algorithms graphpad prism version 9 5 1 graphpad (Tree Star Inc)
86
Structured Review
Tree Star Inc
algorithms graphpad prism version 9 5 1 graphpad
Algorithms Graphpad Prism Version 9 5 1 Graphpad, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/computer+software+program+graphpad+prism+version+9/flowjo10/pm42166330-192-5-19
Average 86 stars, based on 1 article reviews
Algorithms Graphpad Prism Version 9 5 1 Graphpad, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/computer+software+program+graphpad+prism+version+9/flowjo10/pm42166330-192-5-19
Average 86 stars, based on 1 article reviews
algorithms graphpad prism version 9 5 1 graphpad - by Bioz Stars,
2026-09
86/100 stars
Images
Related Articles
Software:Article Title: 5' UTR introns reduce nuclear transgene silencing and enable robust protein expression in Chlamydomonas reinhardtii. Article Snippet: .. This paper N/A Software and Article Title: Glutathione is critical for NK cell-mediated immunity. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and Article Title: Endothelial protein C receptor CD201 is a better marker than SCA1 to identify mouse long-term reconstituting hematopoietic stem cells following septic challenge Article Snippet: Samples were analyzed either on a Cytoflex (Beckman Coulter) flow cytometer equipped with 640nm, 561nm, 488nm, and 405nm lasers. .. Uncompensated FCS files were analyzed using Article Title: Endothelial protein C receptor CD201 is a better marker than SCA1 to identify mouse long-term reconstituting hematopoietic stem cells following septic challenge. Article Snippet: Stem cell antigen-1 (SCA1) is widely used to identify mouse hematopoietic stem cells (HSC) and multipotent progenitors (MPP) among lineage-negative KIT (LK) cells.. However, SCA1 is expressed only in a few inbred mouse strains and becomes strongly upregulated on LK cells following in vivo challenge with interferons, lipopolysaccharide (LPS) or pathogens leading to incorrect analysis of HSC function subsets and delineation of HSC, MPP and lineage-restricted progenitor subsets.. Endothelial protein C receptor CD201can be used as an alternative marker for mouse and even human HSC. Article Title: The mechanosensitive channel TRPV4 inhibits pulmonary inflammation by limiting NF-KB signaling in alveolar macrophages Article Snippet: Samples were run on a FACSymphony A1 (BD Biosciences) flow cytometer with standard configuration with 50,000 to 100,000 events acquired. .. Data was analyzed using Microscopy:Article Title: 5' UTR introns reduce nuclear transgene silencing and enable robust protein expression in Chlamydomonas reinhardtii. Article Snippet: .. This paper N/A Software and Flow Cytometry:Article Title: 5' UTR introns reduce nuclear transgene silencing and enable robust protein expression in Chlamydomonas reinhardtii. Article Snippet: .. This paper N/A Software and other:Article Title: Glehnia littoralis and imperatorin attenuate allergic airway inflammation via mast cell stabilization and transcriptome-defined suppression of FcεRI/TLR-MAPK/NF-κB signaling. Article Snippet: 20 Background: Allergic airway inflammation is driven by mast cell activation and IgE–FcεRI 21 signaling.. Current pharmacological treatments often present limited efficacy or long-term 22 adverse effects.. Glehnia littoralis Fr. Article Title: STING-OPTN signaling confers cytoprotection through TBK1-dependent mitophagy. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER YPH mito-keima Dr. Richard J. Youle N/A HEK293T stably expressing YFP-Parkin Dr. Han-Ming Shen N/A SH-SY5Y ATCC Cat#CRL-2266; RRID:CVCL_0019 Oligonucleotides siRNA targeting cGAS Purchased from Integrated DNA Technologies (IDT) Design ID: hs.Ri.MB21D1.13 siRNA targeting TBK1 Purchased from Integrated DNA Technologies (IDT) Design ID: hs.Ri.TBK1.13 siRNA targeting STING #1: AGCATTACAACAACCTGCT Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting STING #2: CGAACTTACAATCAGCATT Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting OPTN: CCACCAGCTGAAAGAAGCC Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting PINK1 Purchased from Invitrogen Cat#1299001 siRNA targeting sequence: VCP #1: CAGUGUUGCUGAAAGGAAAGA UUUCCUUUCAGCAACACUGUG Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting sequence: VCP #2: GCAGCUAGCUCAGAUCAAAGA UUUGAUCUGAGCUAGCUGCUU Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting sequence: VCP #3: GCAAGAAGAUGGAUCUCAUUG AUGAGAUCCAUCUUCUUGCGG Synthesized by Tsingke Biotechnology (Beijing, China) N/A Recombinant DNA lentiCRISPR v2 Dr. Feng Zhang Addgene plasmid # 52961; RRID:Addgene_52961 Lentiguide V2-sgcGAS Dr. James Chen N/A Lentiguide V2-sgSTING Dr. James Chen N/A Lentiguide V2-sgTBK1 Dr. James Chen N/A pCDNA4-TREX1-WT-3XFLAG This paper N/A pCDNA4-PINK1-WT-3XFLAG This paper N/A pCDNA4-PINK1-E240K-3XFLAG This paper N/A pCDNA4-PINK1-G309D-3XFLAG This paper N/A Parkin-WT-FLAG Dr. Liming Wang N/A Parkin-S65A-FLAG Dr. Liming Wang N/A OPTN-FLAG Dr. Qiming Sun N/A TBK1-FLAG Dr. Wei Wan N/A Software and |