Review



whole cell patch clamp recordings system  (Danaher Inc)


Bioz Verified Symbol Danaher Inc is a verified supplier
Bioz Manufacturer Symbol Danaher Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Danaher Inc whole cell patch clamp recordings system
    Whole Cell Patch Clamp Recordings System, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 99/100, based on 14016 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+patch+clamp+recordings/MultiClamp+700B+current+%26+patch+clamp+amplifier/pmc12373886-224-0-9
    Average 99 stars, based on 14016 article reviews
    whole cell patch clamp recordings system - by Bioz Stars, 2026-11
    99/100 stars

    Images

    Related Articles

    Patch Clamp:

    Article Title: Bipolar cell networks underlying steady-state intensity encoding in intrinsically photosensitive retinal ganglion cells
    Article Snippet: .. Whole-cell patch-clamp for current recordings in flat-mount retinas was performed as described, using a Multiclamp 700B amplifier, Digidata 1550 digitizer, and pClamp 10.5 data acquisition software (Molecular Devices; 10 kHz sampling). .. Pipettes pulled from thick-walled borosilicate capillaries (P-97; Sutter Instruments) had tip resistances of 5–6 MΩ when filled (in mM, 120 Cs-methanesulfonate, 5 NaCl, 4 CsCl, 2 EGTA, 10 HEPES, 4 ATP-mg, 7 Phosphocreatine-tris, and 0.3 GTP-tris, pH 7.3, 270–280 mOsm).

    Software:

    Article Title: Bipolar cell networks underlying steady-state intensity encoding in intrinsically photosensitive retinal ganglion cells
    Article Snippet: .. Whole-cell patch-clamp for current recordings in flat-mount retinas was performed as described, using a Multiclamp 700B amplifier, Digidata 1550 digitizer, and pClamp 10.5 data acquisition software (Molecular Devices; 10 kHz sampling). .. Pipettes pulled from thick-walled borosilicate capillaries (P-97; Sutter Instruments) had tip resistances of 5–6 MΩ when filled (in mM, 120 Cs-methanesulfonate, 5 NaCl, 4 CsCl, 2 EGTA, 10 HEPES, 4 ATP-mg, 7 Phosphocreatine-tris, and 0.3 GTP-tris, pH 7.3, 270–280 mOsm).

    Article Title: The Cullin3–Ring E3 ubiquitin ligase complex and USP14 regulate spastin-mediated microtubule severing and promotion of neurite outgrowth
    Article Snippet: .. Recordings were performed at room temperature in voltage clamp mode, at a holding potential of -70 mV, using a Multiclamp 700 B amplifier (Molecular Devices, Sunnyvale, CA, USA) and Clampex 10.5 software (Axon Instruments, Union City, CA, USA). .. The series resistance was below 30 MΩ, and data were acquired at 10 kHz and filtered at 1 kHz. mEPSCs were analyzed using MiniAnalysis software (Synaptosoft, Decatur, GA, USA).

    Sampling:

    Article Title: Bipolar cell networks underlying steady-state intensity encoding in intrinsically photosensitive retinal ganglion cells
    Article Snippet: .. Whole-cell patch-clamp for current recordings in flat-mount retinas was performed as described, using a Multiclamp 700B amplifier, Digidata 1550 digitizer, and pClamp 10.5 data acquisition software (Molecular Devices; 10 kHz sampling). .. Pipettes pulled from thick-walled borosilicate capillaries (P-97; Sutter Instruments) had tip resistances of 5–6 MΩ when filled (in mM, 120 Cs-methanesulfonate, 5 NaCl, 4 CsCl, 2 EGTA, 10 HEPES, 4 ATP-mg, 7 Phosphocreatine-tris, and 0.3 GTP-tris, pH 7.3, 270–280 mOsm).

    other:

    Article Title: Cingulate thrombospondin 4 protects against neuropathic pain and comorbid anxiodepression via interaction with EAAT2.
    Article Snippet: CTATGTCGTCGTCGCAGGCATC(R) Sangon N/A Bacterial and virus strains rAAV2/9-hSyn-mThbs4-3×FLAG-P2A-mCherry-WPREhGH polyA Braincase N/A rAAV2/9-hSyn-mThbs4-2A-EGFP-WPREs BrainVTA N/A rAAV2/9-hSyn-EGFP-WPREs Braincase N/A rAAV2/9-hSyn-mCherry-WPREs Braincase N/A rAAV2/9-CaMKIIα-GCaMP6s-WPREs-pA Braincase N/A rAAV-hSyn-iGluSnFR3.v857.GPI Braincase N/A rAAV2/9-CMV-mThbs4-3×FLAG-P2A Braincase N/A rAAV2/9-CMV-3×FLAG-P2A Braincase N/A Experimental models: Organisms/strains Mouse: C57BL/6J Fourth Military Medical University RRID: IMSR_JAX:000664 Experimental models: Cell lines HEK 293FT Invitrogen Cat# R70007; RRID: CVCL_6911 Critical commercial assays BCA protein assay kit Thermo Scientific Cat# 23225 Plasma membrane protein isolation and cell fractionation Invent Cat# SM-05 Glutamic acid colorimetric assay kit Elabscience Cat# E-BC-K903-M Deposited data RNA-Seq data Li et al.20 SRP323752 Software and algorithms SMART v.3.0 Panlab http://smart.embl.de/ Imaris software Bitplane http://www.bitplane.com/imaris/imaris Statistical Program for Social Sciences 21.0 SPSS http://www-01.ibm.com/software/ uk/analytics/spss/ Prism GraphPad https://www.graphpad.com/ Others Elevated mesh-bottom platform Danmic Global N/A Thermal sensitivity device IITC Life science RRID:SCR_012152 Applied Biosystems Real-time PCR system Thermofisher RRID:SCR_025855 FV3000 Confocal microscope Olympus RRID:SCR_017015 Stereotactic frame RWD Life Science Inc N/A 10 μL microsyringe Gaoge N/A Microsyringe pump Kd Scientific N/A 1200s Vibratome Leica RRID:SCR_018453 Dichroic mirror fiber photometry recording Thorlabs N/A Optical commutator for fiber photometry recording Doris Lenses N/A Low-pass filter for fiber photometry recording ThinkerTech N/A S-4800 Scanning electron microscope Hitachi RRID:SCR_020018 Axon700B amplifier Molecular Devices Corporation N/A 20 Cell Reports 45, 118112, October 27, 2026

    Activation Assay:

    Article Title: Prelimbic cortex to zona incerta pathway mediates recognition memory recovery delay through down-regulating astrocytic GAT-3
    Article Snippet: ZI sagittal slices (350 μm thickness) were cut with a vibrating slicer (Leica, VT1200S, Germany) under a continuous supply of oxygen mixture, and the ZI brain slices were incubated at 32°C in ACSF containing (in mM) 126 NaCl, 2.5 KCl, 1.25 NaH 2 PO 4 , 1.3 MgCl 2 , 2 CaCl 2 , 26 NaHCO 3 , and 10 glucose, pH (7.3, 300-305 mOsm / kg) at room temperature and incubated for 1 h. All reagents were purchased from Sigma Aldrich, USA. .. For chemogenetic activation or inhibition of ZI neurons, 10 mM CNO was applied during activity potential recording. membrane potentials were acquired with a MultiClamp 700B amplifier (Molecular Devices), filtered at 1 kHz, and sampled at 20 kHz with a Digidata 1440A interface and Clampex 10.2 (Molecular Devices). ..

    Inhibition:

    Article Title: Prelimbic cortex to zona incerta pathway mediates recognition memory recovery delay through down-regulating astrocytic GAT-3
    Article Snippet: ZI sagittal slices (350 μm thickness) were cut with a vibrating slicer (Leica, VT1200S, Germany) under a continuous supply of oxygen mixture, and the ZI brain slices were incubated at 32°C in ACSF containing (in mM) 126 NaCl, 2.5 KCl, 1.25 NaH 2 PO 4 , 1.3 MgCl 2 , 2 CaCl 2 , 26 NaHCO 3 , and 10 glucose, pH (7.3, 300-305 mOsm / kg) at room temperature and incubated for 1 h. All reagents were purchased from Sigma Aldrich, USA. .. For chemogenetic activation or inhibition of ZI neurons, 10 mM CNO was applied during activity potential recording. membrane potentials were acquired with a MultiClamp 700B amplifier (Molecular Devices), filtered at 1 kHz, and sampled at 20 kHz with a Digidata 1440A interface and Clampex 10.2 (Molecular Devices). ..

    Activity Assay:

    Article Title: Prelimbic cortex to zona incerta pathway mediates recognition memory recovery delay through down-regulating astrocytic GAT-3
    Article Snippet: ZI sagittal slices (350 μm thickness) were cut with a vibrating slicer (Leica, VT1200S, Germany) under a continuous supply of oxygen mixture, and the ZI brain slices were incubated at 32°C in ACSF containing (in mM) 126 NaCl, 2.5 KCl, 1.25 NaH 2 PO 4 , 1.3 MgCl 2 , 2 CaCl 2 , 26 NaHCO 3 , and 10 glucose, pH (7.3, 300-305 mOsm / kg) at room temperature and incubated for 1 h. All reagents were purchased from Sigma Aldrich, USA. .. For chemogenetic activation or inhibition of ZI neurons, 10 mM CNO was applied during activity potential recording. membrane potentials were acquired with a MultiClamp 700B amplifier (Molecular Devices), filtered at 1 kHz, and sampled at 20 kHz with a Digidata 1440A interface and Clampex 10.2 (Molecular Devices). ..

    Membrane:

    Article Title: Prelimbic cortex to zona incerta pathway mediates recognition memory recovery delay through down-regulating astrocytic GAT-3
    Article Snippet: ZI sagittal slices (350 μm thickness) were cut with a vibrating slicer (Leica, VT1200S, Germany) under a continuous supply of oxygen mixture, and the ZI brain slices were incubated at 32°C in ACSF containing (in mM) 126 NaCl, 2.5 KCl, 1.25 NaH 2 PO 4 , 1.3 MgCl 2 , 2 CaCl 2 , 26 NaHCO 3 , and 10 glucose, pH (7.3, 300-305 mOsm / kg) at room temperature and incubated for 1 h. All reagents were purchased from Sigma Aldrich, USA. .. For chemogenetic activation or inhibition of ZI neurons, 10 mM CNO was applied during activity potential recording. membrane potentials were acquired with a MultiClamp 700B amplifier (Molecular Devices), filtered at 1 kHz, and sampled at 20 kHz with a Digidata 1440A interface and Clampex 10.2 (Molecular Devices). ..



    Similar Products

    whole cell current clamp recordings  (Danaher Inc)
    97
    Danaher Inc whole cell current clamp recordings
    Whole Cell Current Clamp Recordings, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+patch+clamp+recordings/Axopatch+200B-2+capacitor+feedback+patch+clamp+amplifier/pm42875903-47-16-24
    Average 97 stars, based on 1 article reviews
    whole cell current clamp recordings - by Bioz Stars, 2026-11
    97/100 stars
    		  Buy from Supplier
    cell patch clamp recordings  (World Precision Instruments)
    96
    World Precision Instruments cell patch clamp recordings
    A) Schematic depicting JONs projecting through the antennal nerve and synapsing onto APN2 cells (gold dashed box) in the ipsilateral hemisphere of the central brain. Inset shows expression pattern of the genetic driver line labeling APN2 ( 24C06-GAL4) . Scale bar is 20 µm. B) During whole <t>cell</t> <t>patch</t> <t>clamp</t> <t>recordings,</t> antennal movements were recorded by a lateral camera and flight activity was monitored using an optical wingbeat detector. C) Example video frame with 2 tracked points and the relative direction of antenna angle deflections. Deflections down towards the head are represented as negative values, and deflections up and away from the head as positive values. D) Example single-trial traces showing antennal and APN2 activity during quiescence (left) and flight (right). Wing movement was detected using an infrared light sensor. E) Each dot is the average response of one APN2 cell. Black bars indicate the average across APN2 cells for each condition, with respective SEM error bars. Grey dashed lines pair measurements from the same cell during flight and quiescence. Across flies, the average APN2 membrane potential is reduced during bouts of flight compared to quiescence, both when the antennae are free (paired t-test; p = 0.037) and when the antennae are glued (Wilcoxon Signed-Rank Test; p = 0.014).
    Cell Patch Clamp Recordings, supplied by World Precision Instruments, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+patch+clamp+recordings/Standard+Glass+Capillaries-1B150F-6/bio_rxiv__64898__2026__04__16__718965-189-14-9
    Average 96 stars, based on 1 article reviews
    cell patch clamp recordings - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    whole cell patch clamp recordings  (Nikon)
    97
    Nikon whole cell patch clamp recordings
    A) Schematic depicting JONs projecting through the antennal nerve and synapsing onto APN2 cells (gold dashed box) in the ipsilateral hemisphere of the central brain. Inset shows expression pattern of the genetic driver line labeling APN2 ( 24C06-GAL4) . Scale bar is 20 µm. B) During whole <t>cell</t> <t>patch</t> <t>clamp</t> <t>recordings,</t> antennal movements were recorded by a lateral camera and flight activity was monitored using an optical wingbeat detector. C) Example video frame with 2 tracked points and the relative direction of antenna angle deflections. Deflections down towards the head are represented as negative values, and deflections up and away from the head as positive values. D) Example single-trial traces showing antennal and APN2 activity during quiescence (left) and flight (right). Wing movement was detected using an infrared light sensor. E) Each dot is the average response of one APN2 cell. Black bars indicate the average across APN2 cells for each condition, with respective SEM error bars. Grey dashed lines pair measurements from the same cell during flight and quiescence. Across flies, the average APN2 membrane potential is reduced during bouts of flight compared to quiescence, both when the antennae are free (paired t-test; p = 0.037) and when the antennae are glued (Wilcoxon Signed-Rank Test; p = 0.014).
    Whole Cell Patch Clamp Recordings, supplied by Nikon, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+patch+clamp+recordings/ECLIPSE+FN1/pm41844648-569-0-11
    Average 97 stars, based on 1 article reviews
    whole cell patch clamp recordings - by Bioz Stars, 2026-11
    97/100 stars
    		  Buy from Supplier
    cell patch clamp recordings  (Jackson Laboratory)
    86
    Jackson Laboratory cell patch clamp recordings
    A) Schematic depicting JONs projecting through the antennal nerve and synapsing onto APN2 cells (gold dashed box) in the ipsilateral hemisphere of the central brain. Inset shows expression pattern of the genetic driver line labeling APN2 ( 24C06-GAL4) . Scale bar is 20 µm. B) During whole <t>cell</t> <t>patch</t> <t>clamp</t> <t>recordings,</t> antennal movements were recorded by a lateral camera and flight activity was monitored using an optical wingbeat detector. C) Example video frame with 2 tracked points and the relative direction of antenna angle deflections. Deflections down towards the head are represented as negative values, and deflections up and away from the head as positive values. D) Example single-trial traces showing antennal and APN2 activity during quiescence (left) and flight (right). Wing movement was detected using an infrared light sensor. E) Each dot is the average response of one APN2 cell. Black bars indicate the average across APN2 cells for each condition, with respective SEM error bars. Grey dashed lines pair measurements from the same cell during flight and quiescence. Across flies, the average APN2 membrane potential is reduced during bouts of flight compared to quiescence, both when the antennae are free (paired t-test; p = 0.037) and when the antennae are glued (Wilcoxon Signed-Rank Test; p = 0.014).
    Cell Patch Clamp Recordings, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+patch+clamp+recordings/cell+clamp+patch+recordings+whole/pm41687612-167-1-11
    Average 86 stars, based on 1 article reviews
    cell patch clamp recordings - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    axopatch amplifier  (AutoMate Scientific Inc)
    97
    AutoMate Scientific Inc axopatch amplifier
    A) Schematic depicting JONs projecting through the antennal nerve and synapsing onto APN2 cells (gold dashed box) in the ipsilateral hemisphere of the central brain. Inset shows expression pattern of the genetic driver line labeling APN2 ( 24C06-GAL4) . Scale bar is 20 µm. B) During whole <t>cell</t> <t>patch</t> <t>clamp</t> <t>recordings,</t> antennal movements were recorded by a lateral camera and flight activity was monitored using an optical wingbeat detector. C) Example video frame with 2 tracked points and the relative direction of antenna angle deflections. Deflections down towards the head are represented as negative values, and deflections up and away from the head as positive values. D) Example single-trial traces showing antennal and APN2 activity during quiescence (left) and flight (right). Wing movement was detected using an infrared light sensor. E) Each dot is the average response of one APN2 cell. Black bars indicate the average across APN2 cells for each condition, with respective SEM error bars. Grey dashed lines pair measurements from the same cell during flight and quiescence. Across flies, the average APN2 membrane potential is reduced during bouts of flight compared to quiescence, both when the antennae are free (paired t-test; p = 0.037) and when the antennae are glued (Wilcoxon Signed-Rank Test; p = 0.014).
    Axopatch Amplifier, supplied by AutoMate Scientific Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+patch+clamp+recordings/Axopatch+Amplifier/custom%40axopatch_200b_2%4010%2E1172%2Fjci196705
    Average 97 stars, based on 1 article reviews
    axopatch amplifier - by Bioz Stars, 2026-11
    97/100 stars
    		  Buy from Supplier
    whole cell recording  (Danaher Inc)
    99
    Danaher Inc whole cell recording
    A) Schematic depicting JONs projecting through the antennal nerve and synapsing onto APN2 cells (gold dashed box) in the ipsilateral hemisphere of the central brain. Inset shows expression pattern of the genetic driver line labeling APN2 ( 24C06-GAL4) . Scale bar is 20 µm. B) During whole <t>cell</t> <t>patch</t> <t>clamp</t> <t>recordings,</t> antennal movements were recorded by a lateral camera and flight activity was monitored using an optical wingbeat detector. C) Example video frame with 2 tracked points and the relative direction of antenna angle deflections. Deflections down towards the head are represented as negative values, and deflections up and away from the head as positive values. D) Example single-trial traces showing antennal and APN2 activity during quiescence (left) and flight (right). Wing movement was detected using an infrared light sensor. E) Each dot is the average response of one APN2 cell. Black bars indicate the average across APN2 cells for each condition, with respective SEM error bars. Grey dashed lines pair measurements from the same cell during flight and quiescence. Across flies, the average APN2 membrane potential is reduced during bouts of flight compared to quiescence, both when the antennae are free (paired t-test; p = 0.037) and when the antennae are glued (Wilcoxon Signed-Rank Test; p = 0.014).
    Whole Cell Recording, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+patch+clamp+recordings/MultiClamp+700B+current+%26+patch+clamp+amplifier/pmc12766208-112-0-9
    Average 99 stars, based on 1 article reviews
    whole cell recording - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    whole cell patch clamp recordings system  (Danaher Inc)
    99
    Danaher Inc whole cell patch clamp recordings system
    A) Schematic depicting JONs projecting through the antennal nerve and synapsing onto APN2 cells (gold dashed box) in the ipsilateral hemisphere of the central brain. Inset shows expression pattern of the genetic driver line labeling APN2 ( 24C06-GAL4) . Scale bar is 20 µm. B) During whole <t>cell</t> <t>patch</t> <t>clamp</t> <t>recordings,</t> antennal movements were recorded by a lateral camera and flight activity was monitored using an optical wingbeat detector. C) Example video frame with 2 tracked points and the relative direction of antenna angle deflections. Deflections down towards the head are represented as negative values, and deflections up and away from the head as positive values. D) Example single-trial traces showing antennal and APN2 activity during quiescence (left) and flight (right). Wing movement was detected using an infrared light sensor. E) Each dot is the average response of one APN2 cell. Black bars indicate the average across APN2 cells for each condition, with respective SEM error bars. Grey dashed lines pair measurements from the same cell during flight and quiescence. Across flies, the average APN2 membrane potential is reduced during bouts of flight compared to quiescence, both when the antennae are free (paired t-test; p = 0.037) and when the antennae are glued (Wilcoxon Signed-Rank Test; p = 0.014).
    Whole Cell Patch Clamp Recordings System, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+patch+clamp+recordings/MultiClamp+700B+current+%26+patch+clamp+amplifier/pmc12373886-224-0-9
    Average 99 stars, based on 1 article reviews
    whole cell patch clamp recordings system - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    whole-cell patch-clamp recordings (wcrs)  (Charles River Laboratories)
    90
    Charles River Laboratories whole-cell patch-clamp recordings (wcrs)
    A) Schematic depicting JONs projecting through the antennal nerve and synapsing onto APN2 cells (gold dashed box) in the ipsilateral hemisphere of the central brain. Inset shows expression pattern of the genetic driver line labeling APN2 ( 24C06-GAL4) . Scale bar is 20 µm. B) During whole <t>cell</t> <t>patch</t> <t>clamp</t> <t>recordings,</t> antennal movements were recorded by a lateral camera and flight activity was monitored using an optical wingbeat detector. C) Example video frame with 2 tracked points and the relative direction of antenna angle deflections. Deflections down towards the head are represented as negative values, and deflections up and away from the head as positive values. D) Example single-trial traces showing antennal and APN2 activity during quiescence (left) and flight (right). Wing movement was detected using an infrared light sensor. E) Each dot is the average response of one APN2 cell. Black bars indicate the average across APN2 cells for each condition, with respective SEM error bars. Grey dashed lines pair measurements from the same cell during flight and quiescence. Across flies, the average APN2 membrane potential is reduced during bouts of flight compared to quiescence, both when the antennae are free (paired t-test; p = 0.037) and when the antennae are glued (Wilcoxon Signed-Rank Test; p = 0.014).
    Whole Cell Patch Clamp Recordings (Wcrs), supplied by Charles River Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+patch+clamp+recordings/herg+assay/pm40652073-47-0-28
    Average 90 stars, based on 1 article reviews
    whole-cell patch-clamp recordings (wcrs) - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    A) Schematic depicting JONs projecting through the antennal nerve and synapsing onto APN2 cells (gold dashed box) in the ipsilateral hemisphere of the central brain. Inset shows expression pattern of the genetic driver line labeling APN2 ( 24C06-GAL4) . Scale bar is 20 µm. B) During whole cell patch clamp recordings, antennal movements were recorded by a lateral camera and flight activity was monitored using an optical wingbeat detector. C) Example video frame with 2 tracked points and the relative direction of antenna angle deflections. Deflections down towards the head are represented as negative values, and deflections up and away from the head as positive values. D) Example single-trial traces showing antennal and APN2 activity during quiescence (left) and flight (right). Wing movement was detected using an infrared light sensor. E) Each dot is the average response of one APN2 cell. Black bars indicate the average across APN2 cells for each condition, with respective SEM error bars. Grey dashed lines pair measurements from the same cell during flight and quiescence. Across flies, the average APN2 membrane potential is reduced during bouts of flight compared to quiescence, both when the antennae are free (paired t-test; p = 0.037) and when the antennae are glued (Wilcoxon Signed-Rank Test; p = 0.014).

    Journal: bioRxiv

    Article Title: Sensory-motor integration in a nonspiking interneuron contributes to active sensor control in Drosophila

    doi: 10.64898/2026.04.16.718965

    Figure Lengend Snippet: A) Schematic depicting JONs projecting through the antennal nerve and synapsing onto APN2 cells (gold dashed box) in the ipsilateral hemisphere of the central brain. Inset shows expression pattern of the genetic driver line labeling APN2 ( 24C06-GAL4) . Scale bar is 20 µm. B) During whole cell patch clamp recordings, antennal movements were recorded by a lateral camera and flight activity was monitored using an optical wingbeat detector. C) Example video frame with 2 tracked points and the relative direction of antenna angle deflections. Deflections down towards the head are represented as negative values, and deflections up and away from the head as positive values. D) Example single-trial traces showing antennal and APN2 activity during quiescence (left) and flight (right). Wing movement was detected using an infrared light sensor. E) Each dot is the average response of one APN2 cell. Black bars indicate the average across APN2 cells for each condition, with respective SEM error bars. Grey dashed lines pair measurements from the same cell during flight and quiescence. Across flies, the average APN2 membrane potential is reduced during bouts of flight compared to quiescence, both when the antennae are free (paired t-test; p = 0.037) and when the antennae are glued (Wilcoxon Signed-Rank Test; p = 0.014).

    Article Snippet: We used 6-11 MΩ thick-walled glass pipettes (Item #1B150F-3, World Precision Instruments) for whole cell patch clamp recordings, which we pulled using a Sutter P-1000 puller.

    Techniques: Expressing, Labeling, Patch Clamp, Activity Assay, Membrane