Derivative Assay:Article Title: Probiotic interventions to reduce antepartum Group B streptococcus colonization: A systematic review and meta-analysis
Article Snippet: .. 3 GBS strains: • derived from vaginal & peri-rectal swabs • L. crispatus (BC1, BC4, BC7, and BC8) cells or supernatants totally eradicated GBS in 60 minutes • L. crispatus BC6, L. gasseri (BC9, BC12-BC14) cells or supernatants inhibited GBS growth in 60 minutes • L. crispatus (BC3, BC5), L. gasseri (BC10), L. vaginalis (BC16, BC17) cells or supernatants had no activity against GBS or ↓ GBS viability in 60 minutes Acidification • pH<4.0 • pH <4.0-4.5 • pH≥4.5 ( Martiń et al., 2019 ) 10 Lactobacillus salivarius strains (V3III-1, CECT 9145, V711-1, V711-62, V7IV-1; V7IV-60, V8III-62, V11I-60, V11IV-60, CELA2) 4 GBS strains: • from vaginal exudates • L salivarius CECT 9145 cells showed best adherence to VEC, and was selected as most effective with 100% GBS eradication in 24 hours Acidification: pH=4.01 (High lactic acid and hydrogen peroxide) Adherence Patras et al., 2015 9 Streptococcus salivarius strains (K12, M18, Tove R, NR, 20P3, #5, MPS, P, CCHSS3) 13 GBS strains: • ATCC • vaginally-derived • S. salivarius K12 and Tove R inhibited all 13 GBS strains (K12 was most effective) • S. salivarius K12 had good adherence to VEC. ..
Article Title: Probiotic interventions to reduce antepartum Group B streptococcus colonization: A systematic review and meta-analysis
Article Snippet: .. 3 • derived from vaginal and peri-rectal swabs • L. crispatus (BC1, BC4, BC7, and BC8) cells or supernatants totally eradicated GBS in 60 minutes • L. crispatus BC6, L. gasseri (BC9, BC12-BC14) cells or supernatants inhibited GBS growth in 60 minutes • L. crispatus (BC3, BC5), L. gasseri (BC10), L. vaginalis (BC16, BC17) cells or supernatants had no activity against GBS or ↓ GBS viability in 60 minutes Acidification pH<4.0 pH<4.0-4.5 pH≥4.5 ( Martiń et al., 2019 ) 10 Lactobacillus salivarius strains: (V3III-1, CECT 9145, V711-1, V711-62, V7IV-1; V7IV-60, V8III-62, V11I-60, V11IV-60, CELA2) 4 • from vaginal exudates L salivarius CECT 9145 cells showed best adherence to VEC and was selected as most effective with 100% GBS eradication in 24 hours AdherenceAcidification • pH=4.01 (High lactic acid and hydrogen peroxide) Patras et al., 2015 9 Streptococcus salivarius strains: (K12, M18, Tove R, NR, 20P3, #5, MPS, P, CCHSS3) 13 • ATCC • vaginally-dervied • S. salivarius K12 and Tove R inhibited all 13 GBS strains (K12 was most effective) • S. salivarius K12 had good adherence to VEC. ..
Article Title: Systematic characterization of regulatory variants of blood pressure genes
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal Anti-Cardiac Troponin T antibody Abcam Cat#ab10214; RRID:AB_2206574 Bacterial and virus strains NEB 5-alpha Competent E.coli (High Efficiency) NEB Cat#C2987H Chemicals, peptides, and recombinant proteins STEMdiff CM Differentiation Kit STEMCELL Technologies Cat#05010 SfiI NEB Cat#R0123L Alkaline Phosphatase, Calf Intest NEB Cat#M0290L T4 DNA Ligase NEB Cat#M0202M XbaI NEB Cat#R0145L KpnI-HF NEB Cat#R3142L Q5- High Fidelity DNA polymerase NEB Cat#M0491L Formamide (Deionized) Invitrogen Cat#AM9342 Agencourt AMPure XP Beckman Coulter Cat#A63881 Trizol Reagent Life Technologies Cat#15596018 RNase-Free DNase set Qiagen Cat#79254 DNaseI recombinant Worthington Biochemical Cat#LS006355 T4 Polynucleotide Kinase NEB Cat#M0201L SacI-HF NEB Cat#R3156L Lipofectamine 3000 Invitrogen Cat#L3000008 Lipofectamine Stem Transfection Reagent Invitrogen Cat#STEM00015 Recombinant Human EGF Protein, CF R&D Systems Cat#236-EG-200 L-Alanyl-L-Glutamine ThermoFisher Scientific Cat#J66996.14 Geneticin Life Technologies Cat#G418 TGF-b1 R&D Systems Cat#240-B-002 GeneXPlus Transfection Reagent ATCC Cat#ACS-4004 16% Formaldehyde (W/V) Methanol-free ThermoFisher Scientific Cat#28906 5M NaCl Invitrogen Cat#AM9759 1M Tris pH8.0 Invitrogen Cat#AM9856 Tween-20 Sigma-Aldrich Cat#P9416 BsaI HF-v2 NEB Cat#R3733S BsmBI NEB Cat#R0739S Puromycin Dihydrochloride Gibco Cat#A1113803 Thermo Scientifi Phusion Hot Start II High-Fidelity PCR Master Mix Thermo Scientific Cat#F565L DirectPCR Lysis Reagent Viagen Cat#301-C OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer NEB Cat#M0488L PowerUpTM SYBRTM Green Master Mix ABI A25742 Critical commercial assays Micellula DNA Emulsion & Purification Kit Chimerx Cat#3600-02 QIAGEN Plasmid Plus Maxi Kit Qiagen Cat#12965 dsDNA Quantitation, High Sensitivity ThermoFisher Scientific Cat#Q32851 RNeasy Mini Kit Qiagen Cat#74104 (Continued on next page) Cell Genomics 3, 100330, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript III 1st Strand Synthesis Invitrogen Cat#18080051 Gibson Assembly Master Mix - 10 rxns NEB Cat#E2611S Quick Ligation Kit NEB Cat#M2200L Dual-Luciferase Reporter Assay System Promega Cat#E1910 DNeasy Blood and Tissue kit Qiagen Cat#69506 Monarch PCR & DNA Cleanup Kit NEB Cat#T1030L TruSeq Stranded Total RNA Ribo-Zero Gold Illumina Cat#RS-122-2301 Deposited data MPRA and RNAseq data upon CRISPR prime editing This paper GSE213558 Omni-C data This paper GSE217358 Experimental models: Cell lines Human: HEK-293 ATCC Cat#CRL-1573 Human: hTERT-immortalized adipose derived primary human mesenchymal stem cells ATCC Cat#SCRC4000 Human: PGPC-17 human iPS cells Hildebrandt et al., 2019106 N/A Oligonucleotides ePCR forward primer: GCTAAGGGCCTAAC TGGCCGCTTCACTG Mattioli et al.21 N/A ePCR reverse primer: GTTTAAGGCCTCCG AGGCCGACGCTCTTC Mattioli et al.21 N/A cloning step 1, universal 3’ primer: AATGAT ACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning step 1, universal 5’ primer: caagcagaa gacggcatacgagatCGTGATgtgactggagttcagacg tgtgctcttccgatctACTGGCCGCTTCACTG Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 3’ primer: AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 5’ primer: caagcagaagacggcatacgagatCGTGATgtgac tggagttcagacgtgtgctcttccgatctCGCCGCGTGGAG GAGGA Mattioli et al.21 N/A Oligonucleotide pool, see Table S1 This paper N/A pegRNA/gRNAs, see Table S19 This paper N/A qPCR primers, see Table S24 This paper N/A Recombinant DNA pGL4.29 Promega Cat#E8471 pRL-TK Promega Cat#E2241 MPRA_backbone_empty_pGL4-2.3_cloning_ site_polyA Mattioli et al.21 N/A pCMV-PE2 Anzalone et al.88 Addgene Cat#132775 pU6-gg acceptor Anzalone et al.88 Addgene Cat#132777 BPK1520_puroR Erwood et al.107 Addgene Cat#173901 Software and algorithms rAggr N/A https://web.archive.org/web/20160 416223424/http://raggr.usc.edu/ HaploView N/A http://www.broad.mit.edu/mpg/haploview MPRAnalyze Ashuach et al.108 https://bioconductor.org/packages/ release/bioc/html/MPRAnalyze.html (Continued on next page) e2 Cell Genomics 3, 100330, July 12, 2023 Resource ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BEDTools Quinlan and Hall109 https://code.google.com/archive/p/ bedtools/ R version v4.0.2 https://www.r-project.org/ Ensembl Variant Effect Predictor Tool McLaren et al.110 https://github.com/Ensembl/ensembl- tools/archive/release/83.zip PhyloP Pollard et al.111 http://compgen.cshl.edu/phast/ PastCons Siepel et al.55 http://compgen.cshl.edu/phast/downloads.php ColocQuial Chen et al.45 https://github.com/bvoightlab/ColocQuiaL COLOC package Giambartolomei et al.27 https://github.com/bvoightlab/ColocQuiaL FIMO Bailey et al.112 https://meme-suite.org/meme/doc/fimo.html Python Statsmodels package Seabold et al.113 https://www.statsmodels.org/stable/index.html Hisat2 Kim et al.114 http://daehwankimlab.github.io/hisat2/ FeatureCounts Liao et al.115 https://subread.sourceforge.net/ DESeq2 Love et al.116 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html Metascape Zhou et al.117 https://metascape.org/gp/index.html#/ main/step1 WebGestalt Liao et al.118 http://www.webgestalt.org/ Hi-C Processing Protocol 4D Nucleome Project https://data.4dnucleome.org/resources/ data-analysis/hi_c-processing-pipeline# overview Samtools version 1.5 Li et al.119 https://samtools.sourceforge.net/ Pairx version 0.3.7 N/A https://github.com/4dn-dcic/pairix Pairtools version 0.3.0 N/A https://github.com/open2c/pairtools Cooler version 0.8.11 Abdennur and Mirny120 https://github.com/mirnylab/cooler RepeatMasker Open-4.0 Smit, AFA, Hubley, R & Green, P http://www.repeatmasker.org Sushi package v1.32.0 R v4.0.2 https://bioconductor.org/packages/3.14/ bioc/html/Sushi.html DeepPE Kim et al.121 http://deepcrispr.info/DeepPE/ EditR Kluesner et al.122 http://baseeditr.com/ GraphPad Prism v 9.3.0 9.3.0 https://www.graphpad.com/ scientific-software/prism/ R v4.1.2 4.1.2 https://www.r-project.org/ Python v3.8.10 3.8.10 https://www.python.org/downloads/ Cutadapt Martin123 https://cutadapt.readthedocs.io/en/stable/ Resource ll OPEN ACCESS
Activity Assay:Article Title: Probiotic interventions to reduce antepartum Group B streptococcus colonization: A systematic review and meta-analysis
Article Snippet: .. 3 GBS strains: • derived from vaginal & peri-rectal swabs • L. crispatus (BC1, BC4, BC7, and BC8) cells or supernatants totally eradicated GBS in 60 minutes • L. crispatus BC6, L. gasseri (BC9, BC12-BC14) cells or supernatants inhibited GBS growth in 60 minutes • L. crispatus (BC3, BC5), L. gasseri (BC10), L. vaginalis (BC16, BC17) cells or supernatants had no activity against GBS or ↓ GBS viability in 60 minutes Acidification • pH<4.0 • pH <4.0-4.5 • pH≥4.5 ( Martiń et al., 2019 ) 10 Lactobacillus salivarius strains (V3III-1, CECT 9145, V711-1, V711-62, V7IV-1; V7IV-60, V8III-62, V11I-60, V11IV-60, CELA2) 4 GBS strains: • from vaginal exudates • L salivarius CECT 9145 cells showed best adherence to VEC, and was selected as most effective with 100% GBS eradication in 24 hours Acidification: pH=4.01 (High lactic acid and hydrogen peroxide) Adherence Patras et al., 2015 9 Streptococcus salivarius strains (K12, M18, Tove R, NR, 20P3, #5, MPS, P, CCHSS3) 13 GBS strains: • ATCC • vaginally-derived • S. salivarius K12 and Tove R inhibited all 13 GBS strains (K12 was most effective) • S. salivarius K12 had good adherence to VEC. ..
Article Title: Probiotic interventions to reduce antepartum Group B streptococcus colonization: A systematic review and meta-analysis
Article Snippet: .. 3 • derived from vaginal and peri-rectal swabs • L. crispatus (BC1, BC4, BC7, and BC8) cells or supernatants totally eradicated GBS in 60 minutes • L. crispatus BC6, L. gasseri (BC9, BC12-BC14) cells or supernatants inhibited GBS growth in 60 minutes • L. crispatus (BC3, BC5), L. gasseri (BC10), L. vaginalis (BC16, BC17) cells or supernatants had no activity against GBS or ↓ GBS viability in 60 minutes Acidification pH<4.0 pH<4.0-4.5 pH≥4.5 ( Martiń et al., 2019 ) 10 Lactobacillus salivarius strains: (V3III-1, CECT 9145, V711-1, V711-62, V7IV-1; V7IV-60, V8III-62, V11I-60, V11IV-60, CELA2) 4 • from vaginal exudates L salivarius CECT 9145 cells showed best adherence to VEC and was selected as most effective with 100% GBS eradication in 24 hours AdherenceAcidification • pH=4.01 (High lactic acid and hydrogen peroxide) Patras et al., 2015 9 Streptococcus salivarius strains: (K12, M18, Tove R, NR, 20P3, #5, MPS, P, CCHSS3) 13 • ATCC • vaginally-dervied • S. salivarius K12 and Tove R inhibited all 13 GBS strains (K12 was most effective) • S. salivarius K12 had good adherence to VEC. ..
Staining:Article Title: Applications of 3D models in cholangiocarcinoma
Article Snippet: / Matrigel Liver and bile duct biopsies of choledochal cysts RNA sequencing Nakagawa et al. 2017 10.1073/pnas.1619416114 24 Ad-DMEM/F12 (Invitrogen) supplemented with B27 and N2, 1 mM N-acetylcysteine, 10 mM nicotinamide (Wako), 50 ng/mL EGF, 1 μg/mL Rspo1, 100 ng/mL Noggin, 100 ng/mL FGF10 (Peprotech), and 10% Wnt3a-conditioned medium (ATCC). .. / Matrigel Murine extrahepatic bile duct tissue Histological staining, western blot, PCR, Tumorigeneity through xenografting, cDNA microarray analysis Razumilava et al. 2019 10.1002/hep4.1295 / 50% L‐WRN (CRL‐3276; ATCC, Manassas, VA) conditioned media,30 1X penicillin– streptomycin, 1X GlutaMAX, 10 mM 4‐(2‐ hydroxyethyl)‐1‐piperazine ethanesulfonic acid, 1X Fungizone, 1X gentamicin, 1X B27, and 1X N2 (Thermo Fisher Scientific) in advanced Dulbecco’s modified Eagle’s medium/F12 (Invitrogen, Carlsbad, CA). .. Fibroblast growth factor 10 (100 ng/mL; PeproTech, Rocky Hill, NJ) and epithelial growth factor (50 ng/mL; Invitrogen) were added to the culture media for the first 3 days.
Western Blot:Article Title: Applications of 3D models in cholangiocarcinoma
Article Snippet: / Matrigel Liver and bile duct biopsies of choledochal cysts RNA sequencing Nakagawa et al. 2017 10.1073/pnas.1619416114 24 Ad-DMEM/F12 (Invitrogen) supplemented with B27 and N2, 1 mM N-acetylcysteine, 10 mM nicotinamide (Wako), 50 ng/mL EGF, 1 μg/mL Rspo1, 100 ng/mL Noggin, 100 ng/mL FGF10 (Peprotech), and 10% Wnt3a-conditioned medium (ATCC). .. / Matrigel Murine extrahepatic bile duct tissue Histological staining, western blot, PCR, Tumorigeneity through xenografting, cDNA microarray analysis Razumilava et al. 2019 10.1002/hep4.1295 / 50% L‐WRN (CRL‐3276; ATCC, Manassas, VA) conditioned media,30 1X penicillin– streptomycin, 1X GlutaMAX, 10 mM 4‐(2‐ hydroxyethyl)‐1‐piperazine ethanesulfonic acid, 1X Fungizone, 1X gentamicin, 1X B27, and 1X N2 (Thermo Fisher Scientific) in advanced Dulbecco’s modified Eagle’s medium/F12 (Invitrogen, Carlsbad, CA). .. Fibroblast growth factor 10 (100 ng/mL; PeproTech, Rocky Hill, NJ) and epithelial growth factor (50 ng/mL; Invitrogen) were added to the culture media for the first 3 days.
Polymerase Chain Reaction:Article Title: Applications of 3D models in cholangiocarcinoma
Article Snippet: / Matrigel Liver and bile duct biopsies of choledochal cysts RNA sequencing Nakagawa et al. 2017 10.1073/pnas.1619416114 24 Ad-DMEM/F12 (Invitrogen) supplemented with B27 and N2, 1 mM N-acetylcysteine, 10 mM nicotinamide (Wako), 50 ng/mL EGF, 1 μg/mL Rspo1, 100 ng/mL Noggin, 100 ng/mL FGF10 (Peprotech), and 10% Wnt3a-conditioned medium (ATCC). .. / Matrigel Murine extrahepatic bile duct tissue Histological staining, western blot, PCR, Tumorigeneity through xenografting, cDNA microarray analysis Razumilava et al. 2019 10.1002/hep4.1295 / 50% L‐WRN (CRL‐3276; ATCC, Manassas, VA) conditioned media,30 1X penicillin– streptomycin, 1X GlutaMAX, 10 mM 4‐(2‐ hydroxyethyl)‐1‐piperazine ethanesulfonic acid, 1X Fungizone, 1X gentamicin, 1X B27, and 1X N2 (Thermo Fisher Scientific) in advanced Dulbecco’s modified Eagle’s medium/F12 (Invitrogen, Carlsbad, CA). .. Fibroblast growth factor 10 (100 ng/mL; PeproTech, Rocky Hill, NJ) and epithelial growth factor (50 ng/mL; Invitrogen) were added to the culture media for the first 3 days.
Article Title: Systematic characterization of regulatory variants of blood pressure genes
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal Anti-Cardiac Troponin T antibody Abcam Cat#ab10214; RRID:AB_2206574 Bacterial and virus strains NEB 5-alpha Competent E.coli (High Efficiency) NEB Cat#C2987H Chemicals, peptides, and recombinant proteins STEMdiff CM Differentiation Kit STEMCELL Technologies Cat#05010 SfiI NEB Cat#R0123L Alkaline Phosphatase, Calf Intest NEB Cat#M0290L T4 DNA Ligase NEB Cat#M0202M XbaI NEB Cat#R0145L KpnI-HF NEB Cat#R3142L Q5- High Fidelity DNA polymerase NEB Cat#M0491L Formamide (Deionized) Invitrogen Cat#AM9342 Agencourt AMPure XP Beckman Coulter Cat#A63881 Trizol Reagent Life Technologies Cat#15596018 RNase-Free DNase set Qiagen Cat#79254 DNaseI recombinant Worthington Biochemical Cat#LS006355 T4 Polynucleotide Kinase NEB Cat#M0201L SacI-HF NEB Cat#R3156L Lipofectamine 3000 Invitrogen Cat#L3000008 Lipofectamine Stem Transfection Reagent Invitrogen Cat#STEM00015 Recombinant Human EGF Protein, CF R&D Systems Cat#236-EG-200 L-Alanyl-L-Glutamine ThermoFisher Scientific Cat#J66996.14 Geneticin Life Technologies Cat#G418 TGF-b1 R&D Systems Cat#240-B-002 GeneXPlus Transfection Reagent ATCC Cat#ACS-4004 16% Formaldehyde (W/V) Methanol-free ThermoFisher Scientific Cat#28906 5M NaCl Invitrogen Cat#AM9759 1M Tris pH8.0 Invitrogen Cat#AM9856 Tween-20 Sigma-Aldrich Cat#P9416 BsaI HF-v2 NEB Cat#R3733S BsmBI NEB Cat#R0739S Puromycin Dihydrochloride Gibco Cat#A1113803 Thermo Scientifi Phusion Hot Start II High-Fidelity PCR Master Mix Thermo Scientific Cat#F565L DirectPCR Lysis Reagent Viagen Cat#301-C OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer NEB Cat#M0488L PowerUpTM SYBRTM Green Master Mix ABI A25742 Critical commercial assays Micellula DNA Emulsion & Purification Kit Chimerx Cat#3600-02 QIAGEN Plasmid Plus Maxi Kit Qiagen Cat#12965 dsDNA Quantitation, High Sensitivity ThermoFisher Scientific Cat#Q32851 RNeasy Mini Kit Qiagen Cat#74104 (Continued on next page) Cell Genomics 3, 100330, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript III 1st Strand Synthesis Invitrogen Cat#18080051 Gibson Assembly Master Mix - 10 rxns NEB Cat#E2611S Quick Ligation Kit NEB Cat#M2200L Dual-Luciferase Reporter Assay System Promega Cat#E1910 DNeasy Blood and Tissue kit Qiagen Cat#69506 Monarch PCR & DNA Cleanup Kit NEB Cat#T1030L TruSeq Stranded Total RNA Ribo-Zero Gold Illumina Cat#RS-122-2301 Deposited data MPRA and RNAseq data upon CRISPR prime editing This paper GSE213558 Omni-C data This paper GSE217358 Experimental models: Cell lines Human: HEK-293 ATCC Cat#CRL-1573 Human: hTERT-immortalized adipose derived primary human mesenchymal stem cells ATCC Cat#SCRC4000 Human: PGPC-17 human iPS cells Hildebrandt et al., 2019106 N/A Oligonucleotides ePCR forward primer: GCTAAGGGCCTAAC TGGCCGCTTCACTG Mattioli et al.21 N/A ePCR reverse primer: GTTTAAGGCCTCCG AGGCCGACGCTCTTC Mattioli et al.21 N/A cloning step 1, universal 3’ primer: AATGAT ACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning step 1, universal 5’ primer: caagcagaa gacggcatacgagatCGTGATgtgactggagttcagacg tgtgctcttccgatctACTGGCCGCTTCACTG Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 3’ primer: AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 5’ primer: caagcagaagacggcatacgagatCGTGATgtgac tggagttcagacgtgtgctcttccgatctCGCCGCGTGGAG GAGGA Mattioli et al.21 N/A Oligonucleotide pool, see Table S1 This paper N/A pegRNA/gRNAs, see Table S19 This paper N/A qPCR primers, see Table S24 This paper N/A Recombinant DNA pGL4.29 Promega Cat#E8471 pRL-TK Promega Cat#E2241 MPRA_backbone_empty_pGL4-2.3_cloning_ site_polyA Mattioli et al.21 N/A pCMV-PE2 Anzalone et al.88 Addgene Cat#132775 pU6-gg acceptor Anzalone et al.88 Addgene Cat#132777 BPK1520_puroR Erwood et al.107 Addgene Cat#173901 Software and algorithms rAggr N/A https://web.archive.org/web/20160 416223424/http://raggr.usc.edu/ HaploView N/A http://www.broad.mit.edu/mpg/haploview MPRAnalyze Ashuach et al.108 https://bioconductor.org/packages/ release/bioc/html/MPRAnalyze.html (Continued on next page) e2 Cell Genomics 3, 100330, July 12, 2023 Resource ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BEDTools Quinlan and Hall109 https://code.google.com/archive/p/ bedtools/ R version v4.0.2 https://www.r-project.org/ Ensembl Variant Effect Predictor Tool McLaren et al.110 https://github.com/Ensembl/ensembl- tools/archive/release/83.zip PhyloP Pollard et al.111 http://compgen.cshl.edu/phast/ PastCons Siepel et al.55 http://compgen.cshl.edu/phast/downloads.php ColocQuial Chen et al.45 https://github.com/bvoightlab/ColocQuiaL COLOC package Giambartolomei et al.27 https://github.com/bvoightlab/ColocQuiaL FIMO Bailey et al.112 https://meme-suite.org/meme/doc/fimo.html Python Statsmodels package Seabold et al.113 https://www.statsmodels.org/stable/index.html Hisat2 Kim et al.114 http://daehwankimlab.github.io/hisat2/ FeatureCounts Liao et al.115 https://subread.sourceforge.net/ DESeq2 Love et al.116 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html Metascape Zhou et al.117 https://metascape.org/gp/index.html#/ main/step1 WebGestalt Liao et al.118 http://www.webgestalt.org/ Hi-C Processing Protocol 4D Nucleome Project https://data.4dnucleome.org/resources/ data-analysis/hi_c-processing-pipeline# overview Samtools version 1.5 Li et al.119 https://samtools.sourceforge.net/ Pairx version 0.3.7 N/A https://github.com/4dn-dcic/pairix Pairtools version 0.3.0 N/A https://github.com/open2c/pairtools Cooler version 0.8.11 Abdennur and Mirny120 https://github.com/mirnylab/cooler RepeatMasker Open-4.0 Smit, AFA, Hubley, R & Green, P http://www.repeatmasker.org Sushi package v1.32.0 R v4.0.2 https://bioconductor.org/packages/3.14/ bioc/html/Sushi.html DeepPE Kim et al.121 http://deepcrispr.info/DeepPE/ EditR Kluesner et al.122 http://baseeditr.com/ GraphPad Prism v 9.3.0 9.3.0 https://www.graphpad.com/ scientific-software/prism/ R v4.1.2 4.1.2 https://www.r-project.org/ Python v3.8.10 3.8.10 https://www.python.org/downloads/ Cutadapt Martin123 https://cutadapt.readthedocs.io/en/stable/ Resource ll OPEN ACCESS
Microarray:Article Title: Applications of 3D models in cholangiocarcinoma
Article Snippet: / Matrigel Liver and bile duct biopsies of choledochal cysts RNA sequencing Nakagawa et al. 2017 10.1073/pnas.1619416114 24 Ad-DMEM/F12 (Invitrogen) supplemented with B27 and N2, 1 mM N-acetylcysteine, 10 mM nicotinamide (Wako), 50 ng/mL EGF, 1 μg/mL Rspo1, 100 ng/mL Noggin, 100 ng/mL FGF10 (Peprotech), and 10% Wnt3a-conditioned medium (ATCC). .. / Matrigel Murine extrahepatic bile duct tissue Histological staining, western blot, PCR, Tumorigeneity through xenografting, cDNA microarray analysis Razumilava et al. 2019 10.1002/hep4.1295 / 50% L‐WRN (CRL‐3276; ATCC, Manassas, VA) conditioned media,30 1X penicillin– streptomycin, 1X GlutaMAX, 10 mM 4‐(2‐ hydroxyethyl)‐1‐piperazine ethanesulfonic acid, 1X Fungizone, 1X gentamicin, 1X B27, and 1X N2 (Thermo Fisher Scientific) in advanced Dulbecco’s modified Eagle’s medium/F12 (Invitrogen, Carlsbad, CA). .. Fibroblast growth factor 10 (100 ng/mL; PeproTech, Rocky Hill, NJ) and epithelial growth factor (50 ng/mL; Invitrogen) were added to the culture media for the first 3 days.
Modification:Article Title: Applications of 3D models in cholangiocarcinoma
Article Snippet: / Matrigel Liver and bile duct biopsies of choledochal cysts RNA sequencing Nakagawa et al. 2017 10.1073/pnas.1619416114 24 Ad-DMEM/F12 (Invitrogen) supplemented with B27 and N2, 1 mM N-acetylcysteine, 10 mM nicotinamide (Wako), 50 ng/mL EGF, 1 μg/mL Rspo1, 100 ng/mL Noggin, 100 ng/mL FGF10 (Peprotech), and 10% Wnt3a-conditioned medium (ATCC). .. / Matrigel Murine extrahepatic bile duct tissue Histological staining, western blot, PCR, Tumorigeneity through xenografting, cDNA microarray analysis Razumilava et al. 2019 10.1002/hep4.1295 / 50% L‐WRN (CRL‐3276; ATCC, Manassas, VA) conditioned media,30 1X penicillin– streptomycin, 1X GlutaMAX, 10 mM 4‐(2‐ hydroxyethyl)‐1‐piperazine ethanesulfonic acid, 1X Fungizone, 1X gentamicin, 1X B27, and 1X N2 (Thermo Fisher Scientific) in advanced Dulbecco’s modified Eagle’s medium/F12 (Invitrogen, Carlsbad, CA). .. Fibroblast growth factor 10 (100 ng/mL; PeproTech, Rocky Hill, NJ) and epithelial growth factor (50 ng/mL; Invitrogen) were added to the culture media for the first 3 days.
Cell Culture:
Ligation:Article Title: Systematic characterization of regulatory variants of blood pressure genes
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal Anti-Cardiac Troponin T antibody Abcam Cat#ab10214; RRID:AB_2206574 Bacterial and virus strains NEB 5-alpha Competent E.coli (High Efficiency) NEB Cat#C2987H Chemicals, peptides, and recombinant proteins STEMdiff CM Differentiation Kit STEMCELL Technologies Cat#05010 SfiI NEB Cat#R0123L Alkaline Phosphatase, Calf Intest NEB Cat#M0290L T4 DNA Ligase NEB Cat#M0202M XbaI NEB Cat#R0145L KpnI-HF NEB Cat#R3142L Q5- High Fidelity DNA polymerase NEB Cat#M0491L Formamide (Deionized) Invitrogen Cat#AM9342 Agencourt AMPure XP Beckman Coulter Cat#A63881 Trizol Reagent Life Technologies Cat#15596018 RNase-Free DNase set Qiagen Cat#79254 DNaseI recombinant Worthington Biochemical Cat#LS006355 T4 Polynucleotide Kinase NEB Cat#M0201L SacI-HF NEB Cat#R3156L Lipofectamine 3000 Invitrogen Cat#L3000008 Lipofectamine Stem Transfection Reagent Invitrogen Cat#STEM00015 Recombinant Human EGF Protein, CF R&D Systems Cat#236-EG-200 L-Alanyl-L-Glutamine ThermoFisher Scientific Cat#J66996.14 Geneticin Life Technologies Cat#G418 TGF-b1 R&D Systems Cat#240-B-002 GeneXPlus Transfection Reagent ATCC Cat#ACS-4004 16% Formaldehyde (W/V) Methanol-free ThermoFisher Scientific Cat#28906 5M NaCl Invitrogen Cat#AM9759 1M Tris pH8.0 Invitrogen Cat#AM9856 Tween-20 Sigma-Aldrich Cat#P9416 BsaI HF-v2 NEB Cat#R3733S BsmBI NEB Cat#R0739S Puromycin Dihydrochloride Gibco Cat#A1113803 Thermo Scientifi Phusion Hot Start II High-Fidelity PCR Master Mix Thermo Scientific Cat#F565L DirectPCR Lysis Reagent Viagen Cat#301-C OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer NEB Cat#M0488L PowerUpTM SYBRTM Green Master Mix ABI A25742 Critical commercial assays Micellula DNA Emulsion & Purification Kit Chimerx Cat#3600-02 QIAGEN Plasmid Plus Maxi Kit Qiagen Cat#12965 dsDNA Quantitation, High Sensitivity ThermoFisher Scientific Cat#Q32851 RNeasy Mini Kit Qiagen Cat#74104 (Continued on next page) Cell Genomics 3, 100330, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript III 1st Strand Synthesis Invitrogen Cat#18080051 Gibson Assembly Master Mix - 10 rxns NEB Cat#E2611S Quick Ligation Kit NEB Cat#M2200L Dual-Luciferase Reporter Assay System Promega Cat#E1910 DNeasy Blood and Tissue kit Qiagen Cat#69506 Monarch PCR & DNA Cleanup Kit NEB Cat#T1030L TruSeq Stranded Total RNA Ribo-Zero Gold Illumina Cat#RS-122-2301 Deposited data MPRA and RNAseq data upon CRISPR prime editing This paper GSE213558 Omni-C data This paper GSE217358 Experimental models: Cell lines Human: HEK-293 ATCC Cat#CRL-1573 Human: hTERT-immortalized adipose derived primary human mesenchymal stem cells ATCC Cat#SCRC4000 Human: PGPC-17 human iPS cells Hildebrandt et al., 2019106 N/A Oligonucleotides ePCR forward primer: GCTAAGGGCCTAAC TGGCCGCTTCACTG Mattioli et al.21 N/A ePCR reverse primer: GTTTAAGGCCTCCG AGGCCGACGCTCTTC Mattioli et al.21 N/A cloning step 1, universal 3’ primer: AATGAT ACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning step 1, universal 5’ primer: caagcagaa gacggcatacgagatCGTGATgtgactggagttcagacg tgtgctcttccgatctACTGGCCGCTTCACTG Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 3’ primer: AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 5’ primer: caagcagaagacggcatacgagatCGTGATgtgac tggagttcagacgtgtgctcttccgatctCGCCGCGTGGAG GAGGA Mattioli et al.21 N/A Oligonucleotide pool, see Table S1 This paper N/A pegRNA/gRNAs, see Table S19 This paper N/A qPCR primers, see Table S24 This paper N/A Recombinant DNA pGL4.29 Promega Cat#E8471 pRL-TK Promega Cat#E2241 MPRA_backbone_empty_pGL4-2.3_cloning_ site_polyA Mattioli et al.21 N/A pCMV-PE2 Anzalone et al.88 Addgene Cat#132775 pU6-gg acceptor Anzalone et al.88 Addgene Cat#132777 BPK1520_puroR Erwood et al.107 Addgene Cat#173901 Software and algorithms rAggr N/A https://web.archive.org/web/20160 416223424/http://raggr.usc.edu/ HaploView N/A http://www.broad.mit.edu/mpg/haploview MPRAnalyze Ashuach et al.108 https://bioconductor.org/packages/ release/bioc/html/MPRAnalyze.html (Continued on next page) e2 Cell Genomics 3, 100330, July 12, 2023 Resource ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BEDTools Quinlan and Hall109 https://code.google.com/archive/p/ bedtools/ R version v4.0.2 https://www.r-project.org/ Ensembl Variant Effect Predictor Tool McLaren et al.110 https://github.com/Ensembl/ensembl- tools/archive/release/83.zip PhyloP Pollard et al.111 http://compgen.cshl.edu/phast/ PastCons Siepel et al.55 http://compgen.cshl.edu/phast/downloads.php ColocQuial Chen et al.45 https://github.com/bvoightlab/ColocQuiaL COLOC package Giambartolomei et al.27 https://github.com/bvoightlab/ColocQuiaL FIMO Bailey et al.112 https://meme-suite.org/meme/doc/fimo.html Python Statsmodels package Seabold et al.113 https://www.statsmodels.org/stable/index.html Hisat2 Kim et al.114 http://daehwankimlab.github.io/hisat2/ FeatureCounts Liao et al.115 https://subread.sourceforge.net/ DESeq2 Love et al.116 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html Metascape Zhou et al.117 https://metascape.org/gp/index.html#/ main/step1 WebGestalt Liao et al.118 http://www.webgestalt.org/ Hi-C Processing Protocol 4D Nucleome Project https://data.4dnucleome.org/resources/ data-analysis/hi_c-processing-pipeline# overview Samtools version 1.5 Li et al.119 https://samtools.sourceforge.net/ Pairx version 0.3.7 N/A https://github.com/4dn-dcic/pairix Pairtools version 0.3.0 N/A https://github.com/open2c/pairtools Cooler version 0.8.11 Abdennur and Mirny120 https://github.com/mirnylab/cooler RepeatMasker Open-4.0 Smit, AFA, Hubley, R & Green, P http://www.repeatmasker.org Sushi package v1.32.0 R v4.0.2 https://bioconductor.org/packages/3.14/ bioc/html/Sushi.html DeepPE Kim et al.121 http://deepcrispr.info/DeepPE/ EditR Kluesner et al.122 http://baseeditr.com/ GraphPad Prism v 9.3.0 9.3.0 https://www.graphpad.com/ scientific-software/prism/ R v4.1.2 4.1.2 https://www.r-project.org/ Python v3.8.10 3.8.10 https://www.python.org/downloads/ Cutadapt Martin123 https://cutadapt.readthedocs.io/en/stable/ Resource ll OPEN ACCESS
Reporter Assay:Article Title: Systematic characterization of regulatory variants of blood pressure genes
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal Anti-Cardiac Troponin T antibody Abcam Cat#ab10214; RRID:AB_2206574 Bacterial and virus strains NEB 5-alpha Competent E.coli (High Efficiency) NEB Cat#C2987H Chemicals, peptides, and recombinant proteins STEMdiff CM Differentiation Kit STEMCELL Technologies Cat#05010 SfiI NEB Cat#R0123L Alkaline Phosphatase, Calf Intest NEB Cat#M0290L T4 DNA Ligase NEB Cat#M0202M XbaI NEB Cat#R0145L KpnI-HF NEB Cat#R3142L Q5- High Fidelity DNA polymerase NEB Cat#M0491L Formamide (Deionized) Invitrogen Cat#AM9342 Agencourt AMPure XP Beckman Coulter Cat#A63881 Trizol Reagent Life Technologies Cat#15596018 RNase-Free DNase set Qiagen Cat#79254 DNaseI recombinant Worthington Biochemical Cat#LS006355 T4 Polynucleotide Kinase NEB Cat#M0201L SacI-HF NEB Cat#R3156L Lipofectamine 3000 Invitrogen Cat#L3000008 Lipofectamine Stem Transfection Reagent Invitrogen Cat#STEM00015 Recombinant Human EGF Protein, CF R&D Systems Cat#236-EG-200 L-Alanyl-L-Glutamine ThermoFisher Scientific Cat#J66996.14 Geneticin Life Technologies Cat#G418 TGF-b1 R&D Systems Cat#240-B-002 GeneXPlus Transfection Reagent ATCC Cat#ACS-4004 16% Formaldehyde (W/V) Methanol-free ThermoFisher Scientific Cat#28906 5M NaCl Invitrogen Cat#AM9759 1M Tris pH8.0 Invitrogen Cat#AM9856 Tween-20 Sigma-Aldrich Cat#P9416 BsaI HF-v2 NEB Cat#R3733S BsmBI NEB Cat#R0739S Puromycin Dihydrochloride Gibco Cat#A1113803 Thermo Scientifi Phusion Hot Start II High-Fidelity PCR Master Mix Thermo Scientific Cat#F565L DirectPCR Lysis Reagent Viagen Cat#301-C OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer NEB Cat#M0488L PowerUpTM SYBRTM Green Master Mix ABI A25742 Critical commercial assays Micellula DNA Emulsion & Purification Kit Chimerx Cat#3600-02 QIAGEN Plasmid Plus Maxi Kit Qiagen Cat#12965 dsDNA Quantitation, High Sensitivity ThermoFisher Scientific Cat#Q32851 RNeasy Mini Kit Qiagen Cat#74104 (Continued on next page) Cell Genomics 3, 100330, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript III 1st Strand Synthesis Invitrogen Cat#18080051 Gibson Assembly Master Mix - 10 rxns NEB Cat#E2611S Quick Ligation Kit NEB Cat#M2200L Dual-Luciferase Reporter Assay System Promega Cat#E1910 DNeasy Blood and Tissue kit Qiagen Cat#69506 Monarch PCR & DNA Cleanup Kit NEB Cat#T1030L TruSeq Stranded Total RNA Ribo-Zero Gold Illumina Cat#RS-122-2301 Deposited data MPRA and RNAseq data upon CRISPR prime editing This paper GSE213558 Omni-C data This paper GSE217358 Experimental models: Cell lines Human: HEK-293 ATCC Cat#CRL-1573 Human: hTERT-immortalized adipose derived primary human mesenchymal stem cells ATCC Cat#SCRC4000 Human: PGPC-17 human iPS cells Hildebrandt et al., 2019106 N/A Oligonucleotides ePCR forward primer: GCTAAGGGCCTAAC TGGCCGCTTCACTG Mattioli et al.21 N/A ePCR reverse primer: GTTTAAGGCCTCCG AGGCCGACGCTCTTC Mattioli et al.21 N/A cloning step 1, universal 3’ primer: AATGAT ACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning step 1, universal 5’ primer: caagcagaa gacggcatacgagatCGTGATgtgactggagttcagacg tgtgctcttccgatctACTGGCCGCTTCACTG Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 3’ primer: AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 5’ primer: caagcagaagacggcatacgagatCGTGATgtgac tggagttcagacgtgtgctcttccgatctCGCCGCGTGGAG GAGGA Mattioli et al.21 N/A Oligonucleotide pool, see Table S1 This paper N/A pegRNA/gRNAs, see Table S19 This paper N/A qPCR primers, see Table S24 This paper N/A Recombinant DNA pGL4.29 Promega Cat#E8471 pRL-TK Promega Cat#E2241 MPRA_backbone_empty_pGL4-2.3_cloning_ site_polyA Mattioli et al.21 N/A pCMV-PE2 Anzalone et al.88 Addgene Cat#132775 pU6-gg acceptor Anzalone et al.88 Addgene Cat#132777 BPK1520_puroR Erwood et al.107 Addgene Cat#173901 Software and algorithms rAggr N/A https://web.archive.org/web/20160 416223424/http://raggr.usc.edu/ HaploView N/A http://www.broad.mit.edu/mpg/haploview MPRAnalyze Ashuach et al.108 https://bioconductor.org/packages/ release/bioc/html/MPRAnalyze.html (Continued on next page) e2 Cell Genomics 3, 100330, July 12, 2023 Resource ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BEDTools Quinlan and Hall109 https://code.google.com/archive/p/ bedtools/ R version v4.0.2 https://www.r-project.org/ Ensembl Variant Effect Predictor Tool McLaren et al.110 https://github.com/Ensembl/ensembl- tools/archive/release/83.zip PhyloP Pollard et al.111 http://compgen.cshl.edu/phast/ PastCons Siepel et al.55 http://compgen.cshl.edu/phast/downloads.php ColocQuial Chen et al.45 https://github.com/bvoightlab/ColocQuiaL COLOC package Giambartolomei et al.27 https://github.com/bvoightlab/ColocQuiaL FIMO Bailey et al.112 https://meme-suite.org/meme/doc/fimo.html Python Statsmodels package Seabold et al.113 https://www.statsmodels.org/stable/index.html Hisat2 Kim et al.114 http://daehwankimlab.github.io/hisat2/ FeatureCounts Liao et al.115 https://subread.sourceforge.net/ DESeq2 Love et al.116 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html Metascape Zhou et al.117 https://metascape.org/gp/index.html#/ main/step1 WebGestalt Liao et al.118 http://www.webgestalt.org/ Hi-C Processing Protocol 4D Nucleome Project https://data.4dnucleome.org/resources/ data-analysis/hi_c-processing-pipeline# overview Samtools version 1.5 Li et al.119 https://samtools.sourceforge.net/ Pairx version 0.3.7 N/A https://github.com/4dn-dcic/pairix Pairtools version 0.3.0 N/A https://github.com/open2c/pairtools Cooler version 0.8.11 Abdennur and Mirny120 https://github.com/mirnylab/cooler RepeatMasker Open-4.0 Smit, AFA, Hubley, R & Green, P http://www.repeatmasker.org Sushi package v1.32.0 R v4.0.2 https://bioconductor.org/packages/3.14/ bioc/html/Sushi.html DeepPE Kim et al.121 http://deepcrispr.info/DeepPE/ EditR Kluesner et al.122 http://baseeditr.com/ GraphPad Prism v 9.3.0 9.3.0 https://www.graphpad.com/ scientific-software/prism/ R v4.1.2 4.1.2 https://www.r-project.org/ Python v3.8.10 3.8.10 https://www.python.org/downloads/ Cutadapt Martin123 https://cutadapt.readthedocs.io/en/stable/ Resource ll OPEN ACCESS
RNA sequencing:Article Title: Systematic characterization of regulatory variants of blood pressure genes
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal Anti-Cardiac Troponin T antibody Abcam Cat#ab10214; RRID:AB_2206574 Bacterial and virus strains NEB 5-alpha Competent E.coli (High Efficiency) NEB Cat#C2987H Chemicals, peptides, and recombinant proteins STEMdiff CM Differentiation Kit STEMCELL Technologies Cat#05010 SfiI NEB Cat#R0123L Alkaline Phosphatase, Calf Intest NEB Cat#M0290L T4 DNA Ligase NEB Cat#M0202M XbaI NEB Cat#R0145L KpnI-HF NEB Cat#R3142L Q5- High Fidelity DNA polymerase NEB Cat#M0491L Formamide (Deionized) Invitrogen Cat#AM9342 Agencourt AMPure XP Beckman Coulter Cat#A63881 Trizol Reagent Life Technologies Cat#15596018 RNase-Free DNase set Qiagen Cat#79254 DNaseI recombinant Worthington Biochemical Cat#LS006355 T4 Polynucleotide Kinase NEB Cat#M0201L SacI-HF NEB Cat#R3156L Lipofectamine 3000 Invitrogen Cat#L3000008 Lipofectamine Stem Transfection Reagent Invitrogen Cat#STEM00015 Recombinant Human EGF Protein, CF R&D Systems Cat#236-EG-200 L-Alanyl-L-Glutamine ThermoFisher Scientific Cat#J66996.14 Geneticin Life Technologies Cat#G418 TGF-b1 R&D Systems Cat#240-B-002 GeneXPlus Transfection Reagent ATCC Cat#ACS-4004 16% Formaldehyde (W/V) Methanol-free ThermoFisher Scientific Cat#28906 5M NaCl Invitrogen Cat#AM9759 1M Tris pH8.0 Invitrogen Cat#AM9856 Tween-20 Sigma-Aldrich Cat#P9416 BsaI HF-v2 NEB Cat#R3733S BsmBI NEB Cat#R0739S Puromycin Dihydrochloride Gibco Cat#A1113803 Thermo Scientifi Phusion Hot Start II High-Fidelity PCR Master Mix Thermo Scientific Cat#F565L DirectPCR Lysis Reagent Viagen Cat#301-C OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer NEB Cat#M0488L PowerUpTM SYBRTM Green Master Mix ABI A25742 Critical commercial assays Micellula DNA Emulsion & Purification Kit Chimerx Cat#3600-02 QIAGEN Plasmid Plus Maxi Kit Qiagen Cat#12965 dsDNA Quantitation, High Sensitivity ThermoFisher Scientific Cat#Q32851 RNeasy Mini Kit Qiagen Cat#74104 (Continued on next page) Cell Genomics 3, 100330, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript III 1st Strand Synthesis Invitrogen Cat#18080051 Gibson Assembly Master Mix - 10 rxns NEB Cat#E2611S Quick Ligation Kit NEB Cat#M2200L Dual-Luciferase Reporter Assay System Promega Cat#E1910 DNeasy Blood and Tissue kit Qiagen Cat#69506 Monarch PCR & DNA Cleanup Kit NEB Cat#T1030L TruSeq Stranded Total RNA Ribo-Zero Gold Illumina Cat#RS-122-2301 Deposited data MPRA and RNAseq data upon CRISPR prime editing This paper GSE213558 Omni-C data This paper GSE217358 Experimental models: Cell lines Human: HEK-293 ATCC Cat#CRL-1573 Human: hTERT-immortalized adipose derived primary human mesenchymal stem cells ATCC Cat#SCRC4000 Human: PGPC-17 human iPS cells Hildebrandt et al., 2019106 N/A Oligonucleotides ePCR forward primer: GCTAAGGGCCTAAC TGGCCGCTTCACTG Mattioli et al.21 N/A ePCR reverse primer: GTTTAAGGCCTCCG AGGCCGACGCTCTTC Mattioli et al.21 N/A cloning step 1, universal 3’ primer: AATGAT ACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning step 1, universal 5’ primer: caagcagaa gacggcatacgagatCGTGATgtgactggagttcagacg tgtgctcttccgatctACTGGCCGCTTCACTG Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 3’ primer: AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 5’ primer: caagcagaagacggcatacgagatCGTGATgtgac tggagttcagacgtgtgctcttccgatctCGCCGCGTGGAG GAGGA Mattioli et al.21 N/A Oligonucleotide pool, see Table S1 This paper N/A pegRNA/gRNAs, see Table S19 This paper N/A qPCR primers, see Table S24 This paper N/A Recombinant DNA pGL4.29 Promega Cat#E8471 pRL-TK Promega Cat#E2241 MPRA_backbone_empty_pGL4-2.3_cloning_ site_polyA Mattioli et al.21 N/A pCMV-PE2 Anzalone et al.88 Addgene Cat#132775 pU6-gg acceptor Anzalone et al.88 Addgene Cat#132777 BPK1520_puroR Erwood et al.107 Addgene Cat#173901 Software and algorithms rAggr N/A https://web.archive.org/web/20160 416223424/http://raggr.usc.edu/ HaploView N/A http://www.broad.mit.edu/mpg/haploview MPRAnalyze Ashuach et al.108 https://bioconductor.org/packages/ release/bioc/html/MPRAnalyze.html (Continued on next page) e2 Cell Genomics 3, 100330, July 12, 2023 Resource ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BEDTools Quinlan and Hall109 https://code.google.com/archive/p/ bedtools/ R version v4.0.2 https://www.r-project.org/ Ensembl Variant Effect Predictor Tool McLaren et al.110 https://github.com/Ensembl/ensembl- tools/archive/release/83.zip PhyloP Pollard et al.111 http://compgen.cshl.edu/phast/ PastCons Siepel et al.55 http://compgen.cshl.edu/phast/downloads.php ColocQuial Chen et al.45 https://github.com/bvoightlab/ColocQuiaL COLOC package Giambartolomei et al.27 https://github.com/bvoightlab/ColocQuiaL FIMO Bailey et al.112 https://meme-suite.org/meme/doc/fimo.html Python Statsmodels package Seabold et al.113 https://www.statsmodels.org/stable/index.html Hisat2 Kim et al.114 http://daehwankimlab.github.io/hisat2/ FeatureCounts Liao et al.115 https://subread.sourceforge.net/ DESeq2 Love et al.116 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html Metascape Zhou et al.117 https://metascape.org/gp/index.html#/ main/step1 WebGestalt Liao et al.118 http://www.webgestalt.org/ Hi-C Processing Protocol 4D Nucleome Project https://data.4dnucleome.org/resources/ data-analysis/hi_c-processing-pipeline# overview Samtools version 1.5 Li et al.119 https://samtools.sourceforge.net/ Pairx version 0.3.7 N/A https://github.com/4dn-dcic/pairix Pairtools version 0.3.0 N/A https://github.com/open2c/pairtools Cooler version 0.8.11 Abdennur and Mirny120 https://github.com/mirnylab/cooler RepeatMasker Open-4.0 Smit, AFA, Hubley, R & Green, P http://www.repeatmasker.org Sushi package v1.32.0 R v4.0.2 https://bioconductor.org/packages/3.14/ bioc/html/Sushi.html DeepPE Kim et al.121 http://deepcrispr.info/DeepPE/ EditR Kluesner et al.122 http://baseeditr.com/ GraphPad Prism v 9.3.0 9.3.0 https://www.graphpad.com/ scientific-software/prism/ R v4.1.2 4.1.2 https://www.r-project.org/ Python v3.8.10 3.8.10 https://www.python.org/downloads/ Cutadapt Martin123 https://cutadapt.readthedocs.io/en/stable/ Resource ll OPEN ACCESS
CRISPR:Article Title: Systematic characterization of regulatory variants of blood pressure genes
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal Anti-Cardiac Troponin T antibody Abcam Cat#ab10214; RRID:AB_2206574 Bacterial and virus strains NEB 5-alpha Competent E.coli (High Efficiency) NEB Cat#C2987H Chemicals, peptides, and recombinant proteins STEMdiff CM Differentiation Kit STEMCELL Technologies Cat#05010 SfiI NEB Cat#R0123L Alkaline Phosphatase, Calf Intest NEB Cat#M0290L T4 DNA Ligase NEB Cat#M0202M XbaI NEB Cat#R0145L KpnI-HF NEB Cat#R3142L Q5- High Fidelity DNA polymerase NEB Cat#M0491L Formamide (Deionized) Invitrogen Cat#AM9342 Agencourt AMPure XP Beckman Coulter Cat#A63881 Trizol Reagent Life Technologies Cat#15596018 RNase-Free DNase set Qiagen Cat#79254 DNaseI recombinant Worthington Biochemical Cat#LS006355 T4 Polynucleotide Kinase NEB Cat#M0201L SacI-HF NEB Cat#R3156L Lipofectamine 3000 Invitrogen Cat#L3000008 Lipofectamine Stem Transfection Reagent Invitrogen Cat#STEM00015 Recombinant Human EGF Protein, CF R&D Systems Cat#236-EG-200 L-Alanyl-L-Glutamine ThermoFisher Scientific Cat#J66996.14 Geneticin Life Technologies Cat#G418 TGF-b1 R&D Systems Cat#240-B-002 GeneXPlus Transfection Reagent ATCC Cat#ACS-4004 16% Formaldehyde (W/V) Methanol-free ThermoFisher Scientific Cat#28906 5M NaCl Invitrogen Cat#AM9759 1M Tris pH8.0 Invitrogen Cat#AM9856 Tween-20 Sigma-Aldrich Cat#P9416 BsaI HF-v2 NEB Cat#R3733S BsmBI NEB Cat#R0739S Puromycin Dihydrochloride Gibco Cat#A1113803 Thermo Scientifi Phusion Hot Start II High-Fidelity PCR Master Mix Thermo Scientific Cat#F565L DirectPCR Lysis Reagent Viagen Cat#301-C OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer NEB Cat#M0488L PowerUpTM SYBRTM Green Master Mix ABI A25742 Critical commercial assays Micellula DNA Emulsion & Purification Kit Chimerx Cat#3600-02 QIAGEN Plasmid Plus Maxi Kit Qiagen Cat#12965 dsDNA Quantitation, High Sensitivity ThermoFisher Scientific Cat#Q32851 RNeasy Mini Kit Qiagen Cat#74104 (Continued on next page) Cell Genomics 3, 100330, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript III 1st Strand Synthesis Invitrogen Cat#18080051 Gibson Assembly Master Mix - 10 rxns NEB Cat#E2611S Quick Ligation Kit NEB Cat#M2200L Dual-Luciferase Reporter Assay System Promega Cat#E1910 DNeasy Blood and Tissue kit Qiagen Cat#69506 Monarch PCR & DNA Cleanup Kit NEB Cat#T1030L TruSeq Stranded Total RNA Ribo-Zero Gold Illumina Cat#RS-122-2301 Deposited data MPRA and RNAseq data upon CRISPR prime editing This paper GSE213558 Omni-C data This paper GSE217358 Experimental models: Cell lines Human: HEK-293 ATCC Cat#CRL-1573 Human: hTERT-immortalized adipose derived primary human mesenchymal stem cells ATCC Cat#SCRC4000 Human: PGPC-17 human iPS cells Hildebrandt et al., 2019106 N/A Oligonucleotides ePCR forward primer: GCTAAGGGCCTAAC TGGCCGCTTCACTG Mattioli et al.21 N/A ePCR reverse primer: GTTTAAGGCCTCCG AGGCCGACGCTCTTC Mattioli et al.21 N/A cloning step 1, universal 3’ primer: AATGAT ACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning step 1, universal 5’ primer: caagcagaa gacggcatacgagatCGTGATgtgactggagttcagacg tgtgctcttccgatctACTGGCCGCTTCACTG Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 3’ primer: AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 5’ primer: caagcagaagacggcatacgagatCGTGATgtgac tggagttcagacgtgtgctcttccgatctCGCCGCGTGGAG GAGGA Mattioli et al.21 N/A Oligonucleotide pool, see Table S1 This paper N/A pegRNA/gRNAs, see Table S19 This paper N/A qPCR primers, see Table S24 This paper N/A Recombinant DNA pGL4.29 Promega Cat#E8471 pRL-TK Promega Cat#E2241 MPRA_backbone_empty_pGL4-2.3_cloning_ site_polyA Mattioli et al.21 N/A pCMV-PE2 Anzalone et al.88 Addgene Cat#132775 pU6-gg acceptor Anzalone et al.88 Addgene Cat#132777 BPK1520_puroR Erwood et al.107 Addgene Cat#173901 Software and algorithms rAggr N/A https://web.archive.org/web/20160 416223424/http://raggr.usc.edu/ HaploView N/A http://www.broad.mit.edu/mpg/haploview MPRAnalyze Ashuach et al.108 https://bioconductor.org/packages/ release/bioc/html/MPRAnalyze.html (Continued on next page) e2 Cell Genomics 3, 100330, July 12, 2023 Resource ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BEDTools Quinlan and Hall109 https://code.google.com/archive/p/ bedtools/ R version v4.0.2 https://www.r-project.org/ Ensembl Variant Effect Predictor Tool McLaren et al.110 https://github.com/Ensembl/ensembl- tools/archive/release/83.zip PhyloP Pollard et al.111 http://compgen.cshl.edu/phast/ PastCons Siepel et al.55 http://compgen.cshl.edu/phast/downloads.php ColocQuial Chen et al.45 https://github.com/bvoightlab/ColocQuiaL COLOC package Giambartolomei et al.27 https://github.com/bvoightlab/ColocQuiaL FIMO Bailey et al.112 https://meme-suite.org/meme/doc/fimo.html Python Statsmodels package Seabold et al.113 https://www.statsmodels.org/stable/index.html Hisat2 Kim et al.114 http://daehwankimlab.github.io/hisat2/ FeatureCounts Liao et al.115 https://subread.sourceforge.net/ DESeq2 Love et al.116 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html Metascape Zhou et al.117 https://metascape.org/gp/index.html#/ main/step1 WebGestalt Liao et al.118 http://www.webgestalt.org/ Hi-C Processing Protocol 4D Nucleome Project https://data.4dnucleome.org/resources/ data-analysis/hi_c-processing-pipeline# overview Samtools version 1.5 Li et al.119 https://samtools.sourceforge.net/ Pairx version 0.3.7 N/A https://github.com/4dn-dcic/pairix Pairtools version 0.3.0 N/A https://github.com/open2c/pairtools Cooler version 0.8.11 Abdennur and Mirny120 https://github.com/mirnylab/cooler RepeatMasker Open-4.0 Smit, AFA, Hubley, R & Green, P http://www.repeatmasker.org Sushi package v1.32.0 R v4.0.2 https://bioconductor.org/packages/3.14/ bioc/html/Sushi.html DeepPE Kim et al.121 http://deepcrispr.info/DeepPE/ EditR Kluesner et al.122 http://baseeditr.com/ GraphPad Prism v 9.3.0 9.3.0 https://www.graphpad.com/ scientific-software/prism/ R v4.1.2 4.1.2 https://www.r-project.org/ Python v3.8.10 3.8.10 https://www.python.org/downloads/ Cutadapt Martin123 https://cutadapt.readthedocs.io/en/stable/ Resource ll OPEN ACCESS
Cloning:Article Title: Systematic characterization of regulatory variants of blood pressure genes
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal Anti-Cardiac Troponin T antibody Abcam Cat#ab10214; RRID:AB_2206574 Bacterial and virus strains NEB 5-alpha Competent E.coli (High Efficiency) NEB Cat#C2987H Chemicals, peptides, and recombinant proteins STEMdiff CM Differentiation Kit STEMCELL Technologies Cat#05010 SfiI NEB Cat#R0123L Alkaline Phosphatase, Calf Intest NEB Cat#M0290L T4 DNA Ligase NEB Cat#M0202M XbaI NEB Cat#R0145L KpnI-HF NEB Cat#R3142L Q5- High Fidelity DNA polymerase NEB Cat#M0491L Formamide (Deionized) Invitrogen Cat#AM9342 Agencourt AMPure XP Beckman Coulter Cat#A63881 Trizol Reagent Life Technologies Cat#15596018 RNase-Free DNase set Qiagen Cat#79254 DNaseI recombinant Worthington Biochemical Cat#LS006355 T4 Polynucleotide Kinase NEB Cat#M0201L SacI-HF NEB Cat#R3156L Lipofectamine 3000 Invitrogen Cat#L3000008 Lipofectamine Stem Transfection Reagent Invitrogen Cat#STEM00015 Recombinant Human EGF Protein, CF R&D Systems Cat#236-EG-200 L-Alanyl-L-Glutamine ThermoFisher Scientific Cat#J66996.14 Geneticin Life Technologies Cat#G418 TGF-b1 R&D Systems Cat#240-B-002 GeneXPlus Transfection Reagent ATCC Cat#ACS-4004 16% Formaldehyde (W/V) Methanol-free ThermoFisher Scientific Cat#28906 5M NaCl Invitrogen Cat#AM9759 1M Tris pH8.0 Invitrogen Cat#AM9856 Tween-20 Sigma-Aldrich Cat#P9416 BsaI HF-v2 NEB Cat#R3733S BsmBI NEB Cat#R0739S Puromycin Dihydrochloride Gibco Cat#A1113803 Thermo Scientifi Phusion Hot Start II High-Fidelity PCR Master Mix Thermo Scientific Cat#F565L DirectPCR Lysis Reagent Viagen Cat#301-C OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer NEB Cat#M0488L PowerUpTM SYBRTM Green Master Mix ABI A25742 Critical commercial assays Micellula DNA Emulsion & Purification Kit Chimerx Cat#3600-02 QIAGEN Plasmid Plus Maxi Kit Qiagen Cat#12965 dsDNA Quantitation, High Sensitivity ThermoFisher Scientific Cat#Q32851 RNeasy Mini Kit Qiagen Cat#74104 (Continued on next page) Cell Genomics 3, 100330, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript III 1st Strand Synthesis Invitrogen Cat#18080051 Gibson Assembly Master Mix - 10 rxns NEB Cat#E2611S Quick Ligation Kit NEB Cat#M2200L Dual-Luciferase Reporter Assay System Promega Cat#E1910 DNeasy Blood and Tissue kit Qiagen Cat#69506 Monarch PCR & DNA Cleanup Kit NEB Cat#T1030L TruSeq Stranded Total RNA Ribo-Zero Gold Illumina Cat#RS-122-2301 Deposited data MPRA and RNAseq data upon CRISPR prime editing This paper GSE213558 Omni-C data This paper GSE217358 Experimental models: Cell lines Human: HEK-293 ATCC Cat#CRL-1573 Human: hTERT-immortalized adipose derived primary human mesenchymal stem cells ATCC Cat#SCRC4000 Human: PGPC-17 human iPS cells Hildebrandt et al., 2019106 N/A Oligonucleotides ePCR forward primer: GCTAAGGGCCTAAC TGGCCGCTTCACTG Mattioli et al.21 N/A ePCR reverse primer: GTTTAAGGCCTCCG AGGCCGACGCTCTTC Mattioli et al.21 N/A cloning step 1, universal 3’ primer: AATGAT ACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning step 1, universal 5’ primer: caagcagaa gacggcatacgagatCGTGATgtgactggagttcagacg tgtgctcttccgatctACTGGCCGCTTCACTG Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 3’ primer: AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 5’ primer: caagcagaagacggcatacgagatCGTGATgtgac tggagttcagacgtgtgctcttccgatctCGCCGCGTGGAG GAGGA Mattioli et al.21 N/A Oligonucleotide pool, see Table S1 This paper N/A pegRNA/gRNAs, see Table S19 This paper N/A qPCR primers, see Table S24 This paper N/A Recombinant DNA pGL4.29 Promega Cat#E8471 pRL-TK Promega Cat#E2241 MPRA_backbone_empty_pGL4-2.3_cloning_ site_polyA Mattioli et al.21 N/A pCMV-PE2 Anzalone et al.88 Addgene Cat#132775 pU6-gg acceptor Anzalone et al.88 Addgene Cat#132777 BPK1520_puroR Erwood et al.107 Addgene Cat#173901 Software and algorithms rAggr N/A https://web.archive.org/web/20160 416223424/http://raggr.usc.edu/ HaploView N/A http://www.broad.mit.edu/mpg/haploview MPRAnalyze Ashuach et al.108 https://bioconductor.org/packages/ release/bioc/html/MPRAnalyze.html (Continued on next page) e2 Cell Genomics 3, 100330, July 12, 2023 Resource ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BEDTools Quinlan and Hall109 https://code.google.com/archive/p/ bedtools/ R version v4.0.2 https://www.r-project.org/ Ensembl Variant Effect Predictor Tool McLaren et al.110 https://github.com/Ensembl/ensembl- tools/archive/release/83.zip PhyloP Pollard et al.111 http://compgen.cshl.edu/phast/ PastCons Siepel et al.55 http://compgen.cshl.edu/phast/downloads.php ColocQuial Chen et al.45 https://github.com/bvoightlab/ColocQuiaL COLOC package Giambartolomei et al.27 https://github.com/bvoightlab/ColocQuiaL FIMO Bailey et al.112 https://meme-suite.org/meme/doc/fimo.html Python Statsmodels package Seabold et al.113 https://www.statsmodels.org/stable/index.html Hisat2 Kim et al.114 http://daehwankimlab.github.io/hisat2/ FeatureCounts Liao et al.115 https://subread.sourceforge.net/ DESeq2 Love et al.116 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html Metascape Zhou et al.117 https://metascape.org/gp/index.html#/ main/step1 WebGestalt Liao et al.118 http://www.webgestalt.org/ Hi-C Processing Protocol 4D Nucleome Project https://data.4dnucleome.org/resources/ data-analysis/hi_c-processing-pipeline# overview Samtools version 1.5 Li et al.119 https://samtools.sourceforge.net/ Pairx version 0.3.7 N/A https://github.com/4dn-dcic/pairix Pairtools version 0.3.0 N/A https://github.com/open2c/pairtools Cooler version 0.8.11 Abdennur and Mirny120 https://github.com/mirnylab/cooler RepeatMasker Open-4.0 Smit, AFA, Hubley, R & Green, P http://www.repeatmasker.org Sushi package v1.32.0 R v4.0.2 https://bioconductor.org/packages/3.14/ bioc/html/Sushi.html DeepPE Kim et al.121 http://deepcrispr.info/DeepPE/ EditR Kluesner et al.122 http://baseeditr.com/ GraphPad Prism v 9.3.0 9.3.0 https://www.graphpad.com/ scientific-software/prism/ R v4.1.2 4.1.2 https://www.r-project.org/ Python v3.8.10 3.8.10 https://www.python.org/downloads/ Cutadapt Martin123 https://cutadapt.readthedocs.io/en/stable/ Resource ll OPEN ACCESS
Real-time Polymerase Chain Reaction:Article Title: Systematic characterization of regulatory variants of blood pressure genes
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal Anti-Cardiac Troponin T antibody Abcam Cat#ab10214; RRID:AB_2206574 Bacterial and virus strains NEB 5-alpha Competent E.coli (High Efficiency) NEB Cat#C2987H Chemicals, peptides, and recombinant proteins STEMdiff CM Differentiation Kit STEMCELL Technologies Cat#05010 SfiI NEB Cat#R0123L Alkaline Phosphatase, Calf Intest NEB Cat#M0290L T4 DNA Ligase NEB Cat#M0202M XbaI NEB Cat#R0145L KpnI-HF NEB Cat#R3142L Q5- High Fidelity DNA polymerase NEB Cat#M0491L Formamide (Deionized) Invitrogen Cat#AM9342 Agencourt AMPure XP Beckman Coulter Cat#A63881 Trizol Reagent Life Technologies Cat#15596018 RNase-Free DNase set Qiagen Cat#79254 DNaseI recombinant Worthington Biochemical Cat#LS006355 T4 Polynucleotide Kinase NEB Cat#M0201L SacI-HF NEB Cat#R3156L Lipofectamine 3000 Invitrogen Cat#L3000008 Lipofectamine Stem Transfection Reagent Invitrogen Cat#STEM00015 Recombinant Human EGF Protein, CF R&D Systems Cat#236-EG-200 L-Alanyl-L-Glutamine ThermoFisher Scientific Cat#J66996.14 Geneticin Life Technologies Cat#G418 TGF-b1 R&D Systems Cat#240-B-002 GeneXPlus Transfection Reagent ATCC Cat#ACS-4004 16% Formaldehyde (W/V) Methanol-free ThermoFisher Scientific Cat#28906 5M NaCl Invitrogen Cat#AM9759 1M Tris pH8.0 Invitrogen Cat#AM9856 Tween-20 Sigma-Aldrich Cat#P9416 BsaI HF-v2 NEB Cat#R3733S BsmBI NEB Cat#R0739S Puromycin Dihydrochloride Gibco Cat#A1113803 Thermo Scientifi Phusion Hot Start II High-Fidelity PCR Master Mix Thermo Scientific Cat#F565L DirectPCR Lysis Reagent Viagen Cat#301-C OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer NEB Cat#M0488L PowerUpTM SYBRTM Green Master Mix ABI A25742 Critical commercial assays Micellula DNA Emulsion & Purification Kit Chimerx Cat#3600-02 QIAGEN Plasmid Plus Maxi Kit Qiagen Cat#12965 dsDNA Quantitation, High Sensitivity ThermoFisher Scientific Cat#Q32851 RNeasy Mini Kit Qiagen Cat#74104 (Continued on next page) Cell Genomics 3, 100330, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript III 1st Strand Synthesis Invitrogen Cat#18080051 Gibson Assembly Master Mix - 10 rxns NEB Cat#E2611S Quick Ligation Kit NEB Cat#M2200L Dual-Luciferase Reporter Assay System Promega Cat#E1910 DNeasy Blood and Tissue kit Qiagen Cat#69506 Monarch PCR & DNA Cleanup Kit NEB Cat#T1030L TruSeq Stranded Total RNA Ribo-Zero Gold Illumina Cat#RS-122-2301 Deposited data MPRA and RNAseq data upon CRISPR prime editing This paper GSE213558 Omni-C data This paper GSE217358 Experimental models: Cell lines Human: HEK-293 ATCC Cat#CRL-1573 Human: hTERT-immortalized adipose derived primary human mesenchymal stem cells ATCC Cat#SCRC4000 Human: PGPC-17 human iPS cells Hildebrandt et al., 2019106 N/A Oligonucleotides ePCR forward primer: GCTAAGGGCCTAAC TGGCCGCTTCACTG Mattioli et al.21 N/A ePCR reverse primer: GTTTAAGGCCTCCG AGGCCGACGCTCTTC Mattioli et al.21 N/A cloning step 1, universal 3’ primer: AATGAT ACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning step 1, universal 5’ primer: caagcagaa gacggcatacgagatCGTGATgtgactggagttcagacg tgtgctcttccgatctACTGGCCGCTTCACTG Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 3’ primer: AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 5’ primer: caagcagaagacggcatacgagatCGTGATgtgac tggagttcagacgtgtgctcttccgatctCGCCGCGTGGAG GAGGA Mattioli et al.21 N/A Oligonucleotide pool, see Table S1 This paper N/A pegRNA/gRNAs, see Table S19 This paper N/A qPCR primers, see Table S24 This paper N/A Recombinant DNA pGL4.29 Promega Cat#E8471 pRL-TK Promega Cat#E2241 MPRA_backbone_empty_pGL4-2.3_cloning_ site_polyA Mattioli et al.21 N/A pCMV-PE2 Anzalone et al.88 Addgene Cat#132775 pU6-gg acceptor Anzalone et al.88 Addgene Cat#132777 BPK1520_puroR Erwood et al.107 Addgene Cat#173901 Software and algorithms rAggr N/A https://web.archive.org/web/20160 416223424/http://raggr.usc.edu/ HaploView N/A http://www.broad.mit.edu/mpg/haploview MPRAnalyze Ashuach et al.108 https://bioconductor.org/packages/ release/bioc/html/MPRAnalyze.html (Continued on next page) e2 Cell Genomics 3, 100330, July 12, 2023 Resource ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BEDTools Quinlan and Hall109 https://code.google.com/archive/p/ bedtools/ R version v4.0.2 https://www.r-project.org/ Ensembl Variant Effect Predictor Tool McLaren et al.110 https://github.com/Ensembl/ensembl- tools/archive/release/83.zip PhyloP Pollard et al.111 http://compgen.cshl.edu/phast/ PastCons Siepel et al.55 http://compgen.cshl.edu/phast/downloads.php ColocQuial Chen et al.45 https://github.com/bvoightlab/ColocQuiaL COLOC package Giambartolomei et al.27 https://github.com/bvoightlab/ColocQuiaL FIMO Bailey et al.112 https://meme-suite.org/meme/doc/fimo.html Python Statsmodels package Seabold et al.113 https://www.statsmodels.org/stable/index.html Hisat2 Kim et al.114 http://daehwankimlab.github.io/hisat2/ FeatureCounts Liao et al.115 https://subread.sourceforge.net/ DESeq2 Love et al.116 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html Metascape Zhou et al.117 https://metascape.org/gp/index.html#/ main/step1 WebGestalt Liao et al.118 http://www.webgestalt.org/ Hi-C Processing Protocol 4D Nucleome Project https://data.4dnucleome.org/resources/ data-analysis/hi_c-processing-pipeline# overview Samtools version 1.5 Li et al.119 https://samtools.sourceforge.net/ Pairx version 0.3.7 N/A https://github.com/4dn-dcic/pairix Pairtools version 0.3.0 N/A https://github.com/open2c/pairtools Cooler version 0.8.11 Abdennur and Mirny120 https://github.com/mirnylab/cooler RepeatMasker Open-4.0 Smit, AFA, Hubley, R & Green, P http://www.repeatmasker.org Sushi package v1.32.0 R v4.0.2 https://bioconductor.org/packages/3.14/ bioc/html/Sushi.html DeepPE Kim et al.121 http://deepcrispr.info/DeepPE/ EditR Kluesner et al.122 http://baseeditr.com/ GraphPad Prism v 9.3.0 9.3.0 https://www.graphpad.com/ scientific-software/prism/ R v4.1.2 4.1.2 https://www.r-project.org/ Python v3.8.10 3.8.10 https://www.python.org/downloads/ Cutadapt Martin123 https://cutadapt.readthedocs.io/en/stable/ Resource ll OPEN ACCESS
Recombinant:Article Title: Systematic characterization of regulatory variants of blood pressure genes
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal Anti-Cardiac Troponin T antibody Abcam Cat#ab10214; RRID:AB_2206574 Bacterial and virus strains NEB 5-alpha Competent E.coli (High Efficiency) NEB Cat#C2987H Chemicals, peptides, and recombinant proteins STEMdiff CM Differentiation Kit STEMCELL Technologies Cat#05010 SfiI NEB Cat#R0123L Alkaline Phosphatase, Calf Intest NEB Cat#M0290L T4 DNA Ligase NEB Cat#M0202M XbaI NEB Cat#R0145L KpnI-HF NEB Cat#R3142L Q5- High Fidelity DNA polymerase NEB Cat#M0491L Formamide (Deionized) Invitrogen Cat#AM9342 Agencourt AMPure XP Beckman Coulter Cat#A63881 Trizol Reagent Life Technologies Cat#15596018 RNase-Free DNase set Qiagen Cat#79254 DNaseI recombinant Worthington Biochemical Cat#LS006355 T4 Polynucleotide Kinase NEB Cat#M0201L SacI-HF NEB Cat#R3156L Lipofectamine 3000 Invitrogen Cat#L3000008 Lipofectamine Stem Transfection Reagent Invitrogen Cat#STEM00015 Recombinant Human EGF Protein, CF R&D Systems Cat#236-EG-200 L-Alanyl-L-Glutamine ThermoFisher Scientific Cat#J66996.14 Geneticin Life Technologies Cat#G418 TGF-b1 R&D Systems Cat#240-B-002 GeneXPlus Transfection Reagent ATCC Cat#ACS-4004 16% Formaldehyde (W/V) Methanol-free ThermoFisher Scientific Cat#28906 5M NaCl Invitrogen Cat#AM9759 1M Tris pH8.0 Invitrogen Cat#AM9856 Tween-20 Sigma-Aldrich Cat#P9416 BsaI HF-v2 NEB Cat#R3733S BsmBI NEB Cat#R0739S Puromycin Dihydrochloride Gibco Cat#A1113803 Thermo Scientifi Phusion Hot Start II High-Fidelity PCR Master Mix Thermo Scientific Cat#F565L DirectPCR Lysis Reagent Viagen Cat#301-C OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer NEB Cat#M0488L PowerUpTM SYBRTM Green Master Mix ABI A25742 Critical commercial assays Micellula DNA Emulsion & Purification Kit Chimerx Cat#3600-02 QIAGEN Plasmid Plus Maxi Kit Qiagen Cat#12965 dsDNA Quantitation, High Sensitivity ThermoFisher Scientific Cat#Q32851 RNeasy Mini Kit Qiagen Cat#74104 (Continued on next page) Cell Genomics 3, 100330, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript III 1st Strand Synthesis Invitrogen Cat#18080051 Gibson Assembly Master Mix - 10 rxns NEB Cat#E2611S Quick Ligation Kit NEB Cat#M2200L Dual-Luciferase Reporter Assay System Promega Cat#E1910 DNeasy Blood and Tissue kit Qiagen Cat#69506 Monarch PCR & DNA Cleanup Kit NEB Cat#T1030L TruSeq Stranded Total RNA Ribo-Zero Gold Illumina Cat#RS-122-2301 Deposited data MPRA and RNAseq data upon CRISPR prime editing This paper GSE213558 Omni-C data This paper GSE217358 Experimental models: Cell lines Human: HEK-293 ATCC Cat#CRL-1573 Human: hTERT-immortalized adipose derived primary human mesenchymal stem cells ATCC Cat#SCRC4000 Human: PGPC-17 human iPS cells Hildebrandt et al., 2019106 N/A Oligonucleotides ePCR forward primer: GCTAAGGGCCTAAC TGGCCGCTTCACTG Mattioli et al.21 N/A ePCR reverse primer: GTTTAAGGCCTCCG AGGCCGACGCTCTTC Mattioli et al.21 N/A cloning step 1, universal 3’ primer: AATGAT ACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning step 1, universal 5’ primer: caagcagaa gacggcatacgagatCGTGATgtgactggagttcagacg tgtgctcttccgatctACTGGCCGCTTCACTG Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 3’ primer: AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 5’ primer: caagcagaagacggcatacgagatCGTGATgtgac tggagttcagacgtgtgctcttccgatctCGCCGCGTGGAG GAGGA Mattioli et al.21 N/A Oligonucleotide pool, see Table S1 This paper N/A pegRNA/gRNAs, see Table S19 This paper N/A qPCR primers, see Table S24 This paper N/A Recombinant DNA pGL4.29 Promega Cat#E8471 pRL-TK Promega Cat#E2241 MPRA_backbone_empty_pGL4-2.3_cloning_ site_polyA Mattioli et al.21 N/A pCMV-PE2 Anzalone et al.88 Addgene Cat#132775 pU6-gg acceptor Anzalone et al.88 Addgene Cat#132777 BPK1520_puroR Erwood et al.107 Addgene Cat#173901 Software and algorithms rAggr N/A https://web.archive.org/web/20160 416223424/http://raggr.usc.edu/ HaploView N/A http://www.broad.mit.edu/mpg/haploview MPRAnalyze Ashuach et al.108 https://bioconductor.org/packages/ release/bioc/html/MPRAnalyze.html (Continued on next page) e2 Cell Genomics 3, 100330, July 12, 2023 Resource ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BEDTools Quinlan and Hall109 https://code.google.com/archive/p/ bedtools/ R version v4.0.2 https://www.r-project.org/ Ensembl Variant Effect Predictor Tool McLaren et al.110 https://github.com/Ensembl/ensembl- tools/archive/release/83.zip PhyloP Pollard et al.111 http://compgen.cshl.edu/phast/ PastCons Siepel et al.55 http://compgen.cshl.edu/phast/downloads.php ColocQuial Chen et al.45 https://github.com/bvoightlab/ColocQuiaL COLOC package Giambartolomei et al.27 https://github.com/bvoightlab/ColocQuiaL FIMO Bailey et al.112 https://meme-suite.org/meme/doc/fimo.html Python Statsmodels package Seabold et al.113 https://www.statsmodels.org/stable/index.html Hisat2 Kim et al.114 http://daehwankimlab.github.io/hisat2/ FeatureCounts Liao et al.115 https://subread.sourceforge.net/ DESeq2 Love et al.116 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html Metascape Zhou et al.117 https://metascape.org/gp/index.html#/ main/step1 WebGestalt Liao et al.118 http://www.webgestalt.org/ Hi-C Processing Protocol 4D Nucleome Project https://data.4dnucleome.org/resources/ data-analysis/hi_c-processing-pipeline# overview Samtools version 1.5 Li et al.119 https://samtools.sourceforge.net/ Pairx version 0.3.7 N/A https://github.com/4dn-dcic/pairix Pairtools version 0.3.0 N/A https://github.com/open2c/pairtools Cooler version 0.8.11 Abdennur and Mirny120 https://github.com/mirnylab/cooler RepeatMasker Open-4.0 Smit, AFA, Hubley, R & Green, P http://www.repeatmasker.org Sushi package v1.32.0 R v4.0.2 https://bioconductor.org/packages/3.14/ bioc/html/Sushi.html DeepPE Kim et al.121 http://deepcrispr.info/DeepPE/ EditR Kluesner et al.122 http://baseeditr.com/ GraphPad Prism v 9.3.0 9.3.0 https://www.graphpad.com/ scientific-software/prism/ R v4.1.2 4.1.2 https://www.r-project.org/ Python v3.8.10 3.8.10 https://www.python.org/downloads/ Cutadapt Martin123 https://cutadapt.readthedocs.io/en/stable/ Resource ll OPEN ACCESS
Software:Article Title: Systematic characterization of regulatory variants of blood pressure genes
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal Anti-Cardiac Troponin T antibody Abcam Cat#ab10214; RRID:AB_2206574 Bacterial and virus strains NEB 5-alpha Competent E.coli (High Efficiency) NEB Cat#C2987H Chemicals, peptides, and recombinant proteins STEMdiff CM Differentiation Kit STEMCELL Technologies Cat#05010 SfiI NEB Cat#R0123L Alkaline Phosphatase, Calf Intest NEB Cat#M0290L T4 DNA Ligase NEB Cat#M0202M XbaI NEB Cat#R0145L KpnI-HF NEB Cat#R3142L Q5- High Fidelity DNA polymerase NEB Cat#M0491L Formamide (Deionized) Invitrogen Cat#AM9342 Agencourt AMPure XP Beckman Coulter Cat#A63881 Trizol Reagent Life Technologies Cat#15596018 RNase-Free DNase set Qiagen Cat#79254 DNaseI recombinant Worthington Biochemical Cat#LS006355 T4 Polynucleotide Kinase NEB Cat#M0201L SacI-HF NEB Cat#R3156L Lipofectamine 3000 Invitrogen Cat#L3000008 Lipofectamine Stem Transfection Reagent Invitrogen Cat#STEM00015 Recombinant Human EGF Protein, CF R&D Systems Cat#236-EG-200 L-Alanyl-L-Glutamine ThermoFisher Scientific Cat#J66996.14 Geneticin Life Technologies Cat#G418 TGF-b1 R&D Systems Cat#240-B-002 GeneXPlus Transfection Reagent ATCC Cat#ACS-4004 16% Formaldehyde (W/V) Methanol-free ThermoFisher Scientific Cat#28906 5M NaCl Invitrogen Cat#AM9759 1M Tris pH8.0 Invitrogen Cat#AM9856 Tween-20 Sigma-Aldrich Cat#P9416 BsaI HF-v2 NEB Cat#R3733S BsmBI NEB Cat#R0739S Puromycin Dihydrochloride Gibco Cat#A1113803 Thermo Scientifi Phusion Hot Start II High-Fidelity PCR Master Mix Thermo Scientific Cat#F565L DirectPCR Lysis Reagent Viagen Cat#301-C OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer NEB Cat#M0488L PowerUpTM SYBRTM Green Master Mix ABI A25742 Critical commercial assays Micellula DNA Emulsion & Purification Kit Chimerx Cat#3600-02 QIAGEN Plasmid Plus Maxi Kit Qiagen Cat#12965 dsDNA Quantitation, High Sensitivity ThermoFisher Scientific Cat#Q32851 RNeasy Mini Kit Qiagen Cat#74104 (Continued on next page) Cell Genomics 3, 100330, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript III 1st Strand Synthesis Invitrogen Cat#18080051 Gibson Assembly Master Mix - 10 rxns NEB Cat#E2611S Quick Ligation Kit NEB Cat#M2200L Dual-Luciferase Reporter Assay System Promega Cat#E1910 DNeasy Blood and Tissue kit Qiagen Cat#69506 Monarch PCR & DNA Cleanup Kit NEB Cat#T1030L TruSeq Stranded Total RNA Ribo-Zero Gold Illumina Cat#RS-122-2301 Deposited data MPRA and RNAseq data upon CRISPR prime editing This paper GSE213558 Omni-C data This paper GSE217358 Experimental models: Cell lines Human: HEK-293 ATCC Cat#CRL-1573 Human: hTERT-immortalized adipose derived primary human mesenchymal stem cells ATCC Cat#SCRC4000 Human: PGPC-17 human iPS cells Hildebrandt et al., 2019106 N/A Oligonucleotides ePCR forward primer: GCTAAGGGCCTAAC TGGCCGCTTCACTG Mattioli et al.21 N/A ePCR reverse primer: GTTTAAGGCCTCCG AGGCCGACGCTCTTC Mattioli et al.21 N/A cloning step 1, universal 3’ primer: AATGAT ACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning step 1, universal 5’ primer: caagcagaa gacggcatacgagatCGTGATgtgactggagttcagacg tgtgctcttccgatctACTGGCCGCTTCACTG Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 3’ primer: AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTCTTCCGATCT Mattioli et al.21 N/A cloning steps 2 & 3 and cDNA libraries, universal 5’ primer: caagcagaagacggcatacgagatCGTGATgtgac tggagttcagacgtgtgctcttccgatctCGCCGCGTGGAG GAGGA Mattioli et al.21 N/A Oligonucleotide pool, see Table S1 This paper N/A pegRNA/gRNAs, see Table S19 This paper N/A qPCR primers, see Table S24 This paper N/A Recombinant DNA pGL4.29 Promega Cat#E8471 pRL-TK Promega Cat#E2241 MPRA_backbone_empty_pGL4-2.3_cloning_ site_polyA Mattioli et al.21 N/A pCMV-PE2 Anzalone et al.88 Addgene Cat#132775 pU6-gg acceptor Anzalone et al.88 Addgene Cat#132777 BPK1520_puroR Erwood et al.107 Addgene Cat#173901 Software and algorithms rAggr N/A https://web.archive.org/web/20160 416223424/http://raggr.usc.edu/ HaploView N/A http://www.broad.mit.edu/mpg/haploview MPRAnalyze Ashuach et al.108 https://bioconductor.org/packages/ release/bioc/html/MPRAnalyze.html (Continued on next page) e2 Cell Genomics 3, 100330, July 12, 2023 Resource ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BEDTools Quinlan and Hall109 https://code.google.com/archive/p/ bedtools/ R version v4.0.2 https://www.r-project.org/ Ensembl Variant Effect Predictor Tool McLaren et al.110 https://github.com/Ensembl/ensembl- tools/archive/release/83.zip PhyloP Pollard et al.111 http://compgen.cshl.edu/phast/ PastCons Siepel et al.55 http://compgen.cshl.edu/phast/downloads.php ColocQuial Chen et al.45 https://github.com/bvoightlab/ColocQuiaL COLOC package Giambartolomei et al.27 https://github.com/bvoightlab/ColocQuiaL FIMO Bailey et al.112 https://meme-suite.org/meme/doc/fimo.html Python Statsmodels package Seabold et al.113 https://www.statsmodels.org/stable/index.html Hisat2 Kim et al.114 http://daehwankimlab.github.io/hisat2/ FeatureCounts Liao et al.115 https://subread.sourceforge.net/ DESeq2 Love et al.116 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html Metascape Zhou et al.117 https://metascape.org/gp/index.html#/ main/step1 WebGestalt Liao et al.118 http://www.webgestalt.org/ Hi-C Processing Protocol 4D Nucleome Project https://data.4dnucleome.org/resources/ data-analysis/hi_c-processing-pipeline# overview Samtools version 1.5 Li et al.119 https://samtools.sourceforge.net/ Pairx version 0.3.7 N/A https://github.com/4dn-dcic/pairix Pairtools version 0.3.0 N/A https://github.com/open2c/pairtools Cooler version 0.8.11 Abdennur and Mirny120 https://github.com/mirnylab/cooler RepeatMasker Open-4.0 Smit, AFA, Hubley, R & Green, P http://www.repeatmasker.org Sushi package v1.32.0 R v4.0.2 https://bioconductor.org/packages/3.14/ bioc/html/Sushi.html DeepPE Kim et al.121 http://deepcrispr.info/DeepPE/ EditR Kluesner et al.122 http://baseeditr.com/ GraphPad Prism v 9.3.0 9.3.0 https://www.graphpad.com/ scientific-software/prism/ R v4.1.2 4.1.2 https://www.r-project.org/ Python v3.8.10 3.8.10 https://www.python.org/downloads/ Cutadapt Martin123 https://cutadapt.readthedocs.io/en/stable/ Resource ll OPEN ACCESS
|