by the FRED docking program from OpenEye, version 3.0.1. , Ligand conformational analysis was performed with OMEGA from OpenEye., ..

Expressing:

Article Title: Synthesis of distal and proximal fleximer base analogues and evaluation in the nucleocapsid protein of HIV-1
Article Snippet: .. Molecular modeling study was performed as described in previous studies.14, 38 Briefly, the NMR structure of the NC in complex with a small molecule inhibitor was used as rigid receptor in molecular docking simulations,37 which were carried out by the FRED docking program from OpenEye, version 3.0.1.39, 40 Ligand conformational analysis was performed with OMEGA from OpenEye.52, 53 Nucleocapsid NMR Studies Expression and purification of recombinant HIV-1 NC protein.54 The HIV-1 NC coding region in pNL4-355 was PCR amplified using the 5’-primer CCAGCTACCATACATATGCAGAAAGGC (NdeI site underlined) and the 3’-primer GGCCGGATCCTCCCTAACTAATTAGCCTGTC-TCTC (BamHI and stop codon underlined). .. The expression vector pET-3a (Novagen, Madison, WI) was doubly digested with NdeI and BamHI and treated with calf intestinal alkaline phosphate.

Purification:

Article Title: Synthesis of distal and proximal fleximer base analogues and evaluation in the nucleocapsid protein of HIV-1
Article Snippet: .. Molecular modeling study was performed as described in previous studies.14, 38 Briefly, the NMR structure of the NC in complex with a small molecule inhibitor was used as rigid receptor in molecular docking simulations,37 which were carried out by the FRED docking program from OpenEye, version 3.0.1.39, 40 Ligand conformational analysis was performed with OMEGA from OpenEye.52, 53 Nucleocapsid NMR Studies Expression and purification of recombinant HIV-1 NC protein.54 The HIV-1 NC coding region in pNL4-355 was PCR amplified using the 5’-primer CCAGCTACCATACATATGCAGAAAGGC (NdeI site underlined) and the 3’-primer GGCCGGATCCTCCCTAACTAATTAGCCTGTC-TCTC (BamHI and stop codon underlined). .. The expression vector pET-3a (Novagen, Madison, WI) was doubly digested with NdeI and BamHI and treated with calf intestinal alkaline phosphate.

Recombinant:

Article Title: Synthesis of distal and proximal fleximer base analogues and evaluation in the nucleocapsid protein of HIV-1
Article Snippet: .. Molecular modeling study was performed as described in previous studies.14, 38 Briefly, the NMR structure of the NC in complex with a small molecule inhibitor was used as rigid receptor in molecular docking simulations,37 which were carried out by the FRED docking program from OpenEye, version 3.0.1.39, 40 Ligand conformational analysis was performed with OMEGA from OpenEye.52, 53 Nucleocapsid NMR Studies Expression and purification of recombinant HIV-1 NC protein.54 The HIV-1 NC coding region in pNL4-355 was PCR amplified using the 5’-primer CCAGCTACCATACATATGCAGAAAGGC (NdeI site underlined) and the 3’-primer GGCCGGATCCTCCCTAACTAATTAGCCTGTC-TCTC (BamHI and stop codon underlined). .. The expression vector pET-3a (Novagen, Madison, WI) was doubly digested with NdeI and BamHI and treated with calf intestinal alkaline phosphate.

Polymerase Chain Reaction:

Article Title: Synthesis of distal and proximal fleximer base analogues and evaluation in the nucleocapsid protein of HIV-1
Article Snippet: .. Molecular modeling study was performed as described in previous studies.14, 38 Briefly, the NMR structure of the NC in complex with a small molecule inhibitor was used as rigid receptor in molecular docking simulations,37 which were carried out by the FRED docking program from OpenEye, version 3.0.1.39, 40 Ligand conformational analysis was performed with OMEGA from OpenEye.52, 53 Nucleocapsid NMR Studies Expression and purification of recombinant HIV-1 NC protein.54 The HIV-1 NC coding region in pNL4-355 was PCR amplified using the 5’-primer CCAGCTACCATACATATGCAGAAAGGC (NdeI site underlined) and the 3’-primer GGCCGGATCCTCCCTAACTAATTAGCCTGTC-TCTC (BamHI and stop codon underlined). .. The expression vector pET-3a (Novagen, Madison, WI) was doubly digested with NdeI and BamHI and treated with calf intestinal alkaline phosphate.

Amplification:

Article Title: Synthesis of distal and proximal fleximer base analogues and evaluation in the nucleocapsid protein of HIV-1
Article Snippet: .. Molecular modeling study was performed as described in previous studies.14, 38 Briefly, the NMR structure of the NC in complex with a small molecule inhibitor was used as rigid receptor in molecular docking simulations,37 which were carried out by the FRED docking program from OpenEye, version 3.0.1.39, 40 Ligand conformational analysis was performed with OMEGA from OpenEye.52, 53 Nucleocapsid NMR Studies Expression and purification of recombinant HIV-1 NC protein.54 The HIV-1 NC coding region in pNL4-355 was PCR amplified using the 5’-primer CCAGCTACCATACATATGCAGAAAGGC (NdeI site underlined) and the 3’-primer GGCCGGATCCTCCCTAACTAATTAGCCTGTC-TCTC (BamHI and stop codon underlined). .. The expression vector pET-3a (Novagen, Madison, WI) was doubly digested with NdeI and BamHI and treated with calf intestinal alkaline phosphate.

other:

Article Title: High-Throughput Virtual Screening and Validation of a SARS-CoV-2 Main Protease Noncovalent Inhibitor
Article Snippet: OpenEye toolkit’s FRED docking program was deployed on Frontera at TACC.

Article Title: A Smo/Gli Multitarget Hedgehog Pathway Inhibitor Impairs Tumor Growth
Article Snippet: In detail, docking of compound 22 to Smo by FRED docking program (OpenEye) highlighted a number of H-bond interactions between the molecule and Smo key residues, such as Asn219, Gln477, and Arg400 ( A).

Article Title: Discovery of small molecule inhibitors of Leishmania braziliensis Hsp90 chaperone
Article Snippet: Receptor box volume was 10720 Å 3 with the dimensions of 24.00 * 23.33 * 20.00 Å. Molecular docking was performed with FRED docking programme (OpenEye, Santa Fe, NM) , setting the resolution value as High.



Similar Products

90
OpenEye Scientific Software Inc fred docking program
Fred Docking Program, supplied by OpenEye Scientific Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/docking+program+fred/fred+docking+program/pmc11667674__cb4c00403_si_003-34-6-10
Average 90 stars, based on 1 article reviews
fred docking program - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OpenEye Scientific Software Inc fred docking program version 3.3.0.3
Fred Docking Program Version 3.3.0.3, supplied by OpenEye Scientific Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/docking+program+fred/fred+docking+program+version+3+3+0+3/pm36838279-100-7-12
Average 90 stars, based on 1 article reviews
fred docking program version 3.3.0.3 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OpenEye Scientific Software Inc fred docking program oedocking 3.4.0.2
Fred Docking Program Oedocking 3.4.0.2, supplied by OpenEye Scientific Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/docking+program+fred/fred+software+oedocking+3+3+1+2/pm35961068-443-6-11
Average 90 stars, based on 1 article reviews
fred docking program oedocking 3.4.0.2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OpenEye Scientific Software Inc docking programs openeye’s fred
Docking Programs Openeye’s Fred, supplied by OpenEye Scientific Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/docking+program+fred/openeye+docking/10__1186_slash_s13321___020___00471___2-35-6-12
Average 90 stars, based on 1 article reviews
docking programs openeye’s fred - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OpenEye Scientific Software Inc molecular docking fred program
Molecular Docking Fred Program, supplied by OpenEye Scientific Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/docking+program+fred/molecular+docking+package+fred/pmc07236274-98-24-29
Average 90 stars, based on 1 article reviews
molecular docking fred program - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results