snail1 coding sequences (Addgene inc)
Addgene inc is a verified supplier 
94
Structured Review
Addgene inc
snail1 coding sequences
Snail1 Coding Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/blastx+function/pWZL+Blast+Snail+ER+(Plasmid+%2318798)/pmc09856774-51-35-20
Average 94 stars, based on 19 article reviews
Snail1 Coding Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/blastx+function/pWZL+Blast+Snail+ER+(Plasmid+%2318798)/pmc09856774-51-35-20
Average 94 stars, based on 19 article reviews
snail1 coding sequences - by Bioz Stars,
2026-11
94/100 stars
Images
1) Product Images from "TGFβ1-Induced EMT in the MCF10A Mammary Epithelial Cell Line Model Is Executed Independently of SNAIL1 and ZEB1 but Relies on JUNB-Coordinated Transcriptional Regulation"
Article Title: TGFβ1-Induced EMT in the MCF10A Mammary Epithelial Cell Line Model Is Executed Independently of SNAIL1 and ZEB1 but Relies on JUNB-Coordinated Transcriptional Regulation
Journal: Cancers
doi: 10.3390/cancers15020558
Figure Legend Snippet: Analyses of TFBM activity suggests a prominent function for AP-1 family members JUN and JUNB in TGFβ1-induced EMT. ( a ) De novo motif analysis of DARs from the TGFβ1 time course experiment using HOMER. For each time point of the TGFβ1 treatment, all significantly identified TF motifs are shown. Bar plots display the percentage of DARs and random background genomics regions in which the motifs were enriched. Statistical significance is shown next to the corresponding bar as −log 10 of the adj. p -value. ( b ) Number of TFBMs enriched in proximal and distal DARs or both according to IMAGE. Examples for TFBMs specifically enriched in proximal, distal, or proximal and distal DARs are given. ( c ) DARs with predicted motif activities of JUN and JUNB are more numerous and have broader regulatory scopes compared to DARs with SNAIL1 and ZEB1 motif activities. For each time point of TGFβ1 treatment, the DARs with predicted activities of SNAIL1, ZEB1, JUN, and JUNB motifs were identified by IMAGE, and their numbers were plotted. The heatmaps below represent, for each time point, the average values of log 2 FC of accessibility calculated for all DARs harboring a given TF motif and which are associated with annotated genes. The annotation bars to the left of each of the heatmaps specify the location of the DARs (proximal, distal, or both) in which the TF motifs are enriched. The annotation bars to the right of each of the heatmaps show whether the genes annotated to the DARs were previously identified as epithelial markers (Epi), mesenchymal markers (Mes), or have no known connection to EMT (unknown).
Techniques Used: Activity Assay
Figure Legend Snippet: SNAIL1 and ZEB1 are not required for TGFβ1-induced EMT. ( a , b ) Schematic representation of the human SNAI1 and ZEB1 genes and proteins. Exons are depicted as boxes with protein-coding parts colored in black and UTRs in white. Relevant functional domains of the proteins are indicated by color and linked to the exonic region by which they are encoded. DB: destruction box; NES: nuclear export signal; SID: Smad interaction domain; HB: homeobox; CID: CtBP interaction domain. The locations of sgRNA targets used for inactivation of SNAI1 and ZEB1 are marked by red arrows. ( c , d ) Detection of SNAIL1 and ZEB1 proteins by Western blot using nuclear extracts from MCF10A SNAI1 and ZEB1 wild type (WT) and knock-out (KO) cell clones. Glycogen synthase kinase-3 beta (GSK-3 beta) was used as loading control. Molecular weights are given in kilodaltons (kDa). One representative result from three independent biological replicates is presented. ( e , f ) Representative phase-contrast microscopy pictures from one of three independent biological replicates showing the indicated MCF10A SNAI1 and ZEB1 WT and KO clones after 72 h of TGFβ1 treatment. The scale bar represents 200 µm. ( g , h ) Gene expression analysis of epithelial and mesenchymal marker genes after 72 h of TGFβ1 treatment. RNA levels were measured by qRT-PCR and are shown as relative expression compared to the RNA levels of GAPDH . In the box plots each dot represents the result of a single qRT-PCR measurement. Dot color identifies MCF10A SNAI1 and ZEB1 WT and KO cell clones. Stars indicate p -values corrected for multiple testing by the false discovery rate (FDR) method. *: FDR < 0.05, ns: not significant; Mann-Whitney U test. ( i , j ) Detection of epithelial and mesenchymal markers after 72 h of TGFβ1 treatment by Western blot using the cytoplasmic fractions of protein lysates from MCF10A SNAI1 and ZEB1 WT and KO cell clones. Beta-actin was used as loading control. Molecular weights are given in kilodaltons (kDa). Representative results from one of three independent biological replicates are shown. Uncropped versions of immunoblots including densitometry readings can be found in .
Techniques Used: Functional Assay, Western Blot, Knock-Out, Clone Assay, Microscopy, Expressing, Marker, Quantitative RT-PCR, MANN-WHITNEY
Figure Legend Snippet: Increased JUNB activity is sufficient to induce EMT in MCF10A cells. ( a ) Schematic representation of the gene expression cassette for a fusion protein consisting of the human JUNB coding region (JUNB sense) and a mutant estrogen receptor hormone binding domain (ER). A control construct (CTRL) harbored the JUNB coding region in opposite orientation (JUNB antisense). The angled arrow indicates the TSS; the white box represents the 5′-untranslated region. ( b ) Simultaneous detection of endogenous JUNB und ectopic JUNB-ER expression by Western blot using nuclear extracts from MCF10A cells that had been stably transduced with a retroviral vector for expression of JUNB-ER or the control construct. Glycogen synthase kinase-3 beta (GSK-3 beta) was used as loading control. Molecular weights are given in kilodaltons (kDa). One representative result from three independent biological replicates is presented. ( c ) Representative phase-contrast microscopy pictures from one of three independent biological replicates showing the indicated MCF10A JUNB-ER and CTRL cells. The scale bar represents 200 µm. ( d ) Gene expression analysis of epithelial and mesenchymal marker genes in MCF10A JUNB-ER and CTRL cells. RNA levels were measured by qRT-PCR and are shown as relative expression compared to those of GAPDH . ( e ) Detection of epithelial and mesenchymal markers in the cytoplasmic (Fibronectin, N-cadherin, EpCAM, RBM47) and nuclear fractions (SNAIL1, SNAIL2, ZEB1, JUN) of protein lysates from MCF10A JUNB-ER and CTRL cells. Beta-actin and GSK-3beta were used as loading controls. Molecular weights are given in kilodaltons (kDa). Representative results from one of three independent biological replicates are shown. ( f ) Results from transwell migration assays performed with MCF10A JUNB-ER or CTRL cells. Depicted is the area covered by cells on the bottom surface of transwell inserts relative to the value of EtOH treated cells. ( g ) Spheroid invasion assays performed with cellular aggregates embedded in a collagen I matrix. For the quantification single cells and small aggregates (exemplarily marked by arrow heads) that had detached from the bulk of the cell aggregates were counted in two fields of view per cell line and condition. Pictures of representative spheroids from one out of three independent biological replicates are shown on the right. The scale bars represent 100 μm. ( b , e ) Uncropped versions of immunoblots including densitometry readings can be found in . ( b – g ) For all experiments, cells were treated with 100 nM 4-OHT or a corresponding volume of ethanol (EtOH) for 72 h prior to harvest. ( d , f , g ) Bars represent the mean values from at least three independent biological replicates. Error bars depict the standard error of the mean. Stars indicate p -values corrected for multiple testing by the FDR method. *: FDR < 0.05, **: FDR < 0.01, ***: FDR < 0.001, ns: not significant; one-way ANOVA.
Techniques Used: Activity Assay, Expressing, Mutagenesis, Binding Assay, Construct, Western Blot, Stable Transfection, Transduction, Plasmid Preparation, Microscopy, Marker, Quantitative RT-PCR, Migration
Related Articles
Polymerase Chain Reaction:Article Title: TGFβ1-Induced EMT in the MCF10A Mammary Epithelial Cell Line Model Is Executed Independently of SNAIL1 and ZEB1 but Relies on JUNB-Coordinated Transcriptional Regulation. Article Snippet: For constitutive expression of JUNB-ER fusion proteins in MCF10A and A549 cells, the human JUNB coding sequences flanked by extensions with BamHI restriction enzyme sites were PCR-amplified from genomic DNA of MCF10A cells using the Q5 high fidelity polymerase (M0491, New England Biolabs GmbH, Frankfurt, Germany). .. After digestion with BamHI, the JUNB PCR fragment was inserted in sense and antisense orientations into the retroviral vector pWZL-Blast-SNAIL1-ER (addgene plasmid #18798; http://n2t.net/ addgene:18798 (accessed on 28 August 2022); RRID: addgene_18798) [26], whereby the Article Title: TGFβ1-Induced EMT in the MCF10A Mammary Epithelial Cell Line Model Is Executed Independently of SNAIL1 and ZEB1 but Relies on JUNB-Coordinated Transcriptional Regulation Article Snippet: For constitutive expression of JUNB-ER fusion proteins in MCF10A and A549 cells, the human JUNB coding sequences flanked by extensions with BamHI restriction enzyme sites were PCR-amplified from genomic DNA of MCF10A cells using the Q5 high fidelity polymerase (M0491, New England Biolabs GmbH, Frankfurt, Germany). .. After digestion with BamHI, the JUNB PCR fragment was inserted in sense and antisense orientations into the retroviral vector pWZL-Blast-SNAIL1-ER (addgene plasmid #18798; http://n2t.net/addgene:18798 (accessed on 28 August 2022); RRID: addgene_18798) [ ], whereby the Retroviral:Article Title: TGFβ1-Induced EMT in the MCF10A Mammary Epithelial Cell Line Model Is Executed Independently of SNAIL1 and ZEB1 but Relies on JUNB-Coordinated Transcriptional Regulation. Article Snippet: For constitutive expression of JUNB-ER fusion proteins in MCF10A and A549 cells, the human JUNB coding sequences flanked by extensions with BamHI restriction enzyme sites were PCR-amplified from genomic DNA of MCF10A cells using the Q5 high fidelity polymerase (M0491, New England Biolabs GmbH, Frankfurt, Germany). .. After digestion with BamHI, the JUNB PCR fragment was inserted in sense and antisense orientations into the retroviral vector pWZL-Blast-SNAIL1-ER (addgene plasmid #18798; http://n2t.net/ addgene:18798 (accessed on 28 August 2022); RRID: addgene_18798) [26], whereby the Article Title: TGFβ1-Induced EMT in the MCF10A Mammary Epithelial Cell Line Model Is Executed Independently of SNAIL1 and ZEB1 but Relies on JUNB-Coordinated Transcriptional Regulation Article Snippet: For constitutive expression of JUNB-ER fusion proteins in MCF10A and A549 cells, the human JUNB coding sequences flanked by extensions with BamHI restriction enzyme sites were PCR-amplified from genomic DNA of MCF10A cells using the Q5 high fidelity polymerase (M0491, New England Biolabs GmbH, Frankfurt, Germany). .. After digestion with BamHI, the JUNB PCR fragment was inserted in sense and antisense orientations into the retroviral vector pWZL-Blast-SNAIL1-ER (addgene plasmid #18798; http://n2t.net/addgene:18798 (accessed on 28 August 2022); RRID: addgene_18798) [ ], whereby the Plasmid Preparation:Article Title: TGFβ1-Induced EMT in the MCF10A Mammary Epithelial Cell Line Model Is Executed Independently of SNAIL1 and ZEB1 but Relies on JUNB-Coordinated Transcriptional Regulation. Article Snippet: For constitutive expression of JUNB-ER fusion proteins in MCF10A and A549 cells, the human JUNB coding sequences flanked by extensions with BamHI restriction enzyme sites were PCR-amplified from genomic DNA of MCF10A cells using the Q5 high fidelity polymerase (M0491, New England Biolabs GmbH, Frankfurt, Germany). .. After digestion with BamHI, the JUNB PCR fragment was inserted in sense and antisense orientations into the retroviral vector pWZL-Blast-SNAIL1-ER (addgene plasmid #18798; http://n2t.net/ addgene:18798 (accessed on 28 August 2022); RRID: addgene_18798) [26], whereby the Article Title: A synthetic lethal screen for Snail-induced enzalutamide resistance identifies JAK/STAT signaling as a therapeutic vulnerability in prostate cancer Article Snippet: The PSA reporter was synthesized in the lentiviral expression plasmid, pLV[Exp]-Puro by VectorBuilder (Chicago, IL) to include 2 Kb of the proximal PSA promoter upstream of the enhanced green fluorescent protein (EGFP) open reading frame ( ). .. Cells stably expressing Article Title: TGFβ1-Induced EMT in the MCF10A Mammary Epithelial Cell Line Model Is Executed Independently of SNAIL1 and ZEB1 but Relies on JUNB-Coordinated Transcriptional Regulation Article Snippet: For constitutive expression of JUNB-ER fusion proteins in MCF10A and A549 cells, the human JUNB coding sequences flanked by extensions with BamHI restriction enzyme sites were PCR-amplified from genomic DNA of MCF10A cells using the Q5 high fidelity polymerase (M0491, New England Biolabs GmbH, Frankfurt, Germany). .. After digestion with BamHI, the JUNB PCR fragment was inserted in sense and antisense orientations into the retroviral vector pWZL-Blast-SNAIL1-ER (addgene plasmid #18798; http://n2t.net/addgene:18798 (accessed on 28 August 2022); RRID: addgene_18798) [ ], whereby the Article Title: Astrocytic Sox9 overexpression in Alzheimer's disease mouse models promotes Aβ plaque phagocytosis and preserves cognitive function. Article Snippet: Astrocytes play essential roles in the brain, and their dysfunction is associated with nearly every form of neurological disease.. Despite their ubiquity, knowledge of how astrocytes contribute to disease pathogenesis is incomplete; accordingly, harnessing their biology toward therapeutics remains a major challenge.. Here we show that the transcription factor Sox9 plays a context-specific role in maintaining astrocyte function and circuit activity in the aging hippocampus and Alzheimer’s disease (AD) models. Recombinant:Article Title: Damaged mitochondria recruit the effector NEMO to activate NF-κB signaling. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER IRDye 680RD Donkey anti-Rabbit IgG Secondary Antibody LI-COR Cat#926-68073; RRID:AB_10954442 IRDye 800CW Donkey anti-Mouse IgG Secondary Antibody LI-COR Cat#926-32212; RRID:AB_621847 Bacterial and virus strains pLysS E. coli Rosetta (DE3) Merck Cat#70956-M Chemicals and recombinant proteins Oligomycin A Millipore Sigma Cat#75351 Antimycin A Millipore Sigma Cat#A8674 Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific Cat#11668019 Lipofectamine RNAiMax Transfection Reagent Thermo Fisher Scientific Cat#13778075 Recombinant human TNFɑ Peprotech Cat#300-01A 1,6-Hexanediol Millipore Sigma Cat#240117 ChromoTek GFP-Trap Magnetic Particles M-270 Proteintech Cat#gtd Janelia Fluor 646 Halo Ligand Promega Cat#GA112A SNAP-Cell 647-SiR New England Biolabs Cat#S9102S Deposited data Original data this paper https://doi.org/10.5281/zenodo.8256650 Experimental models: Cell lines Human: HeLa-M a gift from A. Peden (CambridgeInstitute for Medical Research) RRID:CVCL_R965 Human: HeLa-OPTN -/- Lazarou et al.,9 a gift from R. Youle (NIH) N/A Human: HeLa-p62 -/- Sarraf et al.,48 a gift from R. Youle (NIH) N/A Experimental models: Organisms/strains Mouse: C57BL6/J The Jackson Laboratory strain#000664; RRID:IMSR_JAX:000664 Rat: CD Sprague Dawley IGS Charles River strain#001; RRID:RGD_734476 Oligonucleotides ON-TARGETplus Human SQSTM1 siRNA Horizon Discovery Cat#J-010230-05 ON-TARGETplus Human IKBKG siRNA - SMARTpool Horizon Discovery Cat# L-003767-00-0020 ON-TARGETplus Human RBCK1 siRNA Horizon Discovery Cat#J-006932-10-0002 ON-TARGETplus Non-targeting siRNA #1 Horizon Discovery Cat#D-001810-01-20 Primer to IFIT3 (fwd): TGCAGGGAAACAGCCATCAT This paper N/A Primer to IFIT3 (rev): GGCATTTCAGCTGTGGAAGG This paper N/A Primer to IL6 (fwd): AGGAGCCCAGCTATGAACTC This paper N/A Primer to IL6 (rev): GAGAAGGCAACTGGACCGA This paper N/A Primer to TNFA (fwd): GGCCCGACTATCTCGACTTT This paper N/A Primer to TNFA (rev): CTCACAGGGCAATGATCCCA This paper N/A Primer to GAPDH (fwd): ATCTTCTTTTGCGTCGCCAG This paper N/A (Continued on next page) e2 Molecular Cell 83, 3188–3204.e1–e7, September 7, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Primer to GAPDH (rev): GTTGACTCCGACCTTCACCT This paper N/A Recombinant DNA Mito-DsRed2 A gift from T. Schwarz (Harvard University) N/A Mito-SBFP2 Wong and Holzbaur, 201411 RRID:Addgene_187964 Mito-SNAP This paper RRID:Addgene_206480 Parkin A gift from I. Dikic RRID:Addgene_187897 mCherry-Parkin Narendra et al.7 RRID:Addgene_23956 YFP-Parkin Narendra et al.7 RRID:Addgene_23955 EGFP-mNEMO Tarantino et al.,40 a gift from E. Laplantine (Sorbonne Universités) N/A EGFP-mNEMOD304N this paper RRID:Addgene_187898 Halo-mNEMO this paper RRID:Addgene_187899 HIS-TEV-mCherry-p62 Wurzer et al.55 RRID:Addgene_199780 pGEX-GST-hNEMO this paper RRID:Addgene_199781 GST-4XUB Wurzer et al.55 RRID:Addgene_199779 Halo-OPTN Moore and Holzbaur42 RRID:Addgene_187900 mCherry-vector Clontech Cat#632524 Imaging:Article Title: Damaged mitochondria recruit the effector NEMO to activate NF-κB signaling. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER IRDye 680RD Donkey anti-Rabbit IgG Secondary Antibody LI-COR Cat#926-68073; RRID:AB_10954442 IRDye 800CW Donkey anti-Mouse IgG Secondary Antibody LI-COR Cat#926-32212; RRID:AB_621847 Bacterial and virus strains pLysS E. coli Rosetta (DE3) Merck Cat#70956-M Chemicals and recombinant proteins Oligomycin A Millipore Sigma Cat#75351 Antimycin A Millipore Sigma Cat#A8674 Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific Cat#11668019 Lipofectamine RNAiMax Transfection Reagent Thermo Fisher Scientific Cat#13778075 Recombinant human TNFɑ Peprotech Cat#300-01A 1,6-Hexanediol Millipore Sigma Cat#240117 ChromoTek GFP-Trap Magnetic Particles M-270 Proteintech Cat#gtd Janelia Fluor 646 Halo Ligand Promega Cat#GA112A SNAP-Cell 647-SiR New England Biolabs Cat#S9102S Deposited data Original data this paper https://doi.org/10.5281/zenodo.8256650 Experimental models: Cell lines Human: HeLa-M a gift from A. Peden (CambridgeInstitute for Medical Research) RRID:CVCL_R965 Human: HeLa-OPTN -/- Lazarou et al.,9 a gift from R. Youle (NIH) N/A Human: HeLa-p62 -/- Sarraf et al.,48 a gift from R. Youle (NIH) N/A Experimental models: Organisms/strains Mouse: C57BL6/J The Jackson Laboratory strain#000664; RRID:IMSR_JAX:000664 Rat: CD Sprague Dawley IGS Charles River strain#001; RRID:RGD_734476 Oligonucleotides ON-TARGETplus Human SQSTM1 siRNA Horizon Discovery Cat#J-010230-05 ON-TARGETplus Human IKBKG siRNA - SMARTpool Horizon Discovery Cat# L-003767-00-0020 ON-TARGETplus Human RBCK1 siRNA Horizon Discovery Cat#J-006932-10-0002 ON-TARGETplus Non-targeting siRNA #1 Horizon Discovery Cat#D-001810-01-20 Primer to IFIT3 (fwd): TGCAGGGAAACAGCCATCAT This paper N/A Primer to IFIT3 (rev): GGCATTTCAGCTGTGGAAGG This paper N/A Primer to IL6 (fwd): AGGAGCCCAGCTATGAACTC This paper N/A Primer to IL6 (rev): GAGAAGGCAACTGGACCGA This paper N/A Primer to TNFA (fwd): GGCCCGACTATCTCGACTTT This paper N/A Primer to TNFA (rev): CTCACAGGGCAATGATCCCA This paper N/A Primer to GAPDH (fwd): ATCTTCTTTTGCGTCGCCAG This paper N/A (Continued on next page) e2 Molecular Cell 83, 3188–3204.e1–e7, September 7, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Primer to GAPDH (rev): GTTGACTCCGACCTTCACCT This paper N/A Recombinant DNA Mito-DsRed2 A gift from T. Schwarz (Harvard University) N/A Mito-SBFP2 Wong and Holzbaur, 201411 RRID:Addgene_187964 Mito-SNAP This paper RRID:Addgene_206480 Parkin A gift from I. Dikic RRID:Addgene_187897 mCherry-Parkin Narendra et al.7 RRID:Addgene_23956 YFP-Parkin Narendra et al.7 RRID:Addgene_23955 EGFP-mNEMO Tarantino et al.,40 a gift from E. Laplantine (Sorbonne Universités) N/A EGFP-mNEMOD304N this paper RRID:Addgene_187898 Halo-mNEMO this paper RRID:Addgene_187899 HIS-TEV-mCherry-p62 Wurzer et al.55 RRID:Addgene_199780 pGEX-GST-hNEMO this paper RRID:Addgene_199781 GST-4XUB Wurzer et al.55 RRID:Addgene_199779 Halo-OPTN Moore and Holzbaur42 RRID:Addgene_187900 mCherry-vector Clontech Cat#632524 Stable Transfection:Article Title: A synthetic lethal screen for Snail-induced enzalutamide resistance identifies JAK/STAT signaling as a therapeutic vulnerability in prostate cancer. Article Snippet: The PSA reporter was synthesized in the lentiviral expression plasmid, pLV[Exp]-Puro by VectorBuilder (Chicago, IL) to include 2 Kb of the proximal PSA promoter upstream of the enhanced green fluorescent protein (EGFP) open reading frame (Zhang et al., 1996). .. Cells stably expressing Article Title: A synthetic lethal screen for Snail-induced enzalutamide resistance identifies JAK/STAT signaling as a therapeutic vulnerability in prostate cancer Article Snippet: The PSA reporter was synthesized in the lentiviral expression plasmid, pLV[Exp]-Puro by VectorBuilder (Chicago, IL) to include 2 Kb of the proximal PSA promoter upstream of the enhanced green fluorescent protein (EGFP) open reading frame ( ). .. Cells stably expressing Expressing:Article Title: A synthetic lethal screen for Snail-induced enzalutamide resistance identifies JAK/STAT signaling as a therapeutic vulnerability in prostate cancer. Article Snippet: The PSA reporter was synthesized in the lentiviral expression plasmid, pLV[Exp]-Puro by VectorBuilder (Chicago, IL) to include 2 Kb of the proximal PSA promoter upstream of the enhanced green fluorescent protein (EGFP) open reading frame (Zhang et al., 1996). .. Cells stably expressing Article Title: A synthetic lethal screen for Snail-induced enzalutamide resistance identifies JAK/STAT signaling as a therapeutic vulnerability in prostate cancer Article Snippet: The PSA reporter was synthesized in the lentiviral expression plasmid, pLV[Exp]-Puro by VectorBuilder (Chicago, IL) to include 2 Kb of the proximal PSA promoter upstream of the enhanced green fluorescent protein (EGFP) open reading frame ( ). .. Cells stably expressing Generated:Article Title: A synthetic lethal screen for Snail-induced enzalutamide resistance identifies JAK/STAT signaling as a therapeutic vulnerability in prostate cancer. Article Snippet: The PSA reporter was synthesized in the lentiviral expression plasmid, pLV[Exp]-Puro by VectorBuilder (Chicago, IL) to include 2 Kb of the proximal PSA promoter upstream of the enhanced green fluorescent protein (EGFP) open reading frame (Zhang et al., 1996). .. Cells stably expressing Article Title: A synthetic lethal screen for Snail-induced enzalutamide resistance identifies JAK/STAT signaling as a therapeutic vulnerability in prostate cancer Article Snippet: The PSA reporter was synthesized in the lentiviral expression plasmid, pLV[Exp]-Puro by VectorBuilder (Chicago, IL) to include 2 Kb of the proximal PSA promoter upstream of the enhanced green fluorescent protein (EGFP) open reading frame ( ). .. Cells stably expressing Transduction:Article Title: A synthetic lethal screen for Snail-induced enzalutamide resistance identifies JAK/STAT signaling as a therapeutic vulnerability in prostate cancer. Article Snippet: The PSA reporter was synthesized in the lentiviral expression plasmid, pLV[Exp]-Puro by VectorBuilder (Chicago, IL) to include 2 Kb of the proximal PSA promoter upstream of the enhanced green fluorescent protein (EGFP) open reading frame (Zhang et al., 1996). .. Cells stably expressing Article Title: A synthetic lethal screen for Snail-induced enzalutamide resistance identifies JAK/STAT signaling as a therapeutic vulnerability in prostate cancer Article Snippet: The PSA reporter was synthesized in the lentiviral expression plasmid, pLV[Exp]-Puro by VectorBuilder (Chicago, IL) to include 2 Kb of the proximal PSA promoter upstream of the enhanced green fluorescent protein (EGFP) open reading frame ( ). .. Cells stably expressing Construct:Article Title: Astrocytic Sox9 overexpression in Alzheimer's disease mouse models promotes Aβ plaque phagocytosis and preserves cognitive function. Article Snippet: Astrocytes play essential roles in the brain, and their dysfunction is associated with nearly every form of neurological disease.. Despite their ubiquity, knowledge of how astrocytes contribute to disease pathogenesis is incomplete; accordingly, harnessing their biology toward therapeutics remains a major challenge.. Here we show that the transcription factor Sox9 plays a context-specific role in maintaining astrocyte function and circuit activity in the aging hippocampus and Alzheimer’s disease (AD) models. Bioprocessing:Article Title: Astrocytic Sox9 overexpression in Alzheimer's disease mouse models promotes Aβ plaque phagocytosis and preserves cognitive function. Article Snippet: Astrocytes play essential roles in the brain, and their dysfunction is associated with nearly every form of neurological disease.. Despite their ubiquity, knowledge of how astrocytes contribute to disease pathogenesis is incomplete; accordingly, harnessing their biology toward therapeutics remains a major challenge.. Here we show that the transcription factor Sox9 plays a context-specific role in maintaining astrocyte function and circuit activity in the aging hippocampus and Alzheimer’s disease (AD) models. |