Review



oligonucleotide pool 12 k dual guide arrays  (CustomArray Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    CustomArray Inc oligonucleotide pool 12 k dual guide arrays
    Oligonucleotide Pool 12 K Dual Guide Arrays, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12k+array/oligonucleotide+pool+12+k+dual+guide+arrays/pmc07558751-184-1-12
    Average 90 stars, based on 1 article reviews
    oligonucleotide pool 12 k dual guide arrays - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Synthesized:

    Article Title: Multiplex enCas12a screens detect functional buffering among paralogs otherwise masked in monogenic Cas9 knockout screens
    Article Snippet: The following vectors were a kind gift from John Doench: pRDA_174 (enzyme expression): EF1a promoter drives EnCas12a enzyme expression; lentiviral vector; confers blasticidin resistance (Addgene #136476). pRDA_052 (guide expression): U6 promoter drives gRNA expression; vector contains AsCas12a direct repeat upstream of dual BsmBI sites for insertion of guide arrays; lentiviral vector; confers puromycin resistance (Addgene #136474). pRDA_221 (positive control): confers constitutive of short half-life EGFP and expression of two guides targeting EGFP; lentiviral vector; confers puromycin resistance [ , ]. pDV204 (positive control): U6 promoter drives expression of guides targeting cell-surface markers CD47 and CD63; derived from pRDA_052 [ , ]. .. An oligonucleotide pool comprising 12 k dual guide arrays was synthesized by CustomArray based on the following template: 5’ TATCTTGTGGAAAGGACGAAAC ACCGG TAATTTCTACTCTTGTAGAT NNNNNNNNNNNNNNNNNNNNNNN TAATTTCTACTGTCGTAGAT nnnnnnnnnnnnnnnnnnnnnnnTTTTTTGAATT CGCTAGCAAGCTTGGCGTAAC -3′. ..



    Similar Products

    12k array  (Twist Bioscience)
    86
    Twist Bioscience 12k array
    12k Array, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12k+array/12k+array/pm41175344-50-10-6
    Average 86 stars, based on 1 article reviews
    12k array - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    12k flex 112-format open-array system  (Thermo Fisher)
    90
    Thermo Fisher 12k flex 112-format open-array system
    12k Flex 112 Format Open Array System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12k+array/pmc11672409-216-46-49
    Average 90 stars, based on 1 article reviews
    12k flex 112-format open-array system - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    12k flex 112-format open array system  (Thermo Fisher)
    90
    Thermo Fisher 12k flex 112-format open array system
    12k Flex 112 Format Open Array System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12k+array/pm39685910-76-50-54
    Average 90 stars, based on 1 article reviews
    12k flex 112-format open array system - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    life 12k flex 112-format open array system  (Thermo Fisher)
    90
    Thermo Fisher life 12k flex 112-format open array system
    Life 12k Flex 112 Format Open Array System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12k+array/pmc11642584-112-52-56
    Average 90 stars, based on 1 article reviews
    life 12k flex 112-format open array system - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    quantstudio 12k flex open array real-time pcr system  (Thermo Fisher)
    90
    Thermo Fisher quantstudio 12k flex open array real-time pcr system
    Quantstudio 12k Flex Open Array Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12k+array/pm38636197-55-39-47
    Average 90 stars, based on 1 article reviews
    quantstudio 12k flex open array real-time pcr system - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    snp array infinium 12k v2 potato array  (INFINIUM Inc)
    90
    INFINIUM Inc snp array infinium 12k v2 potato array
    Snp Array Infinium 12k V2 Potato Array, supplied by INFINIUM Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12k+array/12k+v2+potato+array/pmc10957621-319-22-21
    Average 90 stars, based on 1 article reviews
    snp array infinium 12k v2 potato array - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    open array life quantstudio 12k  (Thermo Fisher)
    90
    Thermo Fisher open array life quantstudio 12k
    Open Array Life Quantstudio 12k, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12k+array/open+array+life+quantstudio+12k/pm37940651-53-15-18
    Average 90 stars, based on 1 article reviews
    open array life quantstudio 12k - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    12k oligonucleotide array  (GenScript corporation)
    90
    GenScript corporation 12k oligonucleotide array
    12k Oligonucleotide Array, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12k+array/12k+oligonucleotide+array/pm37792893-304-15-18
    Average 90 stars, based on 1 article reviews
    12k oligonucleotide array - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results