Review




Structured Review

Gene Codes Inc sequencer 4 7 software
Sequencer 4 7 Software, supplied by Gene Codes Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7+software+code/sequencer+software/pm41751604-60-9-12
Average 86 stars, based on 1 article reviews
sequencer 4 7 software - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

Software:

Article Title: Deciphering Silence: Functional Studies of GCK Synonymous and Nonsense Variants and Their Importance in Understanding Diabetes.
Article Snippet: Sequences were obtained with the Big Dye Terminator Cycle Sequencing Kit according to the provided protocol and run on a 3130xl Genetic Analyzer (Thermo Scientific, Waltham, MA, USA). .. The analysis of the sequences was performed by the Sequencer 4.7 software (Gene Codes Corporation, Ann Arbor, MI, USA). ..

Article Title: Pathogenic SGMS2 variants are not a common cause of early-onset osteoporosis among Finnish patients
Article Snippet: Primers for PCR were designed using Primer3 software and PCR was performed using DreamTaqTM DNA Polymerase (Thermo Fisher Scientific) according to standard protocol. .. Chromatograms were analyzed with Sequencer v5.3 software (Gene Codes Corporation, USA). ..

Article Title: Morphological and Cyto-Nuclear Conflicting Signals Across Non-Sister Lineages in Darkling Beetles (Tenebrionidae: Akis )
Article Snippet: PCR for COI was run with the following conditions: initial denaturation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, 42–44 °C for 45 s and 72 °C for 1 min, and a final extension step at 72 °C for 5 min. PCR cycling profile for H3 was: initial denaturation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 40 s, 50 °C for 40 s and 72 °C for 40 s, and a final extension step at 72 °C for 5 min. PCR products were checked in a 1.5% agarose gel and the products of expected length were purified with ethanol–sodium acetate and sequenced in automatic Sanger sequencers by SECUGEN (Madrid, Spain). .. Sequences were compiled and revised with the software Sequencer v.5.4.8 (Gene Codes Corporation, Ann Arbor, MI, USA), and aligned manually. ..

Article Title: Comprehensive Profiling of T- and B-Cell Receptor Repertoires Demonstrates Impaired Developmental and Activation of Adaptive Immunity in DOCK8 Deficiency.
Article Snippet: .. Resulting sequences were evaluated using Sequencer v5.0 software (Gene Codes Corporation). ..

Article Title: Deciphering Silence: Functional Studies of GCK Synonymous and Nonsense Variants and Their Importance in Understanding Diabetes.
Article Snippet: .. The presence of variants was confirmed by direct Sanger sequencing: PCR products were purified by enzymatic digestion with Exo/SAP-IT (Thermo Scientific, Waltham, MA, USA) and sequenced with the Big Dye Terminator Cycle Sequencing Kit (Thermo Scientific, MA, USA) according to the provided protocol; sequencing reactions were run on a 3130xl Genetic Analyzer (Thermo Scientific, MA, USA) and analyzed with the Sequencer 4.7 software (version 4.7; Gene Codes Corporation, Ann Arbor, MI, USA). ..

Article Title: An intronic variant in Ferredoxin Reductase (FDXR) creates a cryptic exon in Quarter Horses with Equine Juvenile Spinocerebellar Ataxia.
Article Snippet: .. Resulting sequences were aligned to EquCab3.0 (http://www.ncbi.nlm.nih.gov/genome/145) and analyzed with SEQUENCER software (Gene Codes Corp.). ..

Article Title: Lewis antigen and antibody testing as practical first-line approaches for detecting CA19-9 non-producers.
Article Snippet: a Department of Laboratory Medicine and Genetics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, South Korea b Department of Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, South Korea c Department of Health Sciences and Technology, Samsung Advanced Institute for Health Sciences and Technology (SAHIST), Sungkyunkwan University, Seoul, South Korea

Sequencing:

Article Title: Host genetic background influences the severity of disease in Schistosoma haematobium infections.
Article Snippet: Each cycle included a DNA denaturation step at 96 C for 45 s, followed by a primer hybridization step at 58 C for 45 s, and an elongation step at 74 C for 1 min 10 s. The program continued and ended with a final extension step at 74 C for 7 min. All PCR products successfully amplified for both primer pairs were purified and sequenced with primers BS_TNF1R: 50–ATCTGCACCCTCGATGAAGCC–30 and BS_TNF2R: 50–CACCTTCCAGGCATTCAACAGC–30, respectively on an Applied Biosystems genetic analyzer at Genoscreen (Lille, France). .. Successfully sequenced DNA sequences were assembled and manually edited using Sequencer, version 4.5 (Gene Codes Corporation; http://genecodes.com) to remove ambiguities and sequencing errors. ..

Article Title: Deciphering Silence: Functional Studies of GCK Synonymous and Nonsense Variants and Their Importance in Understanding Diabetes.
Article Snippet: .. The presence of variants was confirmed by direct Sanger sequencing: PCR products were purified by enzymatic digestion with Exo/SAP-IT (Thermo Scientific, Waltham, MA, USA) and sequenced with the Big Dye Terminator Cycle Sequencing Kit (Thermo Scientific, MA, USA) according to the provided protocol; sequencing reactions were run on a 3130xl Genetic Analyzer (Thermo Scientific, MA, USA) and analyzed with the Sequencer 4.7 software (version 4.7; Gene Codes Corporation, Ann Arbor, MI, USA). ..

Article Title: Lewis antigen and antibody testing as practical first-line approaches for detecting CA19-9 non-producers.
Article Snippet: a Department of Laboratory Medicine and Genetics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, South Korea b Department of Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, South Korea c Department of Health Sciences and Technology, Samsung Advanced Institute for Health Sciences and Technology (SAHIST), Sungkyunkwan University, Seoul, South Korea

Polymerase Chain Reaction:

Article Title: Deciphering Silence: Functional Studies of GCK Synonymous and Nonsense Variants and Their Importance in Understanding Diabetes.
Article Snippet: .. The presence of variants was confirmed by direct Sanger sequencing: PCR products were purified by enzymatic digestion with Exo/SAP-IT (Thermo Scientific, Waltham, MA, USA) and sequenced with the Big Dye Terminator Cycle Sequencing Kit (Thermo Scientific, MA, USA) according to the provided protocol; sequencing reactions were run on a 3130xl Genetic Analyzer (Thermo Scientific, MA, USA) and analyzed with the Sequencer 4.7 software (version 4.7; Gene Codes Corporation, Ann Arbor, MI, USA). ..

Purification:

Article Title: Deciphering Silence: Functional Studies of GCK Synonymous and Nonsense Variants and Their Importance in Understanding Diabetes.
Article Snippet: .. The presence of variants was confirmed by direct Sanger sequencing: PCR products were purified by enzymatic digestion with Exo/SAP-IT (Thermo Scientific, Waltham, MA, USA) and sequenced with the Big Dye Terminator Cycle Sequencing Kit (Thermo Scientific, MA, USA) according to the provided protocol; sequencing reactions were run on a 3130xl Genetic Analyzer (Thermo Scientific, MA, USA) and analyzed with the Sequencer 4.7 software (version 4.7; Gene Codes Corporation, Ann Arbor, MI, USA). ..



Similar Products

99
Malvern Panalytical computer code data collection malvern zetasizer nano software version 7 12
Computer Code Data Collection Malvern Zetasizer Nano Software Version 7 12, supplied by Malvern Panalytical, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7+software+code/Zetasizer+Advance/pmc11315999__41467_2024_51056_MOESM3_ESM-9-8-12
Average 99 stars, based on 1 article reviews
computer code data collection malvern zetasizer nano software version 7 12 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Tree Star Inc algorithms stepone software applied biosystem v2 3 graphpad prism graphpad version 9 5 0 flowjo v10 7 treestar v10 7 original code
Algorithms Stepone Software Applied Biosystem V2 3 Graphpad Prism Graphpad Version 9 5 0 Flowjo V10 7 Treestar V10 7 Original Code, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7+software+code/flowjo10/pm36736290-205-90-103
Average 86 stars, based on 1 article reviews
algorithms stepone software applied biosystem v2 3 graphpad prism graphpad version 9 5 0 flowjo v10 7 treestar v10 7 original code - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

97
Tecan Systems computer code data collection tecan magellan 7 0 software
Computer Code Data Collection Tecan Magellan 7 0 Software, supplied by Tecan Systems, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7+software+code/Magellan/pmc08617063__41467_2021_27275_MOESM3_ESM-8-8-12
Average 97 stars, based on 1 article reviews
computer code data collection tecan magellan 7 0 software - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

90
Noldus Information Technology automated facial coding software facereader 7
Automated Facial Coding Software Facereader 7, supplied by Noldus Information Technology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7+software+code/automated+facial+coding+software+facereader+6/pmc08505661-111-9-14
Average 90 stars, based on 1 article reviews
automated facial coding software facereader 7 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

96
Bio-Rad computer code data collection none data analysis quantasoft analysis software v 1 7 4 0917
Computer Code Data Collection None Data Analysis Quantasoft Analysis Software V 1 7 4 0917, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7+software+code/Computer/pm32340022-189-8-19
Average 96 stars, based on 1 article reviews
computer code data collection none data analysis quantasoft analysis software v 1 7 4 0917 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

99
Illumina Inc computer code data collection miseq software v2 6 nextseq system suite v2 1 3 data analysis usearch v 7 0 1090 win64 mothur 1 36 1 r 3 6 1 lefse
Computer Code Data Collection Miseq Software V2 6 Nextseq System Suite V2 1 3 Data Analysis Usearch V 7 0 1090 Win64 Mothur 1 36 1 R 3 6 1 Lefse, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7+software+code/MiSeq+System/pmc07264248__42003_2020_1004_MOESM13_ESM-6-8-12
Average 99 stars, based on 1 article reviews
computer code data collection miseq software v2 6 nextseq system suite v2 1 3 data analysis usearch v 7 0 1090 win64 mothur 1 36 1 r 3 6 1 lefse - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

90
Noldus Information Technology professional software for facial coding noldus fr version 7
Professional Software For Facial Coding Noldus Fr Version 7, supplied by Noldus Information Technology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7+software+code/professional+software+for+facial+coding+noldus+fr+version+7/pmc06797095-130-9-8
Average 90 stars, based on 1 article reviews
professional software for facial coding noldus fr version 7 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

86
Thermo Fisher computer code data collection attune software version 2 7
Computer Code Data Collection Attune Software Version 2 7, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7+software+code/pm30377371-412-8-16
Average 86 stars, based on 1 article reviews
computer code data collection attune software version 2 7 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

99
Malvern Panalytical computer code data collection zetasizer software 7 12
Computer Code Data Collection Zetasizer Software 7 12, supplied by Malvern Panalytical, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7+software+code/Zetasizer+Advance/pmc06478844__41467_2019_9763_MOESM7_ESM-8-8-15
Average 99 stars, based on 1 article reviews
computer code data collection zetasizer software 7 12 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

90
qsr international software-assisted coding nvivo 7
Software Assisted Coding Nvivo 7, supplied by qsr international, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7+software+code/nvivo+software/pm20059675-52-8-11
Average 90 stars, based on 1 article reviews
software-assisted coding nvivo 7 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results