global screening array 24 v 3 0 chip (Illumina Inc)
Illumina Inc is a verified supplier 
96
Structured Review
Illumina Inc
global screening array 24 v 3 0 chip
Global Screening Array 24 V 3 0 Chip, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 418 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+array+screening/Infinium+Global+Screening+Array-24+v3%2E0+Kit/pm40598669-51-12-18
Average 96 stars, based on 418 article reviews
Global Screening Array 24 V 3 0 Chip, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 418 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+array+screening/Infinium+Global+Screening+Array-24+v3%2E0+Kit/pm40598669-51-12-18
Average 96 stars, based on 418 article reviews
global screening array 24 v 3 0 chip - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Purification:Article Title: CRISPR-Cas9 genome editing in the parental iPSC line PCIi033-A to introduce the homozygous mutation p.F508del (c.1521_1523del) in the CFTR gene. Article Snippet: At least 50 metaphases per line were imaged using a Zeiss AxioImager Z2 and analyzed with Metafer 4 and Isis software. .. Genomic integrity QC with SNP array Genomic DNA was purified using the Monarch Genomic DNA Purification Kit (NEB) and hybridized on the Infinium DNA Purification:Article Title: CRISPR-Cas9 genome editing in the parental iPSC line PCIi033-A to introduce the homozygous mutation p.F508del (c.1521_1523del) in the CFTR gene. Article Snippet: At least 50 metaphases per line were imaged using a Zeiss AxioImager Z2 and analyzed with Metafer 4 and Isis software. .. Genomic integrity QC with SNP array Genomic DNA was purified using the Monarch Genomic DNA Purification Kit (NEB) and hybridized on the Infinium High Throughput Screening Assay:Article Title: Comparative GWAS using global and Indian Reference Panels reveals non-coding drivers of COVID-19 severity and mortality Article Snippet: .. Genotyping was performed using the Infinium HTS Assay:Article Title: Comparative GWAS using global and Indian Reference Panels reveals non-coding drivers of COVID-19 severity and mortality Article Snippet: .. Genotyping was performed using the Infinium Genome Wide:Article Title: Comparative GWAS using global and Indian Reference Panels reveals non-coding drivers of COVID-19 severity and mortality Article Snippet: .. Genotyping was performed using the Infinium Isolation:Article Title: Generation of iPSC lines from an ADHD patient (UKWi008-A, UKWi008-A-1) and a healthy control (UKWi009-A, UKWi009-A-1). Article Snippet: Antibodies used for immunocytochemistry Antibody Dilution Company Cat # RRID Pluripotency Markers Rabbit anti-OCT4 1:250 Invitrogen Cat# 710788 RRID: AB_2633097 Mouse anti-SSEA4 1:200 Invitrogen Cat# MA1-021 RRID: AB_528477 Mouse anti-TRA-1–60 1:100 Novus Cat# NB100–730 RRID: AB_10001809 Differentiation Markers Rabbit anti-TUBB3/TUJ1 1:500 Invitrogen Cat# A25532 RRID: AB_2814998 Mouse anti-AFP 1:700 Invitrogen Cat# MA1-19178 RRID: AB_1070198 Mouse anti-SMA 1:200 Invitrogen Cat# MA5-11547 RRID: AB_10979529 Secondary Antibodies Alexa Fluor 488 goat anti-mouse IgG3 1:500 Invitrogen Cat# A21151 RRID: AB_2535784 Alexa Fluor 488 goat anti-mouse IgM 1:500 Invitrogen Cat# A21042 RRID: AB_2535711 Alexa Fluor 488 goat anti-mouse IgG1 1:500 Invitrogen Cat# A21121 RRID: AB_2535764 Alexa Fluor 555 goat anti-mouse IgG2a 1:500 Invitrogen Cat# A21137 RRID: AB_2535776 Alexa Flour 594 donkey anti rabbit 1:500 Invitrogen Cat# R37119 RRID: AB_2556547 Alexa Fluor 647 donkey anti-rabbit 1:500 Invitrogen Cat# A31573 RRID: AB_2536183 Primers Target Size of band Forward/Reverse primer (5′-3′) Pluripotency Markers (RT-PCR) hSOX2 278 bp AACCAGCGCATGGACAGTTA/GACTTGACCACCGAACCCAT hNANOG 325 bp ACCAGTCCCAAAGGCAAACA/AAAGGCTGGGGTAGGTAGGT hOCT4 646 bp GTTGATCCTCGGACCTGGCTA/GGTTGCCTCTCACTCGGTTCT hDPPA5 215 bp CGGCTGCTGAAAGCCATTTT/AGTTTGAGCATCCCTCGCTC Sendai virus (SeV) detection (RT-PCR) SeV 181 bp GGATCACTAGGTGATATCGAGC/ACCAGACAAGAGTTTAAGAGATATGTATC c-MYC 532 bp TAACTGACTAGCAGGCTTGTCG/TCCACATACAGTCCTGGATGATGATG KOS 528 bp ATGCACCGCTACGACGTGAGCGC/ACCTTGACAATCCTGATGTGG KLF4 410 bp TTCCTGCATGCCAGAGGAGCCC/AATGTATCGAAGGTGCTCAA House-Keeping Genes (RT-PCR) hGAPDH 701 bp ATCACCATCTTCCAGGAGCGA/AAGTGGTCGTTGAGGGCAAT .. Genomic DNA was isolated (DNeasy Kit, Qiagen) and genotyped on the Infinium other:Article Title: Generation of a homozygous TET2 knock-out hiPSC line for modeling of cardiovascular diseases associated with clonal hematopoiesis of indeterminate potential (CHIP). Article Snippet: An Infinium Article Title: Generation and characterization of a human induced pluripotent stem cell line (hiPSC) expressing the rEstus voltage sensor under doxycycline induction. Article Snippet: To verify genetic variations, |
