Journal: Journal of neurochemistry

Article Title: Functional characterization of the S41Y (C2755A) polymorphism of tryptophan hydroxylase 2

doi: 10.1111/jnc.12779

Figure Lengend Snippet: Comparison of WT hTPH2 and tyrosine for serine substitution at position 41 (S41Y) expression in PC12 cells. Stable transfectants of tetracycline-regulated WT hTPH2 and S41Y PC12 cells were evaluated. (a) doxycycline (DOX)-stimulated expression of hTPH2. The same number of cells was lysed to examine expression efficiency. A total of 15-μg protein were loaded into each well. Immunoblots were probed with a TPH antibody that detects the exogenous hTPH2 and endogenous rat TH (this antibody cross-reacts with both enzymes and TH bands in the figure therefore serve as an internal control). Empty PC12 cell protein and recombinant hTPH2 were loaded as controls (the size of the recombinant protein is 63 kDa as a result of a 26-amino acid fusion segment). Immunoblots were probed with a TPH antibody that detects the exogenous hTPH2 and endogenous rat TH (the antibody cross-reacts with both enzymes). Note that DOX did not affect rat TH expression and that, while the TPH antibody recognizes both rat TH and hTPH2, it does not do so equally, so that relative expression comparisons cannot be made. (+) Indicates treatment with DOX; (−) indicates cells without DOX treatment. (b) Unlike bacterially expressed hTPH2, enzyme expressed in PC12 cells was soluble as determined from high speed supernatants (S) of cellular homogenates (H). (c) Higher S41Y expression levels are due to increased mRNA levels as determined by RT-PCR. Rat TPH1 = rTPH1; rat TPH2 = rTPH2. (d) Higher amounts of S41Y mRNA and immunoprotein are reflected in increases enzyme activity. (e) Following correction for specific amounts of hTPH2 proteins, the S41Y mutant exhibited higher inherent activity (similar to Table 1 for bacterially expressed proteins). All data are expressed as mean ± SEM (n = 3). ***p < 0.001, **p < 0.01, *p < 0.05.

Article Snippet: Total RNA from stably transfected PC12- hTPH2 and PC12-S41Y cells was isolated using the Qiagen RNeasy Plus Mini Kit. cDNAs were synthesized using the Omniscript reverse transcriptase kit (Qiagen, Germantown, MD, USA). qPCR was performed on a 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA, USA) using primers for rat β- Actin (Rn00667869), rat TPH1 (Rn01476869), rat TPH2 (Rn00598017), and human TPH2 (Hs00998776) genes.

Techniques: Comparison, Expressing, Western Blot, Control, Recombinant, Reverse Transcription Polymerase Chain Reaction, Activity Assay, Mutagenesis

Journal: Nutrients

Article Title: Effect of Gestational Diabetes on Postpartum Depression-like Behavior in Rats and Its Mechanism

doi: 10.3390/nu14061229

Figure Lengend Snippet: Comparison of IDO and TPH2 immuno-positive MOD, AD and H-score in different brain regions of rats in each group.

Article Snippet: The membranes were sealed with 5% non-fat milk in TBS-T solution and placed at room temperature for 4 h. The membranes were incubated overnight at 4 °C with the following primary antibodies: (1) rabbit anti-TPH1 antibody (1:1000, Boster, Wuhan, Hubei, China); (2) rabbit anti-IDO2 antibody (1:2000, Boster, Wuhan, Hubei, China); (3) rabbit anti-TPH2 antibody (1:1000, Boster, Wuhan, Hubei, China).

Techniques: Comparison

Journal: Nutrients

Article Title: Effect of Gestational Diabetes on Postpartum Depression-like Behavior in Rats and Its Mechanism

doi: 10.3390/nu14061229

Figure Lengend Snippet: Expression of TPH2 in prefrontal cortex ( a – c ) and hippocampus ( d – f ) of three groups of rats. ( a , d ) CON group, ( b , e ) GH group, ( c , f ) GL group. DAB × 400.

Article Snippet: The membranes were sealed with 5% non-fat milk in TBS-T solution and placed at room temperature for 4 h. The membranes were incubated overnight at 4 °C with the following primary antibodies: (1) rabbit anti-TPH1 antibody (1:1000, Boster, Wuhan, Hubei, China); (2) rabbit anti-IDO2 antibody (1:2000, Boster, Wuhan, Hubei, China); (3) rabbit anti-TPH2 antibody (1:1000, Boster, Wuhan, Hubei, China).

Techniques: Expressing

Journal: Nutrients

Article Title: Effects of a Lacticaseibacillus Mix on Behavioural, Biochemical, and Gut Microbial Outcomes of Male Mice following Chronic Restraint Stress

doi: 10.3390/nu15214635

Figure Lengend Snippet: Primers used for qPCR with the cDNA solution obtained from brain tissue (TaqMan™ Gene Expression Assay (Applied Biosystems, Fisher Scientific)).

Article Snippet: GAPDH , Mm99999915_g1 , FAM , TPH2 , Mm00557722_m1 , VIC.

Techniques: Gene Expression, Marker

Journal: Cell

Article Title: A serotonergic axon-cilium synapse drives nuclear signaling to alter chromatin accessibility

doi: 10.1016/j.cell.2022.07.026

Figure Lengend Snippet: (A) HTR6 (labeled by CF633, green in merged panel) is highly enriched in CA1 neuronal primary cilia (ADCY3, magenta in the merged panel: 20 μm MIP). (B) Magnified images from (A). 5-HTR6s are not evenly distributed along the length of cilia and can be enriched at areas with low ADCY3 labeling (arrow). (C) Left panel: cilia (magenta) co-labeled with serotonergic axons (green). 20-μm maximum intensity projection (MIP). Middle panel: cilia in the left panel color coded by the shortest distance to a serotonergic axon. Right panel: cilia from left panel color coded with the shortest distance to a serotonergic axon-associated synaptophysin punctum. (D) Floxed synaptophysin-EGFP driven by Tph2 -Cre showed ADCY3-labeled cilia (magenta in the merged panel) in contact with serotonergic presynaptic terminals (amplified by anti-GFP and Alexa 488, green in the merged panel). (E) 5-HTR6 (green in the merged panel) are enriched on the cilia at the axonal contact sites (SERT, cyan in the merged panel). Two cilia are in contact with a single serotonergic axonal varicosity. ADCY3 (magenta in the merged panel) can extend beyond the contact site that has few 5-HTR6 (arrow). (A), (B), and (E) are deconvolved confocal images with photon counting detection (Leica). (C) and (D) are Airyscan images (Zeiss). Data from 3- to 4-month-old male C57BL/6J mice.

Article Snippet: Tph2 -Cre vector was generated by replacing GFP in Tph2 -GFP( ; gift from Dr. Björklund) with the Cre-recombinase in Syn1-EBFP-Cre AAV (gift from Hongkui Zeng, Addgene plasmid # 51507; RRID:Addgene_51507). pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] was a gift from Edward Boyden (Addgene plasmid # 62723; RRID:Addgene_62723). pAAV[FLEX-ON]-CAG-Farnesylated-SNAPtag AAV plasmid was made by VectorBuilder, Inc. pAAV-FLEX-ON-tdTomato was a gift from Edward Boyden (Addgene plasmid # 28306; RRID:Addgene_28306). pAAV-EF1a-DIO-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene plasmid # 50460; RRID:Addgene_50460). pAAV-TRE-HTR6-SNAPf-TRIP and pAAV-Syn-Tet3G were made by VectorBuilder.

Techniques: Labeling, Amplification

Journal: Cell

Article Title: A serotonergic axon-cilium synapse drives nuclear signaling to alter chromatin accessibility

doi: 10.1016/j.cell.2022.07.026

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Tph2 -Cre vector was generated by replacing GFP in Tph2 -GFP( ; gift from Dr. Björklund) with the Cre-recombinase in Syn1-EBFP-Cre AAV (gift from Hongkui Zeng, Addgene plasmid # 51507; RRID:Addgene_51507). pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] was a gift from Edward Boyden (Addgene plasmid # 62723; RRID:Addgene_62723). pAAV[FLEX-ON]-CAG-Farnesylated-SNAPtag AAV plasmid was made by VectorBuilder, Inc. pAAV-FLEX-ON-tdTomato was a gift from Edward Boyden (Addgene plasmid # 28306; RRID:Addgene_28306). pAAV-EF1a-DIO-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene plasmid # 50460; RRID:Addgene_50460). pAAV-TRE-HTR6-SNAPf-TRIP and pAAV-Syn-Tet3G were made by VectorBuilder.

Techniques: Virus, Recombinant, Knock-In, Software

Journal:

Article Title: Ovarian Steroid Regulation of the Midbrain CRF and UCN Systems in Macaques

doi: 10.1016/j.neuroscience.2010.08.059

Figure Lengend Snippet: Available information about ABI custom Taqman qPCR assays.

Article Snippet: Then, the ratio of each transcript to GAPDH was calculated for each sample. table ft1 table-wrap mode="anchored" t5 caption a7 Gene Name Gene Symbol Assay ID Context Sequence NCBI Gene Reference urocortin 1 UCN1 Rh03986716_s1 GCCGAGCAGAACCGCATCATATTCG {"type":"entrez-nucleotide","attrs":{"text":"XM_001092424.1","term_id":"109102367","term_text":"XM_001092424.1"}} XM_001092424.1 , {"type":"entrez-nucleotide","attrs":{"text":"XM_001092536.1","term_id":"109102369","term_text":"XM_001092536.1"}} XM_001092536.1 urocortin 2 preproprotein UCN2 Rh02822047_m1 AGAAGAAGCTGGTGGCGCCTGACCT {"type":"entrez-nucleotide","attrs":{"text":"XM_001097967.1","term_id":"109039976","term_text":"XM_001097967.1"}} XM_001097967.1 urocortin 3 (stresscopin) UCN3 Rh03986721_m1 GTCCACTCTCAGGGAGAGATGCCGA {"type":"entrez-nucleotide","attrs":{"text":"XM_001104616.1","term_id":"109088106","term_text":"XM_001104616.1"}} XM_001104616.1 corticotropin releasing factor receptor type 1 CRFR1 Rh02787591_m1 GACAATGAGAAGTGCTGGTTTGGCA {"type":"entrez-nucleotide","attrs":{"text":"NM_001032803.1","term_id":"74136172","term_text":"NM_001032803.1"}} NM_001032803.1 , {"type":"entrez-nucleotide","attrs":{"text":"AB078141.1","term_id":"38602677","term_text":"AB078141.1"}} AB078141.1 corticotropin releasing hormone receptor 2 CRFR2 (LOC697404) Rh01120857_m1 AGTACAACACGACCCGGAATGCCTA {"type":"entrez-nucleotide","attrs":{"text":"XM_001085987.1","term_id":"109066984","term_text":"XM_001085987.1"}} XM_001085987.1 corticotropin releasing hormone binding protein CRHBP Rh01075813_m1 GGGCGGCGACTTCCTGAAGGTATTT {"type":"entrez-nucleotide","attrs":{"text":"XM_001106453.1","term_id":"109077661","term_text":"XM_001106453.1"}} XM_001106453.1 , {"type":"entrez-nucleotide","attrs":{"text":"XM_001106396.1","term_id":"109077663","term_text":"XM_001106396.1"}} XM_001106396.1 tryptophan hydroxylase 2 TPH2 Rh02788839_m1 CTACTCGGCAACTTAACACTAAATA {"type":"entrez-nucleotide","attrs":{"text":"NM_001039946.1","term_id":"90265818","term_text":"NM_001039946.1"}} NM_001039946.1 , {"type":"entrez-nucleotide","attrs":{"text":"AY827483.1","term_id":"56791756","term_text":"AY827483.1"}} AY827483.1 , {"type":"entrez-nucleotide","attrs":{"text":"DQ360113.1","term_id":"86371182","term_text":"DQ360113.1"}} DQ360113.1 Open in a separate window Available information about ABI custom Taqman qPCR assays.

Techniques: Sequencing, Binding Assay

Journal: Acta Neuropathologica Communications

Article Title: Human tau-overexpressing mice recapitulate brainstem involvement and neuropsychiatric features of early Alzheimer’s disease

doi: 10.1186/s40478-023-01546-5

Figure Lengend Snippet: List of primers used for quantitating mRNA expression using RT-qPCR

Article Snippet: TPH2 , Primary , 51124 , Cell signaling technology , 1:2000.

Techniques: Expressing, Sequencing, Transmission Assay

Journal: Acta Neuropathologica Communications

Article Title: Human tau-overexpressing mice recapitulate brainstem involvement and neuropsychiatric features of early Alzheimer’s disease

doi: 10.1186/s40478-023-01546-5

Figure Lengend Snippet: Antibodies used in Western blot

Article Snippet: TPH2 , Primary , 51124 , Cell signaling technology , 1:2000.

Techniques: Western Blot

Journal: Acta Neuropathologica Communications

Article Title: Human tau-overexpressing mice recapitulate brainstem involvement and neuropsychiatric features of early Alzheimer’s disease

doi: 10.1186/s40478-023-01546-5

Figure Lengend Snippet: Reduction in 5-HT neuronal excitability in htau mice at 4 months. A Confocal images of biocytin-labeled cells (red) in the DRN overlaid with TPH2 staining (green) indicating that recorded cells were 5-HT neurons. B Schematic of patch clamp recordings in the DRN and representative traces of voltage ramps that were used to compute the rheobase and action potential (AP) firing at the 200 pA current step from resting membrane potential (RMP). Intracellular recordings in 5-HT neurons from 4-month-old male C57BL/6 J and htau +/- mice with histograms indicating C RMP, D Input resistance at RMP, E Rheobase and F Current (0–200 pA)-induced spiking in 250 ms from RMP G Representative voltage ramps and AP-current plot at 200 pA current step from a holding potential of − 70 mV. H Input resistance I Rheobase and J Current induced spiking (0–200 pA) from a holding potential of − 70 mV. Action potential kinetics showing the K 10–90% rise slope, L Maximum decay slope, M Time to maximum decay slope, N Event Frequency, and O Instantaneous frequency at 0–200 pA current steps from the RMP. * p < 0.05

Article Snippet: TPH2 , Primary , 51124 , Cell signaling technology , 1:2000.

Techniques: Labeling, Staining, Patch Clamp, Membrane

Journal: Acta Neuropathologica Communications

Article Title: Human tau-overexpressing mice recapitulate brainstem involvement and neuropsychiatric features of early Alzheimer’s disease

doi: 10.1186/s40478-023-01546-5

Figure Lengend Snippet: Hyperphosphorylated tau and altered expression of TPH2, TH, IDO1, and TGM2 protein levels in the monoaminergic nuclei. A Atlas plate indicating the DRN region that was dissected for Western blot analysis. Representative western blot images showing the B HT7 and AH36 C TPH2 D IDO1 E TGM2 protein levels in the DRN of C57BL/6 J and htau +/- . F Atlas plate indicating the LC region that was dissected for Western blot analysis. Representative western blot images showing the G HT7 and AH36 H TH I IDO1 J TGM2 protein levels in the LC of C57BL/6 J and htau ± . * p < 0.05, ** p < 0.01

Article Snippet: TPH2 , Primary , 51124 , Cell signaling technology , 1:2000.

Techniques: Expressing, Western Blot

Journal: Psychiatric genetics

Article Title: Genetic moderation of cocaine subjective effects by variation in the TPH1, TPH2, and SLC6A4 serotonin genes

doi: 10.1097/YPG.0000000000000178

Figure Lengend Snippet: Demographic comparison between genotype groups.

Article Snippet: The TaqManÒ primer-probe sets ID C__2645661_10 was used to genotype TPH1 rs1799913 and the primer probe set C__26385365_10 for the TPH2 rs4290270 using the PlatinumÒ quantitative PCR SuperMix-UDG (Invitrogen, Carlsbad, CA) on a ViiA 7 (Applied Biosystems) in duplicate.

Techniques: Comparison

Journal: Psychiatric genetics

Article Title: Genetic moderation of cocaine subjective effects by variation in the TPH1, TPH2, and SLC6A4 serotonin genes

doi: 10.1097/YPG.0000000000000178

Figure Lengend Snippet: Subjective effect scores by TPH2 genotype. (A) Change over time (in minutes) of participant-reported subjective effect of “good effect” by TT genotype (n = 15) versus AA/AT genotype (n = 51) groups. (B) Change over time (in minutes) of participant-reported subjective effect of “depressed” by TT genotype versus AA plus AT genotype groups (TPH2 rs4290270 minor A allele). Data reflect mean +/− S.E.M.

Article Snippet: The TaqManÒ primer-probe sets ID C__2645661_10 was used to genotype TPH1 rs1799913 and the primer probe set C__26385365_10 for the TPH2 rs4290270 using the PlatinumÒ quantitative PCR SuperMix-UDG (Invitrogen, Carlsbad, CA) on a ViiA 7 (Applied Biosystems) in duplicate.

Techniques: