Review



antibody to upf1 nbp1-05967  (Novus Biologicals)


Bioz Verified Symbol Novus Biologicals is a verified supplier
Bioz Manufacturer Symbol Novus Biologicals manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Novus Biologicals antibody to upf1 nbp1-05967
    Antibody To Upf1 Nbp1 05967, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/NBP1-05967/anti+upf1/pm38982067-386-7-13
    Average 90 stars, based on 1 article reviews
    antibody to upf1 nbp1-05967 - by Bioz Stars, 2026-11
    90/100 stars

    Images

    Related Articles

    Western Blot:

    Article Title: UPF1 plays critical roles in early B cell development.
    Article Snippet: Membranes were incubated with indicated primary antibodies and HRP-coupled secondary antibodies (NA9340; GE Healthcare). .. The following primary antibodies were used for immunoblot analysis: antibody to UPF1 (NBP1-05967, Novus biologicals), Phospho-UPF1(071016, Merck), β-actin (sc-1615, Santa Cruz) The complete list of antibodies used in this study can be found in Supplementary table 2. .. Flow cytometry analysis and isolation of B cell progenitors Single-cell suspension of splenocytes or BM cells were stained with Fixable Viability Dye eFluor 450, 506, or 780 (65-0863-14, 65-0866-14, or 65-0865-14, respectively, eBioscience) for 30min at 4 °C and indicated antibody for 30min at 4 °C, followed by the staining with fluorescent-labeled streptavidin (405225, Biolegend) for 30min.

    other:

    Article Title: Analysis and generation of B cell specific Upf1 deficient mice Enrichment score plot of down-regulated genes in Upf1-deficient early LPre-B cells Loss of IFNαR1 signaling does not impact B cell development. Genetic pre-arrangement of Igh locus rescued early to late LPre B cell differentiation in Upf1-cKO mice Genetic pre-arrangement of Igh locus did not rescue the splenic B cell population in Upf1-cKO mice Transcriptome analysis of Upf1-cKO/IghB1-8hi early LPre- and sPre-B cells Identifying UPF1-target RNAs
    Article Snippet: Genotyping for Upf1-Flox forward GAATTGGTGGCATGGGTCCCATATCCCAG Genotyping for Upf1-Flox reverse GACTCTTCCTGGCCTTGAGCCTGGATG VHJ558 forward CGAGCTCTCCARCACAGCCTWCATGCARCTCARC VH7183 forward CGGTACCAAGAASAMCCTGTWCCTGCAAATGASC DH forward TTCAAAGCACAATGCCTGGCT JH3 reverse GTCTAGATTCTCACAAGAGTCCGATAGACCCTGG Cμ forward TGGCCATGGGCTGCCTAGCCCGGGACTT Cμ reverse GCCTGACTGAGCTCACACAAGGAGGA Vk forward GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC Jk reverse CTCATTCCTGTTGAAGCTCTTGACAATGGG Supplementary Table 1 List of primers used for PCR Supplementary Table 3 List of primers used for RT-qPCR Forward Reverse 18S rRNA CGGACAGGATTGACAGATTG CAAATCGCTCCACCAAGTAA mouse Upf1 GCTGAACTTCGAGGAAGATG CTTCCTTGCATTTTGCCCTC mouse Gas5 CAGGTATTAATGGGTCACCTC CTTCTATTTGAGCCTCCATCC mouse Mx1 GATCCGACTTCACTTCCAGATGG CATCTCAGTGGTAGTCAACCC mouse Mx2 TTCACCAGGCTCCGAAAAGAG ACAAACCCTGGCAATTCTCG Antibody Cat# Company Clone Application Dilution anti-Upf1 NBP1-05967 Novus biologicals Polyclonal Immunoblot 1:1000 anti-phospho-Upf1 07-1016 Merck Polyclonal Immunoblot 1:1000 anti-β-actin sc-1615 Santa Cruz Polyclonal Immunoblot 1:2000 anti-Mouse IgG NA9310 Cytiva Polyclonal Immunoblot 1:2000 anti-Rabbit IgG NA9340 Cytiva Polyclonal Immunoblot 1:2000 Biotin anti-mouse CD2 100103 Biolegend RM2-5 Flow cytometry 1:300 PerCP/Cy5.5 anti-mouse CD19 152405 Biolegend 1D3 Flow cytometry 1:200 FITC anti-mouse CD19 115506 Biolegend 6D5 Flow cytometry 1:200 Alexa Fluor 700 anti-mouse CD19 115527 Biolegend 6D5 Flow cytometry 1:200 APC Rat Anti-Mouse CD19 550992 BD Pharmingen 1D3 Flow cytometry 1:200 APC anti-mouse CD25 102011 Biolegend PC61 Flow cytometry 1:200 PE Rat Anti-Mouse CD43 561857 BD Pharmingen S7 Flow cytometry 1:200 FITC anti-mouse IgM 406505 Biolegend RMM-1 Flow cytometry 1:200 APC anti-mouse IgM 406509 Biolegend RMM-1 Flow cytometry 1:200 PE-Cy7 Rat Anti-Mouse CD45R/B220 552772 BD Pharmingen RA3-6B2 Flow cytometry 1:200 FITC anti-mouse/human CD45R/B220 103206 Biolegend RA3-6B2 Flow cytometry 1:200 PE anti-mouse/human CD45R/B220 103208 Biolegend RA3-6B2 Flow cytometry 1:200 PE anti-mouse CD117 (c-Kit) 105807 Biolegend 2B8 Flow cytometry 1:200 PerCP Hamster Anti-Mouse CD3e 553067 BD Pharmingen 145-2C11 Flow cytometry 1:100 PerCP/Cy5.5 anti-mouse/human CD11b 101228 Biolegend M1/70 Flow cytometry 1:100 PerCP anti-mouse CD11c 117326 Biolegend N418 Flow cytometry 1:100 PerCP anti-mouse F4/80 123125 Biolegend BM8 Flow cytometry 1:100 PerCP/Cy5.5 anti-mouse TER-119 116227 Biolegend TER-119 Flow cytometry 1:100 Brilliant Violet 421 Streptavidin 405225 Biolegend ー Flow cytometry 1:400 Supplementary Table 2 List of antibodies

    Article Title: Stabilization of lncRNA GAS5 by a Small Molecule and Its Implications in Diabetic Adipocytes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies RNA polymerase II antibody Novus Cat# NBP1-70155; RRID: AB_11014485 SNRNP70 antibody Novus/Millipore Cat# 03-103; RRID: AB_11210069 IgG antibody Sigma-Aldrich Cat# A9169; RRID: AB_258434 UPF1 antibody Novus Cat# NB100-368; RRID: AB_2213199 Biological Samples White adipose tissue Tampa General Hospital, Dr. Murr.



    Similar Products

    anti upf1  (Novus Biologicals)
    93
    Novus Biologicals anti upf1
    Anti Upf1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/NBP1-05967/RENT1%2FUPF1%2FhUPF1+Antibody/pmc11233602__41467_2024_50032_MOESM7_ESM-54-54-55
    Average 93 stars, based on 1 article reviews
    anti upf1 - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    anti upf1 nbp1 05967 novus biologicals polyclonal immunoblot  (Novus Biologicals)
    93
    Novus Biologicals anti upf1 nbp1 05967 novus biologicals polyclonal immunoblot
    Anti Upf1 Nbp1 05967 Novus Biologicals Polyclonal Immunoblot, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/NBP1-05967/RENT1%2FUPF1%2FhUPF1+Antibody/pmc11233602__41467_2024_50032_MOESM1_ESM-73-80-82
    Average 93 stars, based on 1 article reviews
    anti upf1 nbp1 05967 novus biologicals polyclonal immunoblot - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    antibody to upf1  (Novus Biologicals)
    93
    Novus Biologicals antibody to upf1
    Fig. 4 | <t>UPF1</t> is necessary for Igh VH-DHJH recombination at early LPre-B stage. a–d The transcript amount of Ighv (a), Ighm (b), Ighj (c), and Ighd (d) in Upf1-cKO and Ctrl early LPre-B cells. The data were obtained from the RNA-seq shown in Fig. 2 (n = 3). Each bar represents the mean ± SD from biological replicates. e Schematic illustration of germline Igh locus. Colored arrows indicate each primer used in PCR analysis in (f). f PCR assay amplifying recombined Igh as shown in (e) using the DNA derived from Upf1-cKO and Ctrl early LPre-B cells. Genome DNA derived from the tail of the WT mouse was used as a negative control. Results are representative of at
    Antibody To Upf1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/NBP1-05967/RENT1%2FUPF1%2FhUPF1+Antibody/pm38982067-386-9-13
    Average 93 stars, based on 1 article reviews
    antibody to upf1 - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    antibody to upf1 nbp1-05967  (Novus Biologicals)
    90
    Novus Biologicals antibody to upf1 nbp1-05967
    Fig. 4 | <t>UPF1</t> is necessary for Igh VH-DHJH recombination at early LPre-B stage. a–d The transcript amount of Ighv (a), Ighm (b), Ighj (c), and Ighd (d) in Upf1-cKO and Ctrl early LPre-B cells. The data were obtained from the RNA-seq shown in Fig. 2 (n = 3). Each bar represents the mean ± SD from biological replicates. e Schematic illustration of germline Igh locus. Colored arrows indicate each primer used in PCR analysis in (f). f PCR assay amplifying recombined Igh as shown in (e) using the DNA derived from Upf1-cKO and Ctrl early LPre-B cells. Genome DNA derived from the tail of the WT mouse was used as a negative control. Results are representative of at
    Antibody To Upf1 Nbp1 05967, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/NBP1-05967/anti+upf1/pm38982067-386-7-13
    Average 90 stars, based on 1 article reviews
    antibody to upf1 nbp1-05967 - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    NBP1-06712  (Novus Biologicals)
    94
    Novus Biologicals NBP1-06712
    Fig. 4 | <t>UPF1</t> is necessary for Igh VH-DHJH recombination at early LPre-B stage. a–d The transcript amount of Ighv (a), Ighm (b), Ighj (c), and Ighd (d) in Upf1-cKO and Ctrl early LPre-B cells. The data were obtained from the RNA-seq shown in Fig. 2 (n = 3). Each bar represents the mean ± SD from biological replicates. e Schematic illustration of germline Igh locus. Colored arrows indicate each primer used in PCR analysis in (f). f PCR assay amplifying recombined Igh as shown in (e) using the DNA derived from Upf1-cKO and Ctrl early LPre-B cells. Genome DNA derived from the tail of the WT mouse was used as a negative control. Results are representative of at
    Nbp1 06712, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/NBP1-05967/Flagellin+Antibody+(06)/pmc06283239-124-0-9
    Average 94 stars, based on 1 article reviews
    NBP1-06712 - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier
    anti upf2  (Novus Biologicals)
    93
    Novus Biologicals anti upf2
    Fig. 4 | <t>UPF1</t> is necessary for Igh VH-DHJH recombination at early LPre-B stage. a–d The transcript amount of Ighv (a), Ighm (b), Ighj (c), and Ighd (d) in Upf1-cKO and Ctrl early LPre-B cells. The data were obtained from the RNA-seq shown in Fig. 2 (n = 3). Each bar represents the mean ± SD from biological replicates. e Schematic illustration of germline Igh locus. Colored arrows indicate each primer used in PCR analysis in (f). f PCR assay amplifying recombined Igh as shown in (e) using the DNA derived from Upf1-cKO and Ctrl early LPre-B cells. Genome DNA derived from the tail of the WT mouse was used as a negative control. Results are representative of at
    Anti Upf2, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/NBP1-05967/RENT1%2FUPF1%2FhUPF1+Antibody/pmc04126864-153-4-11
    Average 93 stars, based on 1 article reviews
    anti upf2 - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    Fig. 4 | UPF1 is necessary for Igh VH-DHJH recombination at early LPre-B stage. a–d The transcript amount of Ighv (a), Ighm (b), Ighj (c), and Ighd (d) in Upf1-cKO and Ctrl early LPre-B cells. The data were obtained from the RNA-seq shown in Fig. 2 (n = 3). Each bar represents the mean ± SD from biological replicates. e Schematic illustration of germline Igh locus. Colored arrows indicate each primer used in PCR analysis in (f). f PCR assay amplifying recombined Igh as shown in (e) using the DNA derived from Upf1-cKO and Ctrl early LPre-B cells. Genome DNA derived from the tail of the WT mouse was used as a negative control. Results are representative of at

    Journal: Nature communications

    Article Title: UPF1 plays critical roles in early B cell development.

    doi: 10.1038/s41467-024-50032-6

    Figure Lengend Snippet: Fig. 4 | UPF1 is necessary for Igh VH-DHJH recombination at early LPre-B stage. a–d The transcript amount of Ighv (a), Ighm (b), Ighj (c), and Ighd (d) in Upf1-cKO and Ctrl early LPre-B cells. The data were obtained from the RNA-seq shown in Fig. 2 (n = 3). Each bar represents the mean ± SD from biological replicates. e Schematic illustration of germline Igh locus. Colored arrows indicate each primer used in PCR analysis in (f). f PCR assay amplifying recombined Igh as shown in (e) using the DNA derived from Upf1-cKO and Ctrl early LPre-B cells. Genome DNA derived from the tail of the WT mouse was used as a negative control. Results are representative of at

    Article Snippet: The following primary antibodies were used for immunoblot analysis: antibody to UPF1 (NBP1-05967, Novus biologicals), Phospho-UPF1(071016, Merck), β-actin (sc-1615, Santa Cruz) The complete list of antibodies used in this study can be found in Supplementary table 2.

    Techniques: RNA Sequencing, Derivative Assay, Negative Control