Review




Structured Review

CustomArray Inc oligonucleotide microarrays customarray 12k
Oligonucleotide Microarrays Customarray 12k, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/customarray%E2%84%A2+12k+microarray/microarray+surfaces/pm23306674-79-1-8
Average 90 stars, based on 1 article reviews
oligonucleotide microarrays customarray 12k - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Synthesized:

Article Title: Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof
Article Snippet: Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. A third round of PCR was performed to incorporate overhangs compatible for Gibson Assembly (NEB) into the lentiviral sgRNA AAVS1-targeting vector between the XbaI and NdeI sites.

Amplification:

Article Title: Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof
Article Snippet: Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. A third round of PCR was performed to incorporate overhangs compatible for Gibson Assembly (NEB) into the lentiviral sgRNA AAVS1-targeting vector between the XbaI and NdeI sites.

Nested PCR:

Article Title: Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof
Article Snippet: Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. A third round of PCR was performed to incorporate overhangs compatible for Gibson Assembly (NEB) into the lentiviral sgRNA AAVS1-targeting vector between the XbaI and NdeI sites.

other:

Article Title: Development of DNA Microarray for Parallel Detection of Community-Acquired Pneumonia Bacterial Pathogens
Article Snippet: In the research we used CustomArray microarrays (USA).


Article Title: CRISPR screens identify cholesterol biosynthesis as a therapeutic target on stemness and drug resistance of colon cancer
Article Snippet: Pooled Epi-Drug sgRNA library was designed using CRISPR-DO tool by He lab and synthesized as 73-mer oligonucleotides (CustomArray, NJ, USA), amplified by PCR and then cloned into lentiGuide-puro plasmid (a gift form Feng Zhang, Addgene 52963).

Article Title: Nuclear Control of Mitochondrial Homeostasis and Venetoclax Efficacy in AML via COX4I1.
Article Snippet: CRISPR and cDNA Molecular Cloning: Guide RNA oligonucleotides were synthesized either via microarray (CustomArray) for library cloning or individually (Integrated DNA Technologies) for single sgRNA constructs.

Article Title: CRISPRi screens reveal a DNA methylation-mediated 3D genome dependent causal mechanism in prostate cancer
Article Snippet: sgRNAs were synthesized as 73-mer oligonucleotides (CustomArray, USA), GAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATA GCAAGTTAAAATAAGGC (N’s denote the sgRNA 19–20 nucleotide target sequence) and amplified by PCR as a pool using the following primers: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG (Forward) and ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (Reverse).

Microarray:

Article Title: Serially deposited biomolecules
Article Snippet: .. The 12K CUSTOMARRAY® microarray is commercially available as a custom gene chip that has been used for a variety of genomic assays (e.g., genotyping, gene expression, SNP analysis, etc.). .. CombiMatrix also developed the ELECTRASENSE® microarray and microarray reader based on ECD.

Gene Expression:

Article Title: Serially deposited biomolecules
Article Snippet: .. The 12K CUSTOMARRAY® microarray is commercially available as a custom gene chip that has been used for a variety of genomic assays (e.g., genotyping, gene expression, SNP analysis, etc.). .. CombiMatrix also developed the ELECTRASENSE® microarray and microarray reader based on ECD.



Similar Products

90
CustomArray Inc 12k customarray microarray
12k Customarray Microarray, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/customarray%E2%84%A2+12k+microarray/microarray+surfaces/us12135323-57-1-2
Average 90 stars, based on 1 article reviews
12k customarray microarray - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CombiMatrix customarray​tm 12k microarray
Customarray​Tm 12k Microarray, supplied by CombiMatrix, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/customarray%E2%84%A2+12k+microarray/4x2k+custom+array/pmc04892815-85-0-13
Average 90 stars, based on 1 article reviews
customarray​tm 12k microarray - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CustomArray Inc customarray™ 12k microarrays
Customarray™ 12k Microarrays, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/customarray%E2%84%A2+12k+microarray/microarray+surfaces/pmc04892815-84-25-24
Average 90 stars, based on 1 article reviews
customarray™ 12k microarrays - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CustomArray Inc customarray 12k microarray
Customarray 12k Microarray, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/customarray%E2%84%A2+12k+microarray/microarray+surfaces/pmc03956118-263-24-23
Average 90 stars, based on 1 article reviews
customarray 12k microarray - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CombiMatrix custom-designed “customarray-12k-microarray” platform
Custom Designed “Customarray 12k Microarray” Platform, supplied by CombiMatrix, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/customarray%E2%84%A2+12k+microarray/4x2k+custom+array/10__3727_slash_096368912x658737-84-7-8
Average 90 stars, based on 1 article reviews
custom-designed “customarray-12k-microarray” platform - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CustomArray Inc oligonucleotide microarrays customarray 12k
Oligonucleotide Microarrays Customarray 12k, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/customarray%E2%84%A2+12k+microarray/microarray+surfaces/pm23306674-79-1-8
Average 90 stars, based on 1 article reviews
oligonucleotide microarrays customarray 12k - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CombiMatrix customarray 12k oligonucleotide microarrays
Customarray 12k Oligonucleotide Microarrays, supplied by CombiMatrix, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/customarray%E2%84%A2+12k+microarray/4x2k+custom+array/10__1128_slash_aem__03263___12-78-1-4
Average 90 stars, based on 1 article reviews
customarray 12k oligonucleotide microarrays - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CustomArray Inc customarray™ 12k microarray
Real-time PCR analysis of selected genes based on the <t> microarray </t> results
Customarray™ 12k Microarray, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/customarray%E2%84%A2+12k+microarray/microarray+surfaces/pmc03279671-34-14-13
Average 90 stars, based on 1 article reviews
customarray™ 12k microarray - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Journal: The Korean Journal of Parasitology

Article Title: Microarray Analysis of Differentially Expressed Genes between Cysts and Trophozoites of Acanthamoeba castellanii

doi: 10.3347/kjp.2011.49.4.341

Figure Lengend Snippet: Real-time PCR analysis of selected genes based on the microarray results

Article Snippet: Hybridization was performed with 5 µg of a labeled target sample per 1 CustomArray™ 12K microarray.

Techniques: Real-time Polymerase Chain Reaction, Microarray

Comparison of gene expression by microarray and KOG analysis. Cyst up-regulated genes showed higher percentages in A, D, T, W, U, O, and F articles. In J, C, and Z (cytoskeleton) articles, cyst genes were down-regulated.

Journal: The Korean Journal of Parasitology

Article Title: Microarray Analysis of Differentially Expressed Genes between Cysts and Trophozoites of Acanthamoeba castellanii

doi: 10.3347/kjp.2011.49.4.341

Figure Lengend Snippet: Comparison of gene expression by microarray and KOG analysis. Cyst up-regulated genes showed higher percentages in A, D, T, W, U, O, and F articles. In J, C, and Z (cytoskeleton) articles, cyst genes were down-regulated.

Article Snippet: Hybridization was performed with 5 µg of a labeled target sample per 1 CustomArray™ 12K microarray.

Techniques: Expressing, Microarray