Review



microarray service  (Phalanx Biotech)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Phalanx Biotech microarray service
    Impairedcell proliferation in double transgenic (dTg) mouse hearts. (A) Right panel: immunofluorescence staining was performed with sections from E14.5 control and dTg mouse embryos by using anti-pH3 (pH3: green, a cell proliferation marker) and anti-cTnT-AF647 (cTnT: red, a cardiomyocyte marker). DAPI (blue) was used for staining nuclei. Arrows indicate pH3+/cTnT+cardiomyocytes. Arrowheads indicateexamples of stained red blood cells. The left panel shows the statistical analysis of the data shown in the right panel of (A) . Cont, control. Four randomly selected fields from each sample were scored for pH3 + /cTnT + cardiomyocytes ( n = 3 per group). (B,C) <t>Microarray</t> analysis was performed with RNA purified from E14.5 control and dTg mouse embryos. The 10 most upregulated (B) and 10 most downregulated GO terms (C) are shown. (D) A heat map showing the dysregulated genes involved in cell cycle progression.
    Microarray Service, supplied by Phalanx Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/biotech+microarray+service/microarray+service/pmc07063104-247-0-5
    Average 90 stars, based on 1 article reviews
    microarray service - by Bioz Stars, 2026-09
    90/100 stars

    Images

    1) Product Images from "Contribution of Increased Expression of Yin Yang 2 to Development of Cardiomyopathy"

    Article Title: Contribution of Increased Expression of Yin Yang 2 to Development of Cardiomyopathy

    Journal: Frontiers in Molecular Biosciences

    doi: 10.3389/fmolb.2020.00035

    Impairedcell proliferation in double transgenic (dTg) mouse hearts. (A) Right panel: immunofluorescence staining was performed with sections from E14.5 control and dTg mouse embryos by using anti-pH3 (pH3: green, a cell proliferation marker) and anti-cTnT-AF647 (cTnT: red, a cardiomyocyte marker). DAPI (blue) was used for staining nuclei. Arrows indicate pH3+/cTnT+cardiomyocytes. Arrowheads indicateexamples of stained red blood cells. The left panel shows the statistical analysis of the data shown in the right panel of (A) . Cont, control. Four randomly selected fields from each sample were scored for pH3 + /cTnT + cardiomyocytes ( n = 3 per group). (B,C) Microarray analysis was performed with RNA purified from E14.5 control and dTg mouse embryos. The 10 most upregulated (B) and 10 most downregulated GO terms (C) are shown. (D) A heat map showing the dysregulated genes involved in cell cycle progression.
    Figure Legend Snippet: Impairedcell proliferation in double transgenic (dTg) mouse hearts. (A) Right panel: immunofluorescence staining was performed with sections from E14.5 control and dTg mouse embryos by using anti-pH3 (pH3: green, a cell proliferation marker) and anti-cTnT-AF647 (cTnT: red, a cardiomyocyte marker). DAPI (blue) was used for staining nuclei. Arrows indicate pH3+/cTnT+cardiomyocytes. Arrowheads indicateexamples of stained red blood cells. The left panel shows the statistical analysis of the data shown in the right panel of (A) . Cont, control. Four randomly selected fields from each sample were scored for pH3 + /cTnT + cardiomyocytes ( n = 3 per group). (B,C) Microarray analysis was performed with RNA purified from E14.5 control and dTg mouse embryos. The 10 most upregulated (B) and 10 most downregulated GO terms (C) are shown. (D) A heat map showing the dysregulated genes involved in cell cycle progression.

    Techniques Used: Transgenic Assay, Immunofluorescence, Staining, Control, Marker, Microarray, Purification

    Related Articles

    Microarray:

    Article Title: Contribution of Increased Expression of Yin Yang 2 to Development of Cardiomyopathy
    Article Snippet: .. Microarray service was provided by Phalanx Biotech (OneArray Express, San Diego, CA, United States). ..

    Article Title: Enhanced desumoylation in murine hearts by overexpressed SENP2 leads to congenital heart defects and cardiac dysfunction.
    Article Snippet: .. Microarray service was provided by Phalanx Biotech (OneArray Express). .. Reverse transcription reaction was performed using 1 μg total RNA per reaction and cloned reverse transcriptase, followed by either semiquantitative PCR or qPCR (MX3000, Stratagene) using the following gene-specific primers: SENP2: forward, 5′ GCTAAGGTTCTCGGCACCATT 3′; reverse, 5′ ATTACAAGCAGAAGACACCATG 3′.

    Article Title: Conditional Ablation of Ezh2 in Murine Hearts Reveals Its Essential Roles in Endocardial Cushion Formation, Cardiomyocyte Proliferation and Survival
    Article Snippet: .. Microarray service was provided by Phalanx Biotech (OneArray Express) with three samples per group, and each sample was analyzed in triplicate. .. Reverse transcription reaction was carried out using 1 μg total RNA, cloned reverse transcriptase (Invitrogen) and Oligo dT, which generated a final 50 μl volume reaction to generate the complementary DNA (cDNA).



    Similar Products

    biotech microarray service  (Miltenyi Biotec)
    90
    Miltenyi Biotec biotech microarray service
    Biotech Microarray Service, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/biotech+microarray+service/agilent+human+genome+oligo+microarrays/pm37835445-42-7-9
    Average 90 stars, based on 1 article reviews
    biotech microarray service - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results