Molecular Weight:Article Title: Surface Plasmon Resonance (SPR) Workflow for Comparative Analysis of Nanobody Variants Binding to Lysozyme as a Model Ligand
Article Snippet: .. Samples (see Basic Protocol ) 2× SDS buffer (Novex Tris‐Glycine SDS Sample Buffer (2×), Thermo Fisher Scientific, cat. no. LC2676, or equivalent) 1× Tris‐glycine SDS buffer (Novex Tris‐Glycine SDS Running Buffer, Thermo Fisher Scientific, cat. no. LC26754, or equivalent) Protein molecular‐weight marker (PageRuler Plus Prestained Protein Ladder, Thermo Fisher Scientific, cat. no. 26619, or equivalent) Coomassie blue stain (Imperial Protein Stain, Thermo Fisher Scientific, cat. no. 24617; PageBlue Protein Staining Solution, Thermo Fisher Scientific, cat. no. 24620; or similar reagent) Distilled water Transfer buffer (Pierce 1‐Step Transfer Buffer, Thermo Fisher Scientific, cat. no. 84731 × 5, or equivalent) Blocking buffer (Pierce Fast Blocking Buffer, Thermo Fisher Scientific, cat. no. 37575, or equivalent) Antibody solution: anti‐6×His‐Tag antibody solution (see recipe; make fresh) or Strep‐Tactin HRP solution (see recipe; make fresh) Wash buffer (Pierce Fast Wash Buffer, Thermo Fisher Scientific, cat. no. 37577, or equivalent) Chemiluminescent reagents (Thermo Scientific, cat. no. 34580, or equivalent) 50 mM TEAB/50% (v/v) ACN (see recipe; make fresh) 100% acetonitrile (ACN; Sigma‐Aldrich, cat. no. 34851) 100 mM TEAB (see recipe) 1 M DTT (see recipe) 1 M IAA (see recipe) 10 ng/μl trypsin (see recipe; make fresh) 10% (v/v) TFA (see recipe) 1% (v/v) TFA/50% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) TFA/75% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) formic acid (see recipe) 95°C water bath or dry bath Mini centrifuge Precast or custom‐made 4%‐20% protein gels (Novex Tris‐Glycine Mini Protein Gels, 4%‐20%, 1.0 mm, WedgeWell format, Invitrogen, cat. no. 15466694) Electrophoresis system, including gel box Nitrocellulose transfer stacks (Power Blotter Pre‐cut Membranes and Filters, nitrocellulose, Invitrogen, cat. no. PB7320) Black blot boxes or transparent trays Orbital shaker Semi‐dry transfer system (Invitrogen Power Blotter or equivalent) Blotting roller Aluminum foil Imaging system 1.5 ml Eppendorf tubes 37°C thermomixer (Eppendorf ThermoMixer C) 37°C centrifugal vacuum concentrator Vortex MASCOT v2.3 software (Matrix Sciences) Additional reagents or equipment for LC‐MS/MS (e.g., Orbitrap Fusion Lumos Tribrid Mass Spectrometer, Thermo Fisher Scientific) ..
Marker:Article Title: Surface Plasmon Resonance (SPR) Workflow for Comparative Analysis of Nanobody Variants Binding to Lysozyme as a Model Ligand
Article Snippet: .. Samples (see Basic Protocol ) 2× SDS buffer (Novex Tris‐Glycine SDS Sample Buffer (2×), Thermo Fisher Scientific, cat. no. LC2676, or equivalent) 1× Tris‐glycine SDS buffer (Novex Tris‐Glycine SDS Running Buffer, Thermo Fisher Scientific, cat. no. LC26754, or equivalent) Protein molecular‐weight marker (PageRuler Plus Prestained Protein Ladder, Thermo Fisher Scientific, cat. no. 26619, or equivalent) Coomassie blue stain (Imperial Protein Stain, Thermo Fisher Scientific, cat. no. 24617; PageBlue Protein Staining Solution, Thermo Fisher Scientific, cat. no. 24620; or similar reagent) Distilled water Transfer buffer (Pierce 1‐Step Transfer Buffer, Thermo Fisher Scientific, cat. no. 84731 × 5, or equivalent) Blocking buffer (Pierce Fast Blocking Buffer, Thermo Fisher Scientific, cat. no. 37575, or equivalent) Antibody solution: anti‐6×His‐Tag antibody solution (see recipe; make fresh) or Strep‐Tactin HRP solution (see recipe; make fresh) Wash buffer (Pierce Fast Wash Buffer, Thermo Fisher Scientific, cat. no. 37577, or equivalent) Chemiluminescent reagents (Thermo Scientific, cat. no. 34580, or equivalent) 50 mM TEAB/50% (v/v) ACN (see recipe; make fresh) 100% acetonitrile (ACN; Sigma‐Aldrich, cat. no. 34851) 100 mM TEAB (see recipe) 1 M DTT (see recipe) 1 M IAA (see recipe) 10 ng/μl trypsin (see recipe; make fresh) 10% (v/v) TFA (see recipe) 1% (v/v) TFA/50% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) TFA/75% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) formic acid (see recipe) 95°C water bath or dry bath Mini centrifuge Precast or custom‐made 4%‐20% protein gels (Novex Tris‐Glycine Mini Protein Gels, 4%‐20%, 1.0 mm, WedgeWell format, Invitrogen, cat. no. 15466694) Electrophoresis system, including gel box Nitrocellulose transfer stacks (Power Blotter Pre‐cut Membranes and Filters, nitrocellulose, Invitrogen, cat. no. PB7320) Black blot boxes or transparent trays Orbital shaker Semi‐dry transfer system (Invitrogen Power Blotter or equivalent) Blotting roller Aluminum foil Imaging system 1.5 ml Eppendorf tubes 37°C thermomixer (Eppendorf ThermoMixer C) 37°C centrifugal vacuum concentrator Vortex MASCOT v2.3 software (Matrix Sciences) Additional reagents or equipment for LC‐MS/MS (e.g., Orbitrap Fusion Lumos Tribrid Mass Spectrometer, Thermo Fisher Scientific) ..
Staining:Article Title: Surface Plasmon Resonance (SPR) Workflow for Comparative Analysis of Nanobody Variants Binding to Lysozyme as a Model Ligand
Article Snippet: .. Samples (see Basic Protocol ) 2× SDS buffer (Novex Tris‐Glycine SDS Sample Buffer (2×), Thermo Fisher Scientific, cat. no. LC2676, or equivalent) 1× Tris‐glycine SDS buffer (Novex Tris‐Glycine SDS Running Buffer, Thermo Fisher Scientific, cat. no. LC26754, or equivalent) Protein molecular‐weight marker (PageRuler Plus Prestained Protein Ladder, Thermo Fisher Scientific, cat. no. 26619, or equivalent) Coomassie blue stain (Imperial Protein Stain, Thermo Fisher Scientific, cat. no. 24617; PageBlue Protein Staining Solution, Thermo Fisher Scientific, cat. no. 24620; or similar reagent) Distilled water Transfer buffer (Pierce 1‐Step Transfer Buffer, Thermo Fisher Scientific, cat. no. 84731 × 5, or equivalent) Blocking buffer (Pierce Fast Blocking Buffer, Thermo Fisher Scientific, cat. no. 37575, or equivalent) Antibody solution: anti‐6×His‐Tag antibody solution (see recipe; make fresh) or Strep‐Tactin HRP solution (see recipe; make fresh) Wash buffer (Pierce Fast Wash Buffer, Thermo Fisher Scientific, cat. no. 37577, or equivalent) Chemiluminescent reagents (Thermo Scientific, cat. no. 34580, or equivalent) 50 mM TEAB/50% (v/v) ACN (see recipe; make fresh) 100% acetonitrile (ACN; Sigma‐Aldrich, cat. no. 34851) 100 mM TEAB (see recipe) 1 M DTT (see recipe) 1 M IAA (see recipe) 10 ng/μl trypsin (see recipe; make fresh) 10% (v/v) TFA (see recipe) 1% (v/v) TFA/50% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) TFA/75% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) formic acid (see recipe) 95°C water bath or dry bath Mini centrifuge Precast or custom‐made 4%‐20% protein gels (Novex Tris‐Glycine Mini Protein Gels, 4%‐20%, 1.0 mm, WedgeWell format, Invitrogen, cat. no. 15466694) Electrophoresis system, including gel box Nitrocellulose transfer stacks (Power Blotter Pre‐cut Membranes and Filters, nitrocellulose, Invitrogen, cat. no. PB7320) Black blot boxes or transparent trays Orbital shaker Semi‐dry transfer system (Invitrogen Power Blotter or equivalent) Blotting roller Aluminum foil Imaging system 1.5 ml Eppendorf tubes 37°C thermomixer (Eppendorf ThermoMixer C) 37°C centrifugal vacuum concentrator Vortex MASCOT v2.3 software (Matrix Sciences) Additional reagents or equipment for LC‐MS/MS (e.g., Orbitrap Fusion Lumos Tribrid Mass Spectrometer, Thermo Fisher Scientific) ..
Blocking Assay:Article Title: Surface Plasmon Resonance (SPR) Workflow for Comparative Analysis of Nanobody Variants Binding to Lysozyme as a Model Ligand
Article Snippet: .. Samples (see Basic Protocol ) 2× SDS buffer (Novex Tris‐Glycine SDS Sample Buffer (2×), Thermo Fisher Scientific, cat. no. LC2676, or equivalent) 1× Tris‐glycine SDS buffer (Novex Tris‐Glycine SDS Running Buffer, Thermo Fisher Scientific, cat. no. LC26754, or equivalent) Protein molecular‐weight marker (PageRuler Plus Prestained Protein Ladder, Thermo Fisher Scientific, cat. no. 26619, or equivalent) Coomassie blue stain (Imperial Protein Stain, Thermo Fisher Scientific, cat. no. 24617; PageBlue Protein Staining Solution, Thermo Fisher Scientific, cat. no. 24620; or similar reagent) Distilled water Transfer buffer (Pierce 1‐Step Transfer Buffer, Thermo Fisher Scientific, cat. no. 84731 × 5, or equivalent) Blocking buffer (Pierce Fast Blocking Buffer, Thermo Fisher Scientific, cat. no. 37575, or equivalent) Antibody solution: anti‐6×His‐Tag antibody solution (see recipe; make fresh) or Strep‐Tactin HRP solution (see recipe; make fresh) Wash buffer (Pierce Fast Wash Buffer, Thermo Fisher Scientific, cat. no. 37577, or equivalent) Chemiluminescent reagents (Thermo Scientific, cat. no. 34580, or equivalent) 50 mM TEAB/50% (v/v) ACN (see recipe; make fresh) 100% acetonitrile (ACN; Sigma‐Aldrich, cat. no. 34851) 100 mM TEAB (see recipe) 1 M DTT (see recipe) 1 M IAA (see recipe) 10 ng/μl trypsin (see recipe; make fresh) 10% (v/v) TFA (see recipe) 1% (v/v) TFA/50% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) TFA/75% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) formic acid (see recipe) 95°C water bath or dry bath Mini centrifuge Precast or custom‐made 4%‐20% protein gels (Novex Tris‐Glycine Mini Protein Gels, 4%‐20%, 1.0 mm, WedgeWell format, Invitrogen, cat. no. 15466694) Electrophoresis system, including gel box Nitrocellulose transfer stacks (Power Blotter Pre‐cut Membranes and Filters, nitrocellulose, Invitrogen, cat. no. PB7320) Black blot boxes or transparent trays Orbital shaker Semi‐dry transfer system (Invitrogen Power Blotter or equivalent) Blotting roller Aluminum foil Imaging system 1.5 ml Eppendorf tubes 37°C thermomixer (Eppendorf ThermoMixer C) 37°C centrifugal vacuum concentrator Vortex MASCOT v2.3 software (Matrix Sciences) Additional reagents or equipment for LC‐MS/MS (e.g., Orbitrap Fusion Lumos Tribrid Mass Spectrometer, Thermo Fisher Scientific) ..
Article Title: TBL1X/TBL1XR1 govern β-cell identity through a PAX6-containing gene regulatory network
Article Snippet: For protein extraction, the cells were lysed in ice-cold lysis buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.6, 1% Triton X-100, 0.5% Sodium deoxycholate, 0.1% SDS) supplemented with PhosSTOP (Roche) and an EDTA-free protease inhibitor cocktail (Roche) for 15 min on ice. .. 15 μg of protein extracts were separated using tris-glycine gels (Novex WedgeWell 8–16% Tris-Glycine Mini Gels; Thermo Fisher Scientific) and blotted on nitrocellulose membranes (Amersham), followed by membrane blocking and incubation with primary antibodies overnight at 4 °C (Anti-Vinculin, Abcam, Cat# 129002, RRID: AB_11144129; anti-TBL1X, Abcam, Cat# ab24548, RRID: AB_2199904; anti-TBL1XR1, Santa Cruz, Cat# sc-517365; anti-PAX6, Cell Signaling Technology, Cat# 60433, RRID: AB_2797599). .. After the secondary antibody incubation at room temperature for 1 h (goat anti-rabbit HRP, BioRad, Cat# 1705046, RRID: AB_11125757; goat anti-mouse HRP, BioRad, Cat# 1706516, RRID: AB_2921252; IgG Fraction Monoclonal Mouse Anti-Rabbit IgG, light chain specific, Jackson Immunoresearch Lab, Cat# 213-032-177, RRID: AB_2339251), protein bands were visualized using Amersham ECL Prime and the ChemiDoc MP Imaging System (BioRad).
Electrophoresis:Article Title: Surface Plasmon Resonance (SPR) Workflow for Comparative Analysis of Nanobody Variants Binding to Lysozyme as a Model Ligand
Article Snippet: .. Samples (see Basic Protocol ) 2× SDS buffer (Novex Tris‐Glycine SDS Sample Buffer (2×), Thermo Fisher Scientific, cat. no. LC2676, or equivalent) 1× Tris‐glycine SDS buffer (Novex Tris‐Glycine SDS Running Buffer, Thermo Fisher Scientific, cat. no. LC26754, or equivalent) Protein molecular‐weight marker (PageRuler Plus Prestained Protein Ladder, Thermo Fisher Scientific, cat. no. 26619, or equivalent) Coomassie blue stain (Imperial Protein Stain, Thermo Fisher Scientific, cat. no. 24617; PageBlue Protein Staining Solution, Thermo Fisher Scientific, cat. no. 24620; or similar reagent) Distilled water Transfer buffer (Pierce 1‐Step Transfer Buffer, Thermo Fisher Scientific, cat. no. 84731 × 5, or equivalent) Blocking buffer (Pierce Fast Blocking Buffer, Thermo Fisher Scientific, cat. no. 37575, or equivalent) Antibody solution: anti‐6×His‐Tag antibody solution (see recipe; make fresh) or Strep‐Tactin HRP solution (see recipe; make fresh) Wash buffer (Pierce Fast Wash Buffer, Thermo Fisher Scientific, cat. no. 37577, or equivalent) Chemiluminescent reagents (Thermo Scientific, cat. no. 34580, or equivalent) 50 mM TEAB/50% (v/v) ACN (see recipe; make fresh) 100% acetonitrile (ACN; Sigma‐Aldrich, cat. no. 34851) 100 mM TEAB (see recipe) 1 M DTT (see recipe) 1 M IAA (see recipe) 10 ng/μl trypsin (see recipe; make fresh) 10% (v/v) TFA (see recipe) 1% (v/v) TFA/50% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) TFA/75% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) formic acid (see recipe) 95°C water bath or dry bath Mini centrifuge Precast or custom‐made 4%‐20% protein gels (Novex Tris‐Glycine Mini Protein Gels, 4%‐20%, 1.0 mm, WedgeWell format, Invitrogen, cat. no. 15466694) Electrophoresis system, including gel box Nitrocellulose transfer stacks (Power Blotter Pre‐cut Membranes and Filters, nitrocellulose, Invitrogen, cat. no. PB7320) Black blot boxes or transparent trays Orbital shaker Semi‐dry transfer system (Invitrogen Power Blotter or equivalent) Blotting roller Aluminum foil Imaging system 1.5 ml Eppendorf tubes 37°C thermomixer (Eppendorf ThermoMixer C) 37°C centrifugal vacuum concentrator Vortex MASCOT v2.3 software (Matrix Sciences) Additional reagents or equipment for LC‐MS/MS (e.g., Orbitrap Fusion Lumos Tribrid Mass Spectrometer, Thermo Fisher Scientific) ..
Imaging:Article Title: Surface Plasmon Resonance (SPR) Workflow for Comparative Analysis of Nanobody Variants Binding to Lysozyme as a Model Ligand
Article Snippet: .. Samples (see Basic Protocol ) 2× SDS buffer (Novex Tris‐Glycine SDS Sample Buffer (2×), Thermo Fisher Scientific, cat. no. LC2676, or equivalent) 1× Tris‐glycine SDS buffer (Novex Tris‐Glycine SDS Running Buffer, Thermo Fisher Scientific, cat. no. LC26754, or equivalent) Protein molecular‐weight marker (PageRuler Plus Prestained Protein Ladder, Thermo Fisher Scientific, cat. no. 26619, or equivalent) Coomassie blue stain (Imperial Protein Stain, Thermo Fisher Scientific, cat. no. 24617; PageBlue Protein Staining Solution, Thermo Fisher Scientific, cat. no. 24620; or similar reagent) Distilled water Transfer buffer (Pierce 1‐Step Transfer Buffer, Thermo Fisher Scientific, cat. no. 84731 × 5, or equivalent) Blocking buffer (Pierce Fast Blocking Buffer, Thermo Fisher Scientific, cat. no. 37575, or equivalent) Antibody solution: anti‐6×His‐Tag antibody solution (see recipe; make fresh) or Strep‐Tactin HRP solution (see recipe; make fresh) Wash buffer (Pierce Fast Wash Buffer, Thermo Fisher Scientific, cat. no. 37577, or equivalent) Chemiluminescent reagents (Thermo Scientific, cat. no. 34580, or equivalent) 50 mM TEAB/50% (v/v) ACN (see recipe; make fresh) 100% acetonitrile (ACN; Sigma‐Aldrich, cat. no. 34851) 100 mM TEAB (see recipe) 1 M DTT (see recipe) 1 M IAA (see recipe) 10 ng/μl trypsin (see recipe; make fresh) 10% (v/v) TFA (see recipe) 1% (v/v) TFA/50% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) TFA/75% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) formic acid (see recipe) 95°C water bath or dry bath Mini centrifuge Precast or custom‐made 4%‐20% protein gels (Novex Tris‐Glycine Mini Protein Gels, 4%‐20%, 1.0 mm, WedgeWell format, Invitrogen, cat. no. 15466694) Electrophoresis system, including gel box Nitrocellulose transfer stacks (Power Blotter Pre‐cut Membranes and Filters, nitrocellulose, Invitrogen, cat. no. PB7320) Black blot boxes or transparent trays Orbital shaker Semi‐dry transfer system (Invitrogen Power Blotter or equivalent) Blotting roller Aluminum foil Imaging system 1.5 ml Eppendorf tubes 37°C thermomixer (Eppendorf ThermoMixer C) 37°C centrifugal vacuum concentrator Vortex MASCOT v2.3 software (Matrix Sciences) Additional reagents or equipment for LC‐MS/MS (e.g., Orbitrap Fusion Lumos Tribrid Mass Spectrometer, Thermo Fisher Scientific) ..
Software:Article Title: Surface Plasmon Resonance (SPR) Workflow for Comparative Analysis of Nanobody Variants Binding to Lysozyme as a Model Ligand
Article Snippet: .. Samples (see Basic Protocol ) 2× SDS buffer (Novex Tris‐Glycine SDS Sample Buffer (2×), Thermo Fisher Scientific, cat. no. LC2676, or equivalent) 1× Tris‐glycine SDS buffer (Novex Tris‐Glycine SDS Running Buffer, Thermo Fisher Scientific, cat. no. LC26754, or equivalent) Protein molecular‐weight marker (PageRuler Plus Prestained Protein Ladder, Thermo Fisher Scientific, cat. no. 26619, or equivalent) Coomassie blue stain (Imperial Protein Stain, Thermo Fisher Scientific, cat. no. 24617; PageBlue Protein Staining Solution, Thermo Fisher Scientific, cat. no. 24620; or similar reagent) Distilled water Transfer buffer (Pierce 1‐Step Transfer Buffer, Thermo Fisher Scientific, cat. no. 84731 × 5, or equivalent) Blocking buffer (Pierce Fast Blocking Buffer, Thermo Fisher Scientific, cat. no. 37575, or equivalent) Antibody solution: anti‐6×His‐Tag antibody solution (see recipe; make fresh) or Strep‐Tactin HRP solution (see recipe; make fresh) Wash buffer (Pierce Fast Wash Buffer, Thermo Fisher Scientific, cat. no. 37577, or equivalent) Chemiluminescent reagents (Thermo Scientific, cat. no. 34580, or equivalent) 50 mM TEAB/50% (v/v) ACN (see recipe; make fresh) 100% acetonitrile (ACN; Sigma‐Aldrich, cat. no. 34851) 100 mM TEAB (see recipe) 1 M DTT (see recipe) 1 M IAA (see recipe) 10 ng/μl trypsin (see recipe; make fresh) 10% (v/v) TFA (see recipe) 1% (v/v) TFA/50% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) TFA/75% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) formic acid (see recipe) 95°C water bath or dry bath Mini centrifuge Precast or custom‐made 4%‐20% protein gels (Novex Tris‐Glycine Mini Protein Gels, 4%‐20%, 1.0 mm, WedgeWell format, Invitrogen, cat. no. 15466694) Electrophoresis system, including gel box Nitrocellulose transfer stacks (Power Blotter Pre‐cut Membranes and Filters, nitrocellulose, Invitrogen, cat. no. PB7320) Black blot boxes or transparent trays Orbital shaker Semi‐dry transfer system (Invitrogen Power Blotter or equivalent) Blotting roller Aluminum foil Imaging system 1.5 ml Eppendorf tubes 37°C thermomixer (Eppendorf ThermoMixer C) 37°C centrifugal vacuum concentrator Vortex MASCOT v2.3 software (Matrix Sciences) Additional reagents or equipment for LC‐MS/MS (e.g., Orbitrap Fusion Lumos Tribrid Mass Spectrometer, Thermo Fisher Scientific) ..
Mass Spectrometry:Article Title: Surface Plasmon Resonance (SPR) Workflow for Comparative Analysis of Nanobody Variants Binding to Lysozyme as a Model Ligand
Article Snippet: .. Samples (see Basic Protocol ) 2× SDS buffer (Novex Tris‐Glycine SDS Sample Buffer (2×), Thermo Fisher Scientific, cat. no. LC2676, or equivalent) 1× Tris‐glycine SDS buffer (Novex Tris‐Glycine SDS Running Buffer, Thermo Fisher Scientific, cat. no. LC26754, or equivalent) Protein molecular‐weight marker (PageRuler Plus Prestained Protein Ladder, Thermo Fisher Scientific, cat. no. 26619, or equivalent) Coomassie blue stain (Imperial Protein Stain, Thermo Fisher Scientific, cat. no. 24617; PageBlue Protein Staining Solution, Thermo Fisher Scientific, cat. no. 24620; or similar reagent) Distilled water Transfer buffer (Pierce 1‐Step Transfer Buffer, Thermo Fisher Scientific, cat. no. 84731 × 5, or equivalent) Blocking buffer (Pierce Fast Blocking Buffer, Thermo Fisher Scientific, cat. no. 37575, or equivalent) Antibody solution: anti‐6×His‐Tag antibody solution (see recipe; make fresh) or Strep‐Tactin HRP solution (see recipe; make fresh) Wash buffer (Pierce Fast Wash Buffer, Thermo Fisher Scientific, cat. no. 37577, or equivalent) Chemiluminescent reagents (Thermo Scientific, cat. no. 34580, or equivalent) 50 mM TEAB/50% (v/v) ACN (see recipe; make fresh) 100% acetonitrile (ACN; Sigma‐Aldrich, cat. no. 34851) 100 mM TEAB (see recipe) 1 M DTT (see recipe) 1 M IAA (see recipe) 10 ng/μl trypsin (see recipe; make fresh) 10% (v/v) TFA (see recipe) 1% (v/v) TFA/50% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) TFA/75% (v/v) ACN (see recipe; make fresh) 0.1% (v/v) formic acid (see recipe) 95°C water bath or dry bath Mini centrifuge Precast or custom‐made 4%‐20% protein gels (Novex Tris‐Glycine Mini Protein Gels, 4%‐20%, 1.0 mm, WedgeWell format, Invitrogen, cat. no. 15466694) Electrophoresis system, including gel box Nitrocellulose transfer stacks (Power Blotter Pre‐cut Membranes and Filters, nitrocellulose, Invitrogen, cat. no. PB7320) Black blot boxes or transparent trays Orbital shaker Semi‐dry transfer system (Invitrogen Power Blotter or equivalent) Blotting roller Aluminum foil Imaging system 1.5 ml Eppendorf tubes 37°C thermomixer (Eppendorf ThermoMixer C) 37°C centrifugal vacuum concentrator Vortex MASCOT v2.3 software (Matrix Sciences) Additional reagents or equipment for LC‐MS/MS (e.g., Orbitrap Fusion Lumos Tribrid Mass Spectrometer, Thermo Fisher Scientific) ..
other:
Article Title: Methods for detecting and inhibiting brain metastasis
Article Snippet: TABLE 2 Antibody List Antibody/Protein Product Antibody Application recognized Vendor reference dilution Immunoblot CEMIP Novus biologicals 4575.00.02 1:5000 HSP70 System EXOAB- 1:1000 Biosciences Hsp70A-1 Syntenin-1 Santa Cruz sc-100336 1:200 biotechnology CD81 Santa Cruz sc-166029 1:1000 biotechnology ACTB [unconjugated] Cell Signaling 4967L 1:1000 ACTB [peroxidase- Sigma A3854 1:20000 conjugated] Mouse/Rabbit Whole IgG Jackson 1:5000 [peroxidase-conjugated] ImmunoResearch Laboratories Immunofluorescence GFP Aves labs GFP-1020 1:200 mCherry abcam ab205402 1:200 Collagen IV abcam ab6586 1:500 PECAM-1/CD31 Santa Cruz sc-18916 1:50 biotechnology Glut-1 abcam ab40084 1:100 Iba-1 Wako 019-19741 1:200 GFAP abcam ab7260 1:500 NeuN Millipore ABN90 1:500 Ki-67 abcam ab66155 1:500 Mouse/Rat/Chicken/Rabbit Life technologies A11001, 1:500 IgG [fluorochrome- A11008, conjugated] A11036, A11039, A11077, A21244, A21247, A27040 Mouse IgG [fluorochrome- Vector CI-2000 1:500 conjugated] laboratories Immunohistochemistry CEMIP abcam ab76849 1:100 FACS CD45 EBioscience 56-0451-82 1:100 CD31 BD Biosciences 561073 1:40 CD11b BD Biosciences 550993 1:200 CD49d Biolegend 103618 1:100 Primer List Primer Application name Primer sequence Notes CEMIP CEMIP CGTACCAACGGGCCCCTCCG (SEQ knockout gRNA ID NO: 114) KO1 GCGGCTTGGACCATAGCGGA CEMIP (SEQ ID NO: 115) gRNA KO2 CEMIP CEMIP 5′- with 5′ overexpression forward ACGTACTCGAGCACCATGGGAGCTGCTGGGAGGCA- PspXI 3′ (SEQ ID NO: 116) restriction CEMIP 5′-ACGTGCTAGCCTACAACTTCTTCTTCTTCAC-3′ site reverse (SEQ ID NO: 117) with 3′ NheI restriction site Exosome OptiPrep density gradient.
Lysis:Article Title: Computational and Proteomic Analyses Reveal Cardiac Dysfunction and Heart Failure-Associated Biomarker Secretion from Venezuelan Equine Encephalitis Virus TC83-infected human IPSC-derived cardiomyocytes
Article Snippet: .. The heart tissue was placed in blue lysis buffer (2X Novex Tris-Glycine Sample Loading Buffer SDS (ThermoFisher, Cat. LC2676) T-PER Tissue Protein Extraction Reagent (ThermoFisher, Cat. 78510), 0.5M EDTA pH 8.0 (ThermoFisher, Cat. J15684AE), complete Protease Cocktail tablets (Roche, Cat. 11697498001), 0.1M Na3VO4 (Sigma-Aldrich, Cat. 56508), 0.1M NaF (FisherScientific, Cat. S299100), and 1M dithiothreitol (DTT; ThermoFisher, Cat. R0861) and homogenized using a bead homogenizer. ..
Protein Extraction:Article Title: Computational and Proteomic Analyses Reveal Cardiac Dysfunction and Heart Failure-Associated Biomarker Secretion from Venezuelan Equine Encephalitis Virus TC83-infected human IPSC-derived cardiomyocytes
Article Snippet: .. The heart tissue was placed in blue lysis buffer (2X Novex Tris-Glycine Sample Loading Buffer SDS (ThermoFisher, Cat. LC2676) T-PER Tissue Protein Extraction Reagent (ThermoFisher, Cat. 78510), 0.5M EDTA pH 8.0 (ThermoFisher, Cat. J15684AE), complete Protease Cocktail tablets (Roche, Cat. 11697498001), 0.1M Na3VO4 (Sigma-Aldrich, Cat. 56508), 0.1M NaF (FisherScientific, Cat. S299100), and 1M dithiothreitol (DTT; ThermoFisher, Cat. R0861) and homogenized using a bead homogenizer. ..
Membrane:Article Title: TBL1X/TBL1XR1 govern β-cell identity through a PAX6-containing gene regulatory network
Article Snippet: For protein extraction, the cells were lysed in ice-cold lysis buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.6, 1% Triton X-100, 0.5% Sodium deoxycholate, 0.1% SDS) supplemented with PhosSTOP (Roche) and an EDTA-free protease inhibitor cocktail (Roche) for 15 min on ice. .. 15 μg of protein extracts were separated using tris-glycine gels (Novex WedgeWell 8–16% Tris-Glycine Mini Gels; Thermo Fisher Scientific) and blotted on nitrocellulose membranes (Amersham), followed by membrane blocking and incubation with primary antibodies overnight at 4 °C (Anti-Vinculin, Abcam, Cat# 129002, RRID: AB_11144129; anti-TBL1X, Abcam, Cat# ab24548, RRID: AB_2199904; anti-TBL1XR1, Santa Cruz, Cat# sc-517365; anti-PAX6, Cell Signaling Technology, Cat# 60433, RRID: AB_2797599). .. After the secondary antibody incubation at room temperature for 1 h (goat anti-rabbit HRP, BioRad, Cat# 1705046, RRID: AB_11125757; goat anti-mouse HRP, BioRad, Cat# 1706516, RRID: AB_2921252; IgG Fraction Monoclonal Mouse Anti-Rabbit IgG, light chain specific, Jackson Immunoresearch Lab, Cat# 213-032-177, RRID: AB_2339251), protein bands were visualized using Amersham ECL Prime and the ChemiDoc MP Imaging System (BioRad).
Incubation:Article Title: TBL1X/TBL1XR1 govern β-cell identity through a PAX6-containing gene regulatory network
Article Snippet: For protein extraction, the cells were lysed in ice-cold lysis buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.6, 1% Triton X-100, 0.5% Sodium deoxycholate, 0.1% SDS) supplemented with PhosSTOP (Roche) and an EDTA-free protease inhibitor cocktail (Roche) for 15 min on ice. .. 15 μg of protein extracts were separated using tris-glycine gels (Novex WedgeWell 8–16% Tris-Glycine Mini Gels; Thermo Fisher Scientific) and blotted on nitrocellulose membranes (Amersham), followed by membrane blocking and incubation with primary antibodies overnight at 4 °C (Anti-Vinculin, Abcam, Cat# 129002, RRID: AB_11144129; anti-TBL1X, Abcam, Cat# ab24548, RRID: AB_2199904; anti-TBL1XR1, Santa Cruz, Cat# sc-517365; anti-PAX6, Cell Signaling Technology, Cat# 60433, RRID: AB_2797599). .. After the secondary antibody incubation at room temperature for 1 h (goat anti-rabbit HRP, BioRad, Cat# 1705046, RRID: AB_11125757; goat anti-mouse HRP, BioRad, Cat# 1706516, RRID: AB_2921252; IgG Fraction Monoclonal Mouse Anti-Rabbit IgG, light chain specific, Jackson Immunoresearch Lab, Cat# 213-032-177, RRID: AB_2339251), protein bands were visualized using Amersham ECL Prime and the ChemiDoc MP Imaging System (BioRad).
Magnetic Beads:Article Title: Reducing encapsidated impurity DNA derived from plasmid backbone by modifying the p5 terminal resolution site in rAAV vector production
Article Snippet: To recover rAAV particles from the lysed sample liquid, KingFisher Duo Prime (Thermo Fisher Scientific) and Dynabeads CaptureSelect AAVX (Thermo Fisher Scientific) were used. .. Samples, magnetic beads, washing buffer (D-PBS, Gibco), and elution buffer [0.1 M glycine-HCl (pH 2.5)] (Nacalai Tesque, Inc.) were dispensed into 96-deep-well plates and set in the device according to the manufacturer’s protocol. ..
|
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 