taq polymerase binding Search Results


99
Thermo Fisher taq dna polymerase
Taq Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase+binding/DNA/us09267130-1555-6-10
Average 99 stars, based on 1 article reviews
taq dna polymerase - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

98
New England Biolabs taq polymerase
Development of low-oxygen induced protein expression system in R. palustris . a The promoter activities under light-anaerobic conditions were compared by eGFP fluorescence intensities. The synthetic promoter of P T334O , the heterologous promoters of P lac and P tac from E. coli , and the endogenous promoters of P puc , P puf , P bchP and P crtE were analyzed. b Schematic design of low-oxygen induced protein expression based on the synthetic promoter P T334O . ORP: oxygen regular proteins, ORBS: oxygen regular protein binding site, RNAP: RNA <t>polymerase,</t> GOI: genes of interest. c The activities of P T334-6 and P T334O were tested at different oxygen levels. The control indicates the strain with the empty plasmid pBRT. All experiments were carried out in triplicate, and the data are presented as mean and standard deviations
Taq Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase+binding/Hot+Start+Taq+DNA+Polymerase/pmc10612212-145-14-17
Average 98 stars, based on 1 article reviews
taq polymerase - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

93
Genesee Scientific primers for ezh2
Primer sequences for RT-PCR.
Primers For Ezh2, supplied by Genesee Scientific, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase+binding/Taq+DNA+Polymerase/pmc05800601-79-16-46
Average 93 stars, based on 1 article reviews
primers for ezh2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

97
Qiagen taq pcr master mix kit
Suz12 depletion alters intestinal epithelial cell proliferation. Cell growth of ShControl and ShSuz12 IEC-6 cells was measured by cell counting between 4 and 23 days. Error bars represent the SEM of a representative experiment repeated more than three times, and done in triplicate (A). Twenty-five microgram of whole cell protein extracts from sub-confluent (s-c) or 5-day confluent (c) ShControl and ShSuz12 IEC-6 cells were separated by SDS–PAGE and transferred to PVDF membranes for Western blot analysis of histone H3 and phospho-histone H3 (Ser10; B), Cyclin D1 (Ccnd1), Cyclin D2 (Ccnd2), and actin as a loading control (C), Cyclin D3 (Ccnd3) and actin as a loading control (D). The histograms indicate the ratio of sub-confluent and confluent ShSuz12 versus ShControl band intensities normalized to β-actin. Relative quantification of band intensity was performed with the Quantity One software. Results are representative of two independent experiments. E: Total RNAs were isolated from confluent control or Suz12 depleted cells. Expression levels of Ccnd1, Ccnd2, p21 (Cdkn1a), p27 (Cdkn1b), and p57 (Cdkn1c) were verified by semi-quantitative <t>RT-PCR,</t> with Gapdh as a loading control. <t>The</t> <t>amplified</t> products were separated on 1.5% agarose gels. Results are representative of two independent experiments.
Taq Pcr Master Mix Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase+binding/Taq+PCR+Master+Mix+Kit/pmc03617464-48-49-54
Average 97 stars, based on 1 article reviews
taq pcr master mix kit - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

99
Thermo Fisher taq polymerase
Activation of σ 54 -dependent transcription and activator structure. A) σ 54 (red subunit) directs binding of the RNA <t>polymerase</t> (dark blue subunit) holoenzyme (Eσ 54 ) to the -12, -24 promoter elements (light blue box). This closed complex is stable and cannot transition to open complex. In response to an environmental or cellular signal, the activator (bEBP; yellow dimers) oligomerizes. For most bEBPs, the oligomer binds to an enhancer (green box) 80 to 150 bp upstream of the promoter and DNA looping brings the activator in contact with σ 54 in the Eσ 54 closed complex. Hydrolysis of ATP by bEBP causes remodeling of Eσ 54 , which leads to open complex formation and transcription. There are a few bacteria with bEBPs that are missing the DNA binding domain; after oligomerization, these activators can bind to Eσ 54 in closed complex with any promoter to stimulate open complex formation (promiscuous activation). B) The domain structure for the Sinorhizobium meliloti bEBP, DctD, is typical of most bEBPs. The amino-terminal regulatory domain (dark blue box) inhibits assembly of the bEBP oligomer until it interacts with an activation signal; the AAA+ ATPase domain (red box) mediates ATP binding and hydrolysis, as well as the protein-protein interactions between bEBPs (oligomerization) and between bEBP and σ 54 ; the carboxyl-terminal DNA binding domain (aqua box) contains a helix-turn-helix motif for binding the enhancer. The truncated DctD variant, DctD250, is missing the regulatory and DNA binding domains, so that it is constitutively active and promiscuous in stimulating transcription from σ 54 -dependent promoters.
Taq Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase+binding/Taq+DNA+Polymerase+Kit/pmc03844500-342-15-17
Average 99 stars, based on 1 article reviews
taq polymerase - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

95
Qiagen hotstart taq dna polymerase pcr kit
Dynamics of <t>DNA</t> methylation and its relationship with expression changes. (A) Heatmap showing expression levels on 0, 5, and 20 days for genes displaying significant methylation and expression changes (4,753 in total with FC ≥2 or FC ≤0.5; P ≤0.01 and FDR ≤0.05) (Additional file ). (B) catterplots showing the relationship between the log 2 -transformed FC in expression and the log 2 -transformed FC in DNA methylation. Sixty-two percent of the hypomethylated genes are overexpressed (in blue); 55% of the hypermethylated genes are repressed (in red). (C) Correlation between methylation and expression data (slope from the linear regression between DNA methylation differences versus expression differences) for all differentially methylated genes organized by genomic location (first exon, TSS, 5′UTR, gene body, 3′UTR). (D) DNA methylation and expression dynamics of selected loci during monocyte-to-osteoclast differentiation. Methylation percentage determined by bisulfite pyrosequencing. Quantitative <t>RT-PCR</t> data relative to RPL38. DNA methylation and expression data are represented with a black line and a red line, respectively. (E) BrdU assay showing the percentage of replicating cells at different times. From days 1 to 4, only 9.46% of cells divide. (F) Effects of 5azadC treatment (50 nM, 500 nM) on osteoclastogenesis monitoring ACP5 , CTSK , and CX3CR1 levels and TRAP staining over time. (G) Workflow for testing the presence of 5 hydroxymethylcytosine in hypomethylated genes. DNA was treated with a 5hmC-specific glucosyltransferase. Cytosines bearing a 5-hydroxymethyl are protected against MspI digestion, and the surrounding region can be amplified by qPCR. When no 5hmC is present, glucose is not transferred to C, DNA is cleaved at CCGG sites, and there is less qPCR amplification. Several controls are used to set the 0% and 100% content of 5hmC. (H) 5hmC content in several of the CpGs that are rapidly demethylated after RANKL and M-CSF stimulation of OC precursors.
Hotstart Taq Dna Polymerase Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase+binding/Taq+DNA+Polymerase/pmc04054781-293-5-11
Average 95 stars, based on 1 article reviews
hotstart taq dna polymerase pcr kit - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

99
Qiagen taq polymerase
( A ) CAR proteins associate with elongating RNA <t>Polymerase</t> II through interactions with the phosphoCTD. Elongating Pol II (dark blue) is depicted with 3 classes of PCTD associating proteins (shades of pink, brown, and blue, respectively) bound either directly or indirectly to the normally-phosphorylated CTD (dark blue line). We speculate that some CAR proteins form complexes with particular functions; here, for example, we propose that A, B, C, D and E comprise a CAR complex that functions as a damage-responsive module; note how it is coupled to the globular catalytic core of PolII. The elongating catalytic core of Pol II will soon encounter a translocation-blocking DNA lesion (red star on orange DNA). ( B ) CAR proteins respond to damage that blocks elongation. The catalytic core of Pol II has collided with the lesion; translocation is blocked . Changes ensue, signaling that polymerase is blocked and ultimately leading to repair. Possible changes include: 1) alterations in conformation, depicted by shape and surface changes (of core and proteins coupled to it, such as A and B, C, D and E); 2) dissociations and signaling (protein E); 3) changes in activity (not indicated); 4) covalent modifications (beacons on B & D) that signal and/or recruit other components. The combined changes comprise the normal damage response, that leads to repair and normal “damage resistance.” ( C ) An abnormal CAR complex results in aberrant damage response. Here, CAR protein C is truncated, missing its PCTD interacting domain (e.g. SRI domain of Set2). C and E are shown in ghostly white, because in reality they would not properly associate with the elongation complex. Note also that D is no longer coupled to the catalytic core. ( D ) A disrupted CAR system leads to reduced damage resistance. When damage blocks the movement of PolII, changes are induced, but their extent is diminished due to absence of PCTD-binding by mutated protein C. Signaling is reduced (signaling from D and E does not occur). Because only a partial damage response is generated, a reduction in damage resistance is observed. We expect that the specific defects underlying a reduced damage response will differ from case to case, depending on which CAR protein is defective and on the nature of the DNA damage.
Taq Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase+binding/Taq+DNA+Polymerase/pmc03629013-154-22-12
Average 99 stars, based on 1 article reviews
taq polymerase - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
Thermo Fisher taq pol
Purification of <t>His-Taq</t> <t>Pol</t> and C-His/Strep MMLV-RT. A) Summary of expression and purification procedures for His-Taq Pol and C-His/Strep MMLV-RT (see the details in the Materials and Methods). B) Schematic representation of the constructs of the recombinant His-Taq Pol and C-His/Strep MMLV-RT expression vectors. CSPA promoter; cold-shock protein A promoter, RBS; ribosome binding site, 6X His; His-tag with 6 histidines, TEE; translational-enhancing element, Taq ORF; Taq Pol open reading frame, Polh; polyhedrin promoter, MMLV-RT ORF; MMLV-RT open reading frame, TEV; Tabacco Etch virus protease targeting site, 8X His; His-tag with 8 histidines, Strep; Strep-tag, polyA; SV40 late polyadenylation signal. C) SDS-PAGE analysis of overexpressed His-Taq Pol in BL21(DE3) E. coli cells (left) and purified His-Pol. As a size control, native Taq Pol (N-Taq Pol) (Invitrogen, 18038-018) was applied by 1 µL (5 U). D) SDS-PAGE analysis of purified C-His/Strep MMLV-RT expressed in the Sf9 cells. As a size control, SuperScript III (SSIII, Invitrogen, 18080051) was applied by 1 µL (200 U). E) Summary of closing yields of purified His-Taq Pol and C-His/Strep MMLV-RT.
Taq Pol, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase+binding/TRIS-HCL/med_rxiv__2020__07__31__20165704-82-4-37
Average 99 stars, based on 1 article reviews
taq pol - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

97
New England Biolabs taq dna ligase buffer
Purification of <t>His-Taq</t> <t>Pol</t> and C-His/Strep MMLV-RT. A) Summary of expression and purification procedures for His-Taq Pol and C-His/Strep MMLV-RT (see the details in the Materials and Methods). B) Schematic representation of the constructs of the recombinant His-Taq Pol and C-His/Strep MMLV-RT expression vectors. CSPA promoter; cold-shock protein A promoter, RBS; ribosome binding site, 6X His; His-tag with 6 histidines, TEE; translational-enhancing element, Taq ORF; Taq Pol open reading frame, Polh; polyhedrin promoter, MMLV-RT ORF; MMLV-RT open reading frame, TEV; Tabacco Etch virus protease targeting site, 8X His; His-tag with 8 histidines, Strep; Strep-tag, polyA; SV40 late polyadenylation signal. C) SDS-PAGE analysis of overexpressed His-Taq Pol in BL21(DE3) E. coli cells (left) and purified His-Pol. As a size control, native Taq Pol (N-Taq Pol) (Invitrogen, 18038-018) was applied by 1 µL (5 U). D) SDS-PAGE analysis of purified C-His/Strep MMLV-RT expressed in the Sf9 cells. As a size control, SuperScript III (SSIII, Invitrogen, 18080051) was applied by 1 µL (200 U). E) Summary of closing yields of purified His-Taq Pol and C-His/Strep MMLV-RT.
Taq Dna Ligase Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase+binding/Taq+DNA+Ligase/pm28515100-74-16-52
Average 97 stars, based on 1 article reviews
taq dna ligase buffer - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

96
Vazyme Biotech Co taq dna polymerase
(A) Dimers A and B produced by hpdR are combined on Regulatory binding site (RBS) and Activation Binding Site (ABS); (B) The interaction between the two dimers forms a tetramer, leading to <t>DNA</t> bending; (C) RNA <t>polymerase</t> binds to the promoter. Transcription cannot be activated because of the abnormal conformation of DNA; (D) As 3-HP exists, 3-HP binds to hpdR tetramer, protein conformation changes, DNA bending is alleviated, and transcription is activated; (E) The dose-response curve of 3-HP-induced expression Pp HpdR/P hpdH in Q1Z2; The figure shows the relationship between the concentration of the inducer and fluorescence output after 3-HP was after 3-HP was added for about 12 hours. The inducer levels were 0.0001, 0.001, 0.01, 0.1, 0.2, 0.3, 0.4, 0.5,0.6 and 0.7 g/L, respectively. The error bars indicate the standard deviations of measurements from three independent cultures; (F) The cell density of strain CS2 at concentrations of chloramphenicol (0, 17, 34, 68, 85, 102 mg/L) when no 3-HP in medium; (G) The cell density of strain CS2 when adding concentrations of 3-HP (0.5, 0.7, 1.5, 2.0, 2.5 g/L), and the starting concentration of chloramphenicol in the medium is 17 mg/L, and the control group (CK) receives no additional chloramphenicol or 3-HP.
Taq Dna Polymerase, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase+binding/Taq+DNA+Polymerase/bio_rxiv__2025__08__26__672340-65-12-22
Average 96 stars, based on 1 article reviews
taq dna polymerase - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


Development of low-oxygen induced protein expression system in R. palustris . a The promoter activities under light-anaerobic conditions were compared by eGFP fluorescence intensities. The synthetic promoter of P T334O , the heterologous promoters of P lac and P tac from E. coli , and the endogenous promoters of P puc , P puf , P bchP and P crtE were analyzed. b Schematic design of low-oxygen induced protein expression based on the synthetic promoter P T334O . ORP: oxygen regular proteins, ORBS: oxygen regular protein binding site, RNAP: RNA polymerase, GOI: genes of interest. c The activities of P T334-6 and P T334O were tested at different oxygen levels. The control indicates the strain with the empty plasmid pBRT. All experiments were carried out in triplicate, and the data are presented as mean and standard deviations

Journal: Biotechnology for Biofuels and Bioproducts

Article Title: Multidimensional optimization for accelerating light-powered biocatalysis in Rhodopseudomonas palustris

doi: 10.1186/s13068-023-02410-3

Figure Lengend Snippet: Development of low-oxygen induced protein expression system in R. palustris . a The promoter activities under light-anaerobic conditions were compared by eGFP fluorescence intensities. The synthetic promoter of P T334O , the heterologous promoters of P lac and P tac from E. coli , and the endogenous promoters of P puc , P puf , P bchP and P crtE were analyzed. b Schematic design of low-oxygen induced protein expression based on the synthetic promoter P T334O . ORP: oxygen regular proteins, ORBS: oxygen regular protein binding site, RNAP: RNA polymerase, GOI: genes of interest. c The activities of P T334-6 and P T334O were tested at different oxygen levels. The control indicates the strain with the empty plasmid pBRT. All experiments were carried out in triplicate, and the data are presented as mean and standard deviations

Article Snippet: PCR amplification of all genes was performed with High Fidelity Phusion DNA polymerase or Taq polymerase from New England Biolab (Ipswich, MA, USA).

Techniques: Expressing, Fluorescence, Protein Binding, Control, Plasmid Preparation

Primer sequences for RT-PCR.

Journal: PLoS ONE

Article Title: Ezh2 does not mediate retinal ganglion cell homeostasis or their susceptibility to injury

doi: 10.1371/journal.pone.0191853

Figure Lengend Snippet: Primer sequences for RT-PCR.

Article Snippet: To detect the Ezh2 floxed gene, one μl of genomic DNA from a mouse tail and primers for Ezh2 ( F: CTGCTCTGAATGGCAACTCC ; R: TTATTCATAGAGCCACCTGG ) were added to a mixture of solution containing Apex TaqDNA Polymerase (Cat. No. 42–409), Apex buffer, and MgCl 2 from Genesee Scientific (San Diego, CA), and dNTP (Cat. No. 10297–018; Invitrogen).

Techniques:

(A) PCR genotyping of Ezh2 and Cre genes. (B) Representative result of Western blot of Ezh2 expression in RGCs purified from P0 WT and mKO mice. GAPDH was used as a loading control. A strongly reduced level of Ezh2 was found in mKO RGCs as compared to WT RGCs. ( C) Epifluorescence images of retinal sections taken from P0 WT and mKO mice that were immunolabeled for H3K27me3 (red) and nuclear marker 4’,6-Diamidino-2-Phenylindole (DAPI; blue). Note the higher level of H3K27me3 signals in the mKO retina compared to WT retina. Scale bar: 50 μm.

Journal: PLoS ONE

Article Title: Ezh2 does not mediate retinal ganglion cell homeostasis or their susceptibility to injury

doi: 10.1371/journal.pone.0191853

Figure Lengend Snippet: (A) PCR genotyping of Ezh2 and Cre genes. (B) Representative result of Western blot of Ezh2 expression in RGCs purified from P0 WT and mKO mice. GAPDH was used as a loading control. A strongly reduced level of Ezh2 was found in mKO RGCs as compared to WT RGCs. ( C) Epifluorescence images of retinal sections taken from P0 WT and mKO mice that were immunolabeled for H3K27me3 (red) and nuclear marker 4’,6-Diamidino-2-Phenylindole (DAPI; blue). Note the higher level of H3K27me3 signals in the mKO retina compared to WT retina. Scale bar: 50 μm.

Article Snippet: To detect the Ezh2 floxed gene, one μl of genomic DNA from a mouse tail and primers for Ezh2 ( F: CTGCTCTGAATGGCAACTCC ; R: TTATTCATAGAGCCACCTGG ) were added to a mixture of solution containing Apex TaqDNA Polymerase (Cat. No. 42–409), Apex buffer, and MgCl 2 from Genesee Scientific (San Diego, CA), and dNTP (Cat. No. 10297–018; Invitrogen).

Techniques: Western Blot, Expressing, Purification, Control, Immunolabeling, Marker

(A) Volcano plot showing fold changes (fc) of all genes detected from RGCs of mKO mice against control mice. Statistical significance (green dots) was defined as P <0.05 with a fold change ≥ +1.5 or ≤ -1.5 when compared to WT; non-significant changes (orange dots) fulfill either one or none of these two criteria. 997 genes were found with fc ≥ +1.5 and 1,220 genes with fc ≤ -1.5. Arrow points to the Ezh2 site. (B,C ) Pie charts represent depicted GO terms for upregulated (B) and downregulated (C) genes with │fc│ ≥ 1.5. No GO term in either up- or downregulated gene group were found to be specifically related to eye development. ( D) RT-PCR verification of mRNA levels of retinal related genes in RGCs purified from P5 floxed littermate control (white bar; n = 4) and mKO (black bar; n = 7) mouse pups. CRAL: Cellular retinaldehyde binding protein ; Tuj1: βIII-tubulin (Tubb3) ; Brn: Brn3a (Pou4f1) ; Rho: Rhodopsin ; Rec: Recoverin (* P < 0 . 05 by one-way ANOVA ).

Journal: PLoS ONE

Article Title: Ezh2 does not mediate retinal ganglion cell homeostasis or their susceptibility to injury

doi: 10.1371/journal.pone.0191853

Figure Lengend Snippet: (A) Volcano plot showing fold changes (fc) of all genes detected from RGCs of mKO mice against control mice. Statistical significance (green dots) was defined as P <0.05 with a fold change ≥ +1.5 or ≤ -1.5 when compared to WT; non-significant changes (orange dots) fulfill either one or none of these two criteria. 997 genes were found with fc ≥ +1.5 and 1,220 genes with fc ≤ -1.5. Arrow points to the Ezh2 site. (B,C ) Pie charts represent depicted GO terms for upregulated (B) and downregulated (C) genes with │fc│ ≥ 1.5. No GO term in either up- or downregulated gene group were found to be specifically related to eye development. ( D) RT-PCR verification of mRNA levels of retinal related genes in RGCs purified from P5 floxed littermate control (white bar; n = 4) and mKO (black bar; n = 7) mouse pups. CRAL: Cellular retinaldehyde binding protein ; Tuj1: βIII-tubulin (Tubb3) ; Brn: Brn3a (Pou4f1) ; Rho: Rhodopsin ; Rec: Recoverin (* P < 0 . 05 by one-way ANOVA ).

Article Snippet: To detect the Ezh2 floxed gene, one μl of genomic DNA from a mouse tail and primers for Ezh2 ( F: CTGCTCTGAATGGCAACTCC ; R: TTATTCATAGAGCCACCTGG ) were added to a mixture of solution containing Apex TaqDNA Polymerase (Cat. No. 42–409), Apex buffer, and MgCl 2 from Genesee Scientific (San Diego, CA), and dNTP (Cat. No. 10297–018; Invitrogen).

Techniques: Control, Reverse Transcription Polymerase Chain Reaction, Purification, Binding Assay

Suz12 depletion alters intestinal epithelial cell proliferation. Cell growth of ShControl and ShSuz12 IEC-6 cells was measured by cell counting between 4 and 23 days. Error bars represent the SEM of a representative experiment repeated more than three times, and done in triplicate (A). Twenty-five microgram of whole cell protein extracts from sub-confluent (s-c) or 5-day confluent (c) ShControl and ShSuz12 IEC-6 cells were separated by SDS–PAGE and transferred to PVDF membranes for Western blot analysis of histone H3 and phospho-histone H3 (Ser10; B), Cyclin D1 (Ccnd1), Cyclin D2 (Ccnd2), and actin as a loading control (C), Cyclin D3 (Ccnd3) and actin as a loading control (D). The histograms indicate the ratio of sub-confluent and confluent ShSuz12 versus ShControl band intensities normalized to β-actin. Relative quantification of band intensity was performed with the Quantity One software. Results are representative of two independent experiments. E: Total RNAs were isolated from confluent control or Suz12 depleted cells. Expression levels of Ccnd1, Ccnd2, p21 (Cdkn1a), p27 (Cdkn1b), and p57 (Cdkn1c) were verified by semi-quantitative RT-PCR, with Gapdh as a loading control. The amplified products were separated on 1.5% agarose gels. Results are representative of two independent experiments.

Journal: Journal of Cellular Biochemistry

Article Title: The Histone H3K27 Methylation Mark Regulates Intestinal Epithelial Cell Density-Dependent Proliferation and the Inflammatory Response

doi: 10.1002/jcb.24463

Figure Lengend Snippet: Suz12 depletion alters intestinal epithelial cell proliferation. Cell growth of ShControl and ShSuz12 IEC-6 cells was measured by cell counting between 4 and 23 days. Error bars represent the SEM of a representative experiment repeated more than three times, and done in triplicate (A). Twenty-five microgram of whole cell protein extracts from sub-confluent (s-c) or 5-day confluent (c) ShControl and ShSuz12 IEC-6 cells were separated by SDS–PAGE and transferred to PVDF membranes for Western blot analysis of histone H3 and phospho-histone H3 (Ser10; B), Cyclin D1 (Ccnd1), Cyclin D2 (Ccnd2), and actin as a loading control (C), Cyclin D3 (Ccnd3) and actin as a loading control (D). The histograms indicate the ratio of sub-confluent and confluent ShSuz12 versus ShControl band intensities normalized to β-actin. Relative quantification of band intensity was performed with the Quantity One software. Results are representative of two independent experiments. E: Total RNAs were isolated from confluent control or Suz12 depleted cells. Expression levels of Ccnd1, Ccnd2, p21 (Cdkn1a), p27 (Cdkn1b), and p57 (Cdkn1c) were verified by semi-quantitative RT-PCR, with Gapdh as a loading control. The amplified products were separated on 1.5% agarose gels. Results are representative of two independent experiments.

Article Snippet: Total cellular RNAs from ShControl or ShSuz12 IEC-6 cells, treated with or without IL-1β for 4 or 24 h were prepared with the Rneasy kit (Qiagen). cDNAs were synthesized using oligo(dT) and Superscript II reverse transcriptase (Invitrogen, Frederick, MD), following the manufacturer's protocol. cDNA products were amplified with the Taq PCR Master Mix Kit (Qiagen) using PCR primers designed against the corresponding Rattus norvegicus cDNAs for achaete-scute complex homolog 1 (Ascl1), calcitonin receptor (Calcr), amiloride-sensitive cation channel 1 (Accn1), Necdin (Ndn), solute carrier family 6 (neutral amino acid transporter), member 15 (Slc6a15), ALX homeobox 1 (Cart1 or Alx1), UDP glycosyltransferase 8 (Ugt8), Hu antigen B (Elavl2), homeobox B13 (Hoxb13), insulin-like growth factor binding protein 5 (Igfbp5), SIX homeobox 3 (Six3), WNT inhibitory factor 1 (Wif1), dickkopf 2 (Dkk2), dual specificity protein phosphatase 2 (Dusp2), dual specificity protein phosphatase 8 (Dusp8), interleukin 6 (Il6) in order to generate 300–400 bp amplified products (Supplementary ; http://biotools.umassmed.edu/bioapps/primer3_www.cgi ).

Techniques: Cell Counting, SDS Page, Western Blot, Control, Quantitative Proteomics, Software, Isolation, Expressing, Quantitative RT-PCR, Amplification

Suz12 depletion deregulates differentiation-specific genes. A,B: RNA was isolated from control or Suz12 depleted cells. Expression levels of various neuronal genes were verified by semi-quantitative RT-PCR, with Gapdh expression as a loading control. The amplified products were separated on 1.5% agarose gels. The results are representative of two independent experiments. C: Twenty microgram of nuclear protein extracts from sub-confluent (s-c), confluent (c), 5- or 10-day post-confluent (p-c) ShControl (Ctrl) and ShSuz12 IEC-6 cells were separated by SDS–PAGE and transferred to PVDF membranes for Western blot analysis of HoxB13 and Lmnb1 as a loading control. The results are representative of two independent experiments. D: Chromatin immunoprecipitation assays (ChIP) were performed with chromatin extracts from ShControl and ShSuz12 cells. Chromatin was immunoprecipitated with IgG, or with antibodies recognizing H3K27 trimethylation and H3K4 dimethylation marks. ChIP samples were verified by PCR analysis with oligonucleotides amplifying rat proximal promoter regions of upregulated gene necdin (Ndn). DNA levels were determined by PCR using 1% of input DNA prior to immunoprecipitation. The amplified products were separated on 2% agarose gels. Results are representative of two independent experiments.

Journal: Journal of Cellular Biochemistry

Article Title: The Histone H3K27 Methylation Mark Regulates Intestinal Epithelial Cell Density-Dependent Proliferation and the Inflammatory Response

doi: 10.1002/jcb.24463

Figure Lengend Snippet: Suz12 depletion deregulates differentiation-specific genes. A,B: RNA was isolated from control or Suz12 depleted cells. Expression levels of various neuronal genes were verified by semi-quantitative RT-PCR, with Gapdh expression as a loading control. The amplified products were separated on 1.5% agarose gels. The results are representative of two independent experiments. C: Twenty microgram of nuclear protein extracts from sub-confluent (s-c), confluent (c), 5- or 10-day post-confluent (p-c) ShControl (Ctrl) and ShSuz12 IEC-6 cells were separated by SDS–PAGE and transferred to PVDF membranes for Western blot analysis of HoxB13 and Lmnb1 as a loading control. The results are representative of two independent experiments. D: Chromatin immunoprecipitation assays (ChIP) were performed with chromatin extracts from ShControl and ShSuz12 cells. Chromatin was immunoprecipitated with IgG, or with antibodies recognizing H3K27 trimethylation and H3K4 dimethylation marks. ChIP samples were verified by PCR analysis with oligonucleotides amplifying rat proximal promoter regions of upregulated gene necdin (Ndn). DNA levels were determined by PCR using 1% of input DNA prior to immunoprecipitation. The amplified products were separated on 2% agarose gels. Results are representative of two independent experiments.

Article Snippet: Total cellular RNAs from ShControl or ShSuz12 IEC-6 cells, treated with or without IL-1β for 4 or 24 h were prepared with the Rneasy kit (Qiagen). cDNAs were synthesized using oligo(dT) and Superscript II reverse transcriptase (Invitrogen, Frederick, MD), following the manufacturer's protocol. cDNA products were amplified with the Taq PCR Master Mix Kit (Qiagen) using PCR primers designed against the corresponding Rattus norvegicus cDNAs for achaete-scute complex homolog 1 (Ascl1), calcitonin receptor (Calcr), amiloride-sensitive cation channel 1 (Accn1), Necdin (Ndn), solute carrier family 6 (neutral amino acid transporter), member 15 (Slc6a15), ALX homeobox 1 (Cart1 or Alx1), UDP glycosyltransferase 8 (Ugt8), Hu antigen B (Elavl2), homeobox B13 (Hoxb13), insulin-like growth factor binding protein 5 (Igfbp5), SIX homeobox 3 (Six3), WNT inhibitory factor 1 (Wif1), dickkopf 2 (Dkk2), dual specificity protein phosphatase 2 (Dusp2), dual specificity protein phosphatase 8 (Dusp8), interleukin 6 (Il6) in order to generate 300–400 bp amplified products (Supplementary ; http://biotools.umassmed.edu/bioapps/primer3_www.cgi ).

Techniques: Isolation, Control, Expressing, Quantitative RT-PCR, Amplification, SDS Page, Western Blot, Chromatin Immunoprecipitation, Immunoprecipitation

Distinct responses of β-catenin and Stat3 pathways in Suz12 depleted cells. Twenty microgram of nuclear protein extracts from sub-confluent (s-c), confluent (c), 5- or 10-day post-confluent (p-c) ShControl (Ctrl) and ShSuz12 IEC-6 cells were separated by SDS–PAGE and transferred to PVDF membranes for Western blot analysis of active β-catenin and β-catenin (A) or phospho-Stat3 and Stat3 (B) with Lmnb1 as a loading control. The histograms indicate the ratio of sub-confluent and confluent shSuz12 versus ShControl band intensities normalized to actin. Relative quantification of band intensity was performed with the Quantity One software. Results are representative of two independent experiments. In addition, total RNAs were isolated from control or Suz12 depleted cells. Expression levels of genes involved in Wnt pathway regulation (Wif1, Dkk2; A) or in STAT3 activation (Il6; B) were verified by semi-quantitative RT-PCR, with Gapdh expression as a loading control. The amplified products were separated on 1.5% agarose gels. Results are representative of two independent experiments.

Journal: Journal of Cellular Biochemistry

Article Title: The Histone H3K27 Methylation Mark Regulates Intestinal Epithelial Cell Density-Dependent Proliferation and the Inflammatory Response

doi: 10.1002/jcb.24463

Figure Lengend Snippet: Distinct responses of β-catenin and Stat3 pathways in Suz12 depleted cells. Twenty microgram of nuclear protein extracts from sub-confluent (s-c), confluent (c), 5- or 10-day post-confluent (p-c) ShControl (Ctrl) and ShSuz12 IEC-6 cells were separated by SDS–PAGE and transferred to PVDF membranes for Western blot analysis of active β-catenin and β-catenin (A) or phospho-Stat3 and Stat3 (B) with Lmnb1 as a loading control. The histograms indicate the ratio of sub-confluent and confluent shSuz12 versus ShControl band intensities normalized to actin. Relative quantification of band intensity was performed with the Quantity One software. Results are representative of two independent experiments. In addition, total RNAs were isolated from control or Suz12 depleted cells. Expression levels of genes involved in Wnt pathway regulation (Wif1, Dkk2; A) or in STAT3 activation (Il6; B) were verified by semi-quantitative RT-PCR, with Gapdh expression as a loading control. The amplified products were separated on 1.5% agarose gels. Results are representative of two independent experiments.

Article Snippet: Total cellular RNAs from ShControl or ShSuz12 IEC-6 cells, treated with or without IL-1β for 4 or 24 h were prepared with the Rneasy kit (Qiagen). cDNAs were synthesized using oligo(dT) and Superscript II reverse transcriptase (Invitrogen, Frederick, MD), following the manufacturer's protocol. cDNA products were amplified with the Taq PCR Master Mix Kit (Qiagen) using PCR primers designed against the corresponding Rattus norvegicus cDNAs for achaete-scute complex homolog 1 (Ascl1), calcitonin receptor (Calcr), amiloride-sensitive cation channel 1 (Accn1), Necdin (Ndn), solute carrier family 6 (neutral amino acid transporter), member 15 (Slc6a15), ALX homeobox 1 (Cart1 or Alx1), UDP glycosyltransferase 8 (Ugt8), Hu antigen B (Elavl2), homeobox B13 (Hoxb13), insulin-like growth factor binding protein 5 (Igfbp5), SIX homeobox 3 (Six3), WNT inhibitory factor 1 (Wif1), dickkopf 2 (Dkk2), dual specificity protein phosphatase 2 (Dusp2), dual specificity protein phosphatase 8 (Dusp8), interleukin 6 (Il6) in order to generate 300–400 bp amplified products (Supplementary ; http://biotools.umassmed.edu/bioapps/primer3_www.cgi ).

Techniques: SDS Page, Western Blot, Control, Quantitative Proteomics, Software, Isolation, Expressing, Activation Assay, Quantitative RT-PCR, Amplification

Distinct responses of MAPK, NF-κB p65 Rela, and Cebpb activation in response to IL-1β in Suz12 depleted cells. Control or Suz12 depleted IEC-6 cells were stimulated with 10 ng/ml of IL-1β for 10 min, 30 min, and 2 h. Whole cell protein extracts were separated by SDS–PAGE and transferred to PVDF membranes for Western blot analysis of phosphorylated JNK (Mapk8) and of total and phosphorylated p38 MAPK (Mapk14; A), and of total and phosphorylated-NF-κB p65 (Rela), and C/EBPβ (Cebp; B) with actin as a loading control. Results are representative of three independent experiments. In addition, total RNAs were isolated from control or Suz12 depleted cells. Expression levels of genes involved in MAPK pathway regulation (Dusp2, Dusp8; A) were verified by semi-quantitative RT-PCR, with Gapdh expression as a loading control. The amplified products were separated on 1.5% agarose gels. Results are representative of two independent experiments.

Journal: Journal of Cellular Biochemistry

Article Title: The Histone H3K27 Methylation Mark Regulates Intestinal Epithelial Cell Density-Dependent Proliferation and the Inflammatory Response

doi: 10.1002/jcb.24463

Figure Lengend Snippet: Distinct responses of MAPK, NF-κB p65 Rela, and Cebpb activation in response to IL-1β in Suz12 depleted cells. Control or Suz12 depleted IEC-6 cells were stimulated with 10 ng/ml of IL-1β for 10 min, 30 min, and 2 h. Whole cell protein extracts were separated by SDS–PAGE and transferred to PVDF membranes for Western blot analysis of phosphorylated JNK (Mapk8) and of total and phosphorylated p38 MAPK (Mapk14; A), and of total and phosphorylated-NF-κB p65 (Rela), and C/EBPβ (Cebp; B) with actin as a loading control. Results are representative of three independent experiments. In addition, total RNAs were isolated from control or Suz12 depleted cells. Expression levels of genes involved in MAPK pathway regulation (Dusp2, Dusp8; A) were verified by semi-quantitative RT-PCR, with Gapdh expression as a loading control. The amplified products were separated on 1.5% agarose gels. Results are representative of two independent experiments.

Article Snippet: Total cellular RNAs from ShControl or ShSuz12 IEC-6 cells, treated with or without IL-1β for 4 or 24 h were prepared with the Rneasy kit (Qiagen). cDNAs were synthesized using oligo(dT) and Superscript II reverse transcriptase (Invitrogen, Frederick, MD), following the manufacturer's protocol. cDNA products were amplified with the Taq PCR Master Mix Kit (Qiagen) using PCR primers designed against the corresponding Rattus norvegicus cDNAs for achaete-scute complex homolog 1 (Ascl1), calcitonin receptor (Calcr), amiloride-sensitive cation channel 1 (Accn1), Necdin (Ndn), solute carrier family 6 (neutral amino acid transporter), member 15 (Slc6a15), ALX homeobox 1 (Cart1 or Alx1), UDP glycosyltransferase 8 (Ugt8), Hu antigen B (Elavl2), homeobox B13 (Hoxb13), insulin-like growth factor binding protein 5 (Igfbp5), SIX homeobox 3 (Six3), WNT inhibitory factor 1 (Wif1), dickkopf 2 (Dkk2), dual specificity protein phosphatase 2 (Dusp2), dual specificity protein phosphatase 8 (Dusp8), interleukin 6 (Il6) in order to generate 300–400 bp amplified products (Supplementary ; http://biotools.umassmed.edu/bioapps/primer3_www.cgi ).

Techniques: Activation Assay, Control, SDS Page, Western Blot, Isolation, Expressing, Quantitative RT-PCR, Amplification

Suz12 depletion deregulates basal and IL-1β-induced inflammatory gene expression. Total RNAs were isolated from control or Suz12 depleted IEC-6 cells stimulated with 10 ng/ml of IL-1β for 4 or 24 h. Expression levels of various IL-1β-regulated inflammatory genes were verified by semi-quantitative RT-PCR, with Gapdh expression as a loading control. The amplified products were separated on 1.5% agarose gels. The histograms indicate the ratio of ShSuz12 versus ShControl band intensities normalized to Gapdh. Relative quantification of band intensity was performed with the Quantity One software. Results are representative of two independent experiments.

Journal: Journal of Cellular Biochemistry

Article Title: The Histone H3K27 Methylation Mark Regulates Intestinal Epithelial Cell Density-Dependent Proliferation and the Inflammatory Response

doi: 10.1002/jcb.24463

Figure Lengend Snippet: Suz12 depletion deregulates basal and IL-1β-induced inflammatory gene expression. Total RNAs were isolated from control or Suz12 depleted IEC-6 cells stimulated with 10 ng/ml of IL-1β for 4 or 24 h. Expression levels of various IL-1β-regulated inflammatory genes were verified by semi-quantitative RT-PCR, with Gapdh expression as a loading control. The amplified products were separated on 1.5% agarose gels. The histograms indicate the ratio of ShSuz12 versus ShControl band intensities normalized to Gapdh. Relative quantification of band intensity was performed with the Quantity One software. Results are representative of two independent experiments.

Article Snippet: Total cellular RNAs from ShControl or ShSuz12 IEC-6 cells, treated with or without IL-1β for 4 or 24 h were prepared with the Rneasy kit (Qiagen). cDNAs were synthesized using oligo(dT) and Superscript II reverse transcriptase (Invitrogen, Frederick, MD), following the manufacturer's protocol. cDNA products were amplified with the Taq PCR Master Mix Kit (Qiagen) using PCR primers designed against the corresponding Rattus norvegicus cDNAs for achaete-scute complex homolog 1 (Ascl1), calcitonin receptor (Calcr), amiloride-sensitive cation channel 1 (Accn1), Necdin (Ndn), solute carrier family 6 (neutral amino acid transporter), member 15 (Slc6a15), ALX homeobox 1 (Cart1 or Alx1), UDP glycosyltransferase 8 (Ugt8), Hu antigen B (Elavl2), homeobox B13 (Hoxb13), insulin-like growth factor binding protein 5 (Igfbp5), SIX homeobox 3 (Six3), WNT inhibitory factor 1 (Wif1), dickkopf 2 (Dkk2), dual specificity protein phosphatase 2 (Dusp2), dual specificity protein phosphatase 8 (Dusp8), interleukin 6 (Il6) in order to generate 300–400 bp amplified products (Supplementary ; http://biotools.umassmed.edu/bioapps/primer3_www.cgi ).

Techniques: Gene Expression, Isolation, Control, Expressing, Quantitative RT-PCR, Amplification, Quantitative Proteomics, Software

Activation of σ 54 -dependent transcription and activator structure. A) σ 54 (red subunit) directs binding of the RNA polymerase (dark blue subunit) holoenzyme (Eσ 54 ) to the -12, -24 promoter elements (light blue box). This closed complex is stable and cannot transition to open complex. In response to an environmental or cellular signal, the activator (bEBP; yellow dimers) oligomerizes. For most bEBPs, the oligomer binds to an enhancer (green box) 80 to 150 bp upstream of the promoter and DNA looping brings the activator in contact with σ 54 in the Eσ 54 closed complex. Hydrolysis of ATP by bEBP causes remodeling of Eσ 54 , which leads to open complex formation and transcription. There are a few bacteria with bEBPs that are missing the DNA binding domain; after oligomerization, these activators can bind to Eσ 54 in closed complex with any promoter to stimulate open complex formation (promiscuous activation). B) The domain structure for the Sinorhizobium meliloti bEBP, DctD, is typical of most bEBPs. The amino-terminal regulatory domain (dark blue box) inhibits assembly of the bEBP oligomer until it interacts with an activation signal; the AAA+ ATPase domain (red box) mediates ATP binding and hydrolysis, as well as the protein-protein interactions between bEBPs (oligomerization) and between bEBP and σ 54 ; the carboxyl-terminal DNA binding domain (aqua box) contains a helix-turn-helix motif for binding the enhancer. The truncated DctD variant, DctD250, is missing the regulatory and DNA binding domains, so that it is constitutively active and promiscuous in stimulating transcription from σ 54 -dependent promoters.

Journal: BMC Genomics

Article Title: Use of a promiscuous, constitutively-active bacterial enhancer-binding protein to define the σ 54 (RpoN) regulon of Salmonella Typhimurium LT2

doi: 10.1186/1471-2164-14-602

Figure Lengend Snippet: Activation of σ 54 -dependent transcription and activator structure. A) σ 54 (red subunit) directs binding of the RNA polymerase (dark blue subunit) holoenzyme (Eσ 54 ) to the -12, -24 promoter elements (light blue box). This closed complex is stable and cannot transition to open complex. In response to an environmental or cellular signal, the activator (bEBP; yellow dimers) oligomerizes. For most bEBPs, the oligomer binds to an enhancer (green box) 80 to 150 bp upstream of the promoter and DNA looping brings the activator in contact with σ 54 in the Eσ 54 closed complex. Hydrolysis of ATP by bEBP causes remodeling of Eσ 54 , which leads to open complex formation and transcription. There are a few bacteria with bEBPs that are missing the DNA binding domain; after oligomerization, these activators can bind to Eσ 54 in closed complex with any promoter to stimulate open complex formation (promiscuous activation). B) The domain structure for the Sinorhizobium meliloti bEBP, DctD, is typical of most bEBPs. The amino-terminal regulatory domain (dark blue box) inhibits assembly of the bEBP oligomer until it interacts with an activation signal; the AAA+ ATPase domain (red box) mediates ATP binding and hydrolysis, as well as the protein-protein interactions between bEBPs (oligomerization) and between bEBP and σ 54 ; the carboxyl-terminal DNA binding domain (aqua box) contains a helix-turn-helix motif for binding the enhancer. The truncated DctD variant, DctD250, is missing the regulatory and DNA binding domains, so that it is constitutively active and promiscuous in stimulating transcription from σ 54 -dependent promoters.

Article Snippet: Ligated was purified using the Qiagen PCR purification kit and the DNA was amplified with Taq polymerase (Fermentas; Burlington, ON) using LM-PCR-R as the PCR primer and the following cycling conditions: 55°C—2 min (1×); 72°C—5 min (1×); 94°C—5 min (1×); 94°C—1 min, 55°C—1 min, 72°C—1 min (24×); 72°C—5 min (1×); 4°C—hold.

Techniques: Activation Assay, Binding Assay, Bacteria, Protein-Protein interactions, Variant Assay

Dynamics of DNA methylation and its relationship with expression changes. (A) Heatmap showing expression levels on 0, 5, and 20 days for genes displaying significant methylation and expression changes (4,753 in total with FC ≥2 or FC ≤0.5; P ≤0.01 and FDR ≤0.05) (Additional file ). (B) catterplots showing the relationship between the log 2 -transformed FC in expression and the log 2 -transformed FC in DNA methylation. Sixty-two percent of the hypomethylated genes are overexpressed (in blue); 55% of the hypermethylated genes are repressed (in red). (C) Correlation between methylation and expression data (slope from the linear regression between DNA methylation differences versus expression differences) for all differentially methylated genes organized by genomic location (first exon, TSS, 5′UTR, gene body, 3′UTR). (D) DNA methylation and expression dynamics of selected loci during monocyte-to-osteoclast differentiation. Methylation percentage determined by bisulfite pyrosequencing. Quantitative RT-PCR data relative to RPL38. DNA methylation and expression data are represented with a black line and a red line, respectively. (E) BrdU assay showing the percentage of replicating cells at different times. From days 1 to 4, only 9.46% of cells divide. (F) Effects of 5azadC treatment (50 nM, 500 nM) on osteoclastogenesis monitoring ACP5 , CTSK , and CX3CR1 levels and TRAP staining over time. (G) Workflow for testing the presence of 5 hydroxymethylcytosine in hypomethylated genes. DNA was treated with a 5hmC-specific glucosyltransferase. Cytosines bearing a 5-hydroxymethyl are protected against MspI digestion, and the surrounding region can be amplified by qPCR. When no 5hmC is present, glucose is not transferred to C, DNA is cleaved at CCGG sites, and there is less qPCR amplification. Several controls are used to set the 0% and 100% content of 5hmC. (H) 5hmC content in several of the CpGs that are rapidly demethylated after RANKL and M-CSF stimulation of OC precursors.

Journal: Genome Biology

Article Title: PU.1 target genes undergo Tet2-coupled demethylation and DNMT3b-mediated methylation in monocyte-to-osteoclast differentiation

doi: 10.1186/gb-2013-14-9-r99

Figure Lengend Snippet: Dynamics of DNA methylation and its relationship with expression changes. (A) Heatmap showing expression levels on 0, 5, and 20 days for genes displaying significant methylation and expression changes (4,753 in total with FC ≥2 or FC ≤0.5; P ≤0.01 and FDR ≤0.05) (Additional file ). (B) catterplots showing the relationship between the log 2 -transformed FC in expression and the log 2 -transformed FC in DNA methylation. Sixty-two percent of the hypomethylated genes are overexpressed (in blue); 55% of the hypermethylated genes are repressed (in red). (C) Correlation between methylation and expression data (slope from the linear regression between DNA methylation differences versus expression differences) for all differentially methylated genes organized by genomic location (first exon, TSS, 5′UTR, gene body, 3′UTR). (D) DNA methylation and expression dynamics of selected loci during monocyte-to-osteoclast differentiation. Methylation percentage determined by bisulfite pyrosequencing. Quantitative RT-PCR data relative to RPL38. DNA methylation and expression data are represented with a black line and a red line, respectively. (E) BrdU assay showing the percentage of replicating cells at different times. From days 1 to 4, only 9.46% of cells divide. (F) Effects of 5azadC treatment (50 nM, 500 nM) on osteoclastogenesis monitoring ACP5 , CTSK , and CX3CR1 levels and TRAP staining over time. (G) Workflow for testing the presence of 5 hydroxymethylcytosine in hypomethylated genes. DNA was treated with a 5hmC-specific glucosyltransferase. Cytosines bearing a 5-hydroxymethyl are protected against MspI digestion, and the surrounding region can be amplified by qPCR. When no 5hmC is present, glucose is not transferred to C, DNA is cleaved at CCGG sites, and there is less qPCR amplification. Several controls are used to set the 0% and 100% content of 5hmC. (H) 5hmC content in several of the CpGs that are rapidly demethylated after RANKL and M-CSF stimulation of OC precursors.

Article Snippet: PCRs were performed with the HotStart Taq DNA polymerase PCR kit (Qiagen), and the success of amplification was assessed by agarose gel electrophoresis.

Techniques: DNA Methylation Assay, Expressing, Methylation, Transformation Assay, Quantitative RT-PCR, BrdU Staining, Staining, Amplification

Interactions between PU.1 and DNTM3b and TET2 and association with promoters undergoing DNA methylation changes. (A) Quantitative RT-PCR analysis for CTSK , PU.1 , p65 NF-kB , TET1 , TET2 , and DNMT3B during osteoclastogenesis. (B) Western blot for the same factors indicated above. (C) Immunoprecipitation experiment of p65 and PU.1 with DNMT3B and TET2 at 0, 2, and 4 days after RANKL and M-CSF stimulation. IgG used as a negative control. Reciprocal immunoprecipitation experiments in the bottom panel. (D) Quantitative ChIP assays showing PU.1, TET2, and DNMT3b binding to hypomethylated genes ( ACP5 , TM7SF4 , TM4SF19 ) and hypermethylated genes ( CX3CR1 , NR4A2 ), all direct PU.1 targets, and a negative control (MYOD1 promoter) without PU.1 target sites. The experiment was performed with three biological triplicates but only one experiment is shown. T-student test comparing binding of each antibody between 0 days vs. 2 days was performed: * corresponds to P value <0.05; ** means P value <0.01; *** means P value <0.001. (E) Examples showing PU.1 binding (from ChIPseq data, GSE31621) to the region neighboring hypo- and hypermethylated CpGs. The PU.1 binding motif location is presented as a horizontal blue dot and the CpG displaying differential methylation (Illumina probe) between MO and OC is marked with a red bar. (F) Analysis of ChIPseq analysis for PU.1 and comparison to TRANSFAC predictions. Top panel: proportion of the CpG-containing probes displaying DNA methylation changes that have peaks for PU.1 binding in the same 500-bp window. Diagrams are separated in the hypo- and hypermethylated sets and in promoter and distal regions (gene bodies, 3′UTR, and intergenic regions). Bottom panel, Venn diagrams showing the overlap of PU.1 targets from ChIPseq data (GEO accession number: GSE31621) in MOs and TRANSFAC prediction for PU.1, both using a window of 500 pb centered by the CpG displaying significant methylation changes.

Journal: Genome Biology

Article Title: PU.1 target genes undergo Tet2-coupled demethylation and DNMT3b-mediated methylation in monocyte-to-osteoclast differentiation

doi: 10.1186/gb-2013-14-9-r99

Figure Lengend Snippet: Interactions between PU.1 and DNTM3b and TET2 and association with promoters undergoing DNA methylation changes. (A) Quantitative RT-PCR analysis for CTSK , PU.1 , p65 NF-kB , TET1 , TET2 , and DNMT3B during osteoclastogenesis. (B) Western blot for the same factors indicated above. (C) Immunoprecipitation experiment of p65 and PU.1 with DNMT3B and TET2 at 0, 2, and 4 days after RANKL and M-CSF stimulation. IgG used as a negative control. Reciprocal immunoprecipitation experiments in the bottom panel. (D) Quantitative ChIP assays showing PU.1, TET2, and DNMT3b binding to hypomethylated genes ( ACP5 , TM7SF4 , TM4SF19 ) and hypermethylated genes ( CX3CR1 , NR4A2 ), all direct PU.1 targets, and a negative control (MYOD1 promoter) without PU.1 target sites. The experiment was performed with three biological triplicates but only one experiment is shown. T-student test comparing binding of each antibody between 0 days vs. 2 days was performed: * corresponds to P value <0.05; ** means P value <0.01; *** means P value <0.001. (E) Examples showing PU.1 binding (from ChIPseq data, GSE31621) to the region neighboring hypo- and hypermethylated CpGs. The PU.1 binding motif location is presented as a horizontal blue dot and the CpG displaying differential methylation (Illumina probe) between MO and OC is marked with a red bar. (F) Analysis of ChIPseq analysis for PU.1 and comparison to TRANSFAC predictions. Top panel: proportion of the CpG-containing probes displaying DNA methylation changes that have peaks for PU.1 binding in the same 500-bp window. Diagrams are separated in the hypo- and hypermethylated sets and in promoter and distal regions (gene bodies, 3′UTR, and intergenic regions). Bottom panel, Venn diagrams showing the overlap of PU.1 targets from ChIPseq data (GEO accession number: GSE31621) in MOs and TRANSFAC prediction for PU.1, both using a window of 500 pb centered by the CpG displaying significant methylation changes.

Article Snippet: PCRs were performed with the HotStart Taq DNA polymerase PCR kit (Qiagen), and the success of amplification was assessed by agarose gel electrophoresis.

Techniques: DNA Methylation Assay, Quantitative RT-PCR, Western Blot, Immunoprecipitation, Negative Control, Binding Assay, Methylation, Comparison

PU.1 has a direct role in leading DNA methylation changes at their targets. (A) Scheme depicting the two regions of the SPI1 gene (PU.1) (exon 2 and 3′UTR) targeted by the two siRNAs used in this study. (B) Effects of siRNA experiments on PU.1 levels at 1, 2, 4, and 6 days as analyzed by qRT-pCR. (C) Effects of siRNA experiments on PU.1 levels at 1, 2, 4, and 6 days as analyzed by western blot (D) Effects of PU.1 downregulation on expression and methylation of PU.1-target genes that become demethylated ( ACP5 , CTSK ), genes that become hypermethylated ( CX3CR1 , NR4A2 ) and non-pU.1 target genes, PLA2G4E , which becomes also overexpressed and demethylated, and FSCN3 , which is hypermethylated and does not undergo loss of methylation during osteoclastogenesis. (E) ChIP assays showing the effects of PU.1 downregulation in its recruitment, together with TET2 and DNMT3b binding to the same genes. Data were obtained at 0, 2, and 6 days after M-CSF /RANL stimulation. To simplify the representation negative control assays with IgG for each time point have been substracted to the experiments with each antibody. We have used the MYOD1 promoter as a negative control (data without substracting the background is presented in Additional file ). The experiment was performed with three biological triplicates but only one experiment is shown. Error bars correspond to technical replicates. Some of them are smaller than the data point icon. T-student test was performed: * corresponds to P value <0.05; ** means P value <0.01; *** means P value <0.001.

Journal: Genome Biology

Article Title: PU.1 target genes undergo Tet2-coupled demethylation and DNMT3b-mediated methylation in monocyte-to-osteoclast differentiation

doi: 10.1186/gb-2013-14-9-r99

Figure Lengend Snippet: PU.1 has a direct role in leading DNA methylation changes at their targets. (A) Scheme depicting the two regions of the SPI1 gene (PU.1) (exon 2 and 3′UTR) targeted by the two siRNAs used in this study. (B) Effects of siRNA experiments on PU.1 levels at 1, 2, 4, and 6 days as analyzed by qRT-pCR. (C) Effects of siRNA experiments on PU.1 levels at 1, 2, 4, and 6 days as analyzed by western blot (D) Effects of PU.1 downregulation on expression and methylation of PU.1-target genes that become demethylated ( ACP5 , CTSK ), genes that become hypermethylated ( CX3CR1 , NR4A2 ) and non-pU.1 target genes, PLA2G4E , which becomes also overexpressed and demethylated, and FSCN3 , which is hypermethylated and does not undergo loss of methylation during osteoclastogenesis. (E) ChIP assays showing the effects of PU.1 downregulation in its recruitment, together with TET2 and DNMT3b binding to the same genes. Data were obtained at 0, 2, and 6 days after M-CSF /RANL stimulation. To simplify the representation negative control assays with IgG for each time point have been substracted to the experiments with each antibody. We have used the MYOD1 promoter as a negative control (data without substracting the background is presented in Additional file ). The experiment was performed with three biological triplicates but only one experiment is shown. Error bars correspond to technical replicates. Some of them are smaller than the data point icon. T-student test was performed: * corresponds to P value <0.05; ** means P value <0.01; *** means P value <0.001.

Article Snippet: PCRs were performed with the HotStart Taq DNA polymerase PCR kit (Qiagen), and the success of amplification was assessed by agarose gel electrophoresis.

Techniques: DNA Methylation Assay, Quantitative RT-PCR, Western Blot, Expressing, Methylation, Binding Assay, Negative Control

( A ) CAR proteins associate with elongating RNA Polymerase II through interactions with the phosphoCTD. Elongating Pol II (dark blue) is depicted with 3 classes of PCTD associating proteins (shades of pink, brown, and blue, respectively) bound either directly or indirectly to the normally-phosphorylated CTD (dark blue line). We speculate that some CAR proteins form complexes with particular functions; here, for example, we propose that A, B, C, D and E comprise a CAR complex that functions as a damage-responsive module; note how it is coupled to the globular catalytic core of PolII. The elongating catalytic core of Pol II will soon encounter a translocation-blocking DNA lesion (red star on orange DNA). ( B ) CAR proteins respond to damage that blocks elongation. The catalytic core of Pol II has collided with the lesion; translocation is blocked . Changes ensue, signaling that polymerase is blocked and ultimately leading to repair. Possible changes include: 1) alterations in conformation, depicted by shape and surface changes (of core and proteins coupled to it, such as A and B, C, D and E); 2) dissociations and signaling (protein E); 3) changes in activity (not indicated); 4) covalent modifications (beacons on B & D) that signal and/or recruit other components. The combined changes comprise the normal damage response, that leads to repair and normal “damage resistance.” ( C ) An abnormal CAR complex results in aberrant damage response. Here, CAR protein C is truncated, missing its PCTD interacting domain (e.g. SRI domain of Set2). C and E are shown in ghostly white, because in reality they would not properly associate with the elongation complex. Note also that D is no longer coupled to the catalytic core. ( D ) A disrupted CAR system leads to reduced damage resistance. When damage blocks the movement of PolII, changes are induced, but their extent is diminished due to absence of PCTD-binding by mutated protein C. Signaling is reduced (signaling from D and E does not occur). Because only a partial damage response is generated, a reduction in damage resistance is observed. We expect that the specific defects underlying a reduced damage response will differ from case to case, depending on which CAR protein is defective and on the nature of the DNA damage.

Journal: PLoS ONE

Article Title: A DNA Damage Response System Associated with the phosphoCTD of Elongating RNA Polymerase II

doi: 10.1371/journal.pone.0060909

Figure Lengend Snippet: ( A ) CAR proteins associate with elongating RNA Polymerase II through interactions with the phosphoCTD. Elongating Pol II (dark blue) is depicted with 3 classes of PCTD associating proteins (shades of pink, brown, and blue, respectively) bound either directly or indirectly to the normally-phosphorylated CTD (dark blue line). We speculate that some CAR proteins form complexes with particular functions; here, for example, we propose that A, B, C, D and E comprise a CAR complex that functions as a damage-responsive module; note how it is coupled to the globular catalytic core of PolII. The elongating catalytic core of Pol II will soon encounter a translocation-blocking DNA lesion (red star on orange DNA). ( B ) CAR proteins respond to damage that blocks elongation. The catalytic core of Pol II has collided with the lesion; translocation is blocked . Changes ensue, signaling that polymerase is blocked and ultimately leading to repair. Possible changes include: 1) alterations in conformation, depicted by shape and surface changes (of core and proteins coupled to it, such as A and B, C, D and E); 2) dissociations and signaling (protein E); 3) changes in activity (not indicated); 4) covalent modifications (beacons on B & D) that signal and/or recruit other components. The combined changes comprise the normal damage response, that leads to repair and normal “damage resistance.” ( C ) An abnormal CAR complex results in aberrant damage response. Here, CAR protein C is truncated, missing its PCTD interacting domain (e.g. SRI domain of Set2). C and E are shown in ghostly white, because in reality they would not properly associate with the elongation complex. Note also that D is no longer coupled to the catalytic core. ( D ) A disrupted CAR system leads to reduced damage resistance. When damage blocks the movement of PolII, changes are induced, but their extent is diminished due to absence of PCTD-binding by mutated protein C. Signaling is reduced (signaling from D and E does not occur). Because only a partial damage response is generated, a reduction in damage resistance is observed. We expect that the specific defects underlying a reduced damage response will differ from case to case, depending on which CAR protein is defective and on the nature of the DNA damage.

Article Snippet: The resulting PCR product was then purified using a PCR clean-up kit (Qiagen) and incubated for 10 minutes at 72 degrees with taq polymerase and dNTPs to add adenine overhangs on the 3′ ends of the PCR product.

Techniques: Translocation Assay, Blocking Assay, Activity Assay, Binding Assay, Generated

Purification of His-Taq Pol and C-His/Strep MMLV-RT. A) Summary of expression and purification procedures for His-Taq Pol and C-His/Strep MMLV-RT (see the details in the Materials and Methods). B) Schematic representation of the constructs of the recombinant His-Taq Pol and C-His/Strep MMLV-RT expression vectors. CSPA promoter; cold-shock protein A promoter, RBS; ribosome binding site, 6X His; His-tag with 6 histidines, TEE; translational-enhancing element, Taq ORF; Taq Pol open reading frame, Polh; polyhedrin promoter, MMLV-RT ORF; MMLV-RT open reading frame, TEV; Tabacco Etch virus protease targeting site, 8X His; His-tag with 8 histidines, Strep; Strep-tag, polyA; SV40 late polyadenylation signal. C) SDS-PAGE analysis of overexpressed His-Taq Pol in BL21(DE3) E. coli cells (left) and purified His-Pol. As a size control, native Taq Pol (N-Taq Pol) (Invitrogen, 18038-018) was applied by 1 µL (5 U). D) SDS-PAGE analysis of purified C-His/Strep MMLV-RT expressed in the Sf9 cells. As a size control, SuperScript III (SSIII, Invitrogen, 18080051) was applied by 1 µL (200 U). E) Summary of closing yields of purified His-Taq Pol and C-His/Strep MMLV-RT.

Journal: medRxiv

Article Title: R3T (Rapid Research Response Team) One-step RT-qPCR kit for COVID-19 diagnostic using in-house enzymes

doi: 10.1101/2020.07.31.20165704

Figure Lengend Snippet: Purification of His-Taq Pol and C-His/Strep MMLV-RT. A) Summary of expression and purification procedures for His-Taq Pol and C-His/Strep MMLV-RT (see the details in the Materials and Methods). B) Schematic representation of the constructs of the recombinant His-Taq Pol and C-His/Strep MMLV-RT expression vectors. CSPA promoter; cold-shock protein A promoter, RBS; ribosome binding site, 6X His; His-tag with 6 histidines, TEE; translational-enhancing element, Taq ORF; Taq Pol open reading frame, Polh; polyhedrin promoter, MMLV-RT ORF; MMLV-RT open reading frame, TEV; Tabacco Etch virus protease targeting site, 8X His; His-tag with 8 histidines, Strep; Strep-tag, polyA; SV40 late polyadenylation signal. C) SDS-PAGE analysis of overexpressed His-Taq Pol in BL21(DE3) E. coli cells (left) and purified His-Pol. As a size control, native Taq Pol (N-Taq Pol) (Invitrogen, 18038-018) was applied by 1 µL (5 U). D) SDS-PAGE analysis of purified C-His/Strep MMLV-RT expressed in the Sf9 cells. As a size control, SuperScript III (SSIII, Invitrogen, 18080051) was applied by 1 µL (200 U). E) Summary of closing yields of purified His-Taq Pol and C-His/Strep MMLV-RT.

Article Snippet: The PCR reactions by Taq Pol were performed in reaction buffer [20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl 2 , 200 µM dNTPs] besides various amounts of ammonium sulfate and MMLV-RT. pUC19 vector (Invitrogen) was used as a template to amplify the ampicillin resistance gene with the following primers: 5’-TTACCAATGCTTAATCAGTGAGGCACC-3’ and 5’-ATGAGTATTCAACATTTCCGTGTCGCCC-3’.

Techniques: Purification, Expressing, Construct, Recombinant, Binding Assay, Strep-tag, SDS Page

A) Activity assays of His-Taq Pol and N-Taq Pol by PCR. Purified His-Taq Pol was serially diluted by the storage buffer (see Materials and Methods) with the indicated dilution factors and subjected to the PCR reactions. N-Taq Pol is the same as in and the standard titration curve made by N-Taq Pol is shown in Supplemental Figure 1. B) Activity assays of C-His/Strep MMLV-RT and other commercially available reverse transcriptases. The first-strand cDNA was synthesized from SARS-CoV-2 N gene RNAs, and the 2019-nCoV_N3 qPCR assay was conducted. The yields of cDNA synthesis were shown in relative ones compared to that of SuperScript II. Error bars represent standard errors. C) MMLV-RT inhibitory effect on Taq Pol activity in the PCR reaction. The indicated amounts of purified C-His/Strep MMLV-RT were added to the PCR premixture containing different units of Taq Pol. Error bars represent standard errors. D) Ammonium sulfate eases the inhibitory effect of MMLV-RT on the Taq Pol’s activity in PCR. The different amount of ammonium sulfate were added to the PCR reaction mixture without C-His/Strep MMLV-RT, subsequently, 20 ng of C-His/Strep MMLV-RT was added to the reaction. E) The effect of the DTT concentration on the baseline of the TaqMan based detection system. The one-step RT-qPCR reaction was performed with 1,000 copies of the synthetic RNAs as a template. ΔRn; Rn is the fluorescence of the reporter dye divided by the fluorescence of a passive reference dye, ΔRn is Rn minus the baseline.

Journal: medRxiv

Article Title: R3T (Rapid Research Response Team) One-step RT-qPCR kit for COVID-19 diagnostic using in-house enzymes

doi: 10.1101/2020.07.31.20165704

Figure Lengend Snippet: A) Activity assays of His-Taq Pol and N-Taq Pol by PCR. Purified His-Taq Pol was serially diluted by the storage buffer (see Materials and Methods) with the indicated dilution factors and subjected to the PCR reactions. N-Taq Pol is the same as in and the standard titration curve made by N-Taq Pol is shown in Supplemental Figure 1. B) Activity assays of C-His/Strep MMLV-RT and other commercially available reverse transcriptases. The first-strand cDNA was synthesized from SARS-CoV-2 N gene RNAs, and the 2019-nCoV_N3 qPCR assay was conducted. The yields of cDNA synthesis were shown in relative ones compared to that of SuperScript II. Error bars represent standard errors. C) MMLV-RT inhibitory effect on Taq Pol activity in the PCR reaction. The indicated amounts of purified C-His/Strep MMLV-RT were added to the PCR premixture containing different units of Taq Pol. Error bars represent standard errors. D) Ammonium sulfate eases the inhibitory effect of MMLV-RT on the Taq Pol’s activity in PCR. The different amount of ammonium sulfate were added to the PCR reaction mixture without C-His/Strep MMLV-RT, subsequently, 20 ng of C-His/Strep MMLV-RT was added to the reaction. E) The effect of the DTT concentration on the baseline of the TaqMan based detection system. The one-step RT-qPCR reaction was performed with 1,000 copies of the synthetic RNAs as a template. ΔRn; Rn is the fluorescence of the reporter dye divided by the fluorescence of a passive reference dye, ΔRn is Rn minus the baseline.

Article Snippet: The PCR reactions by Taq Pol were performed in reaction buffer [20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl 2 , 200 µM dNTPs] besides various amounts of ammonium sulfate and MMLV-RT. pUC19 vector (Invitrogen) was used as a template to amplify the ampicillin resistance gene with the following primers: 5’-TTACCAATGCTTAATCAGTGAGGCACC-3’ and 5’-ATGAGTATTCAACATTTCCGTGTCGCCC-3’.

Techniques: Activity Assay, Purification, Titration, Synthesized, Concentration Assay, Quantitative RT-PCR, Fluorescence

Determination of the optimal proportions of Taq Pol and MMLV-RT in the one-step RT-qPCR reactions. The one-step RT-qPCR reactions were conducted using the synthetic RNAs with 10-fold serial dilutions (from 10 to 10 copies/µL) as a template with N1 or N2 primer sets (See Materials and Methods). As a control, we used (A) SuperScript III Platinum One-Step RT-qPCR kit, (B) 20 units (U) of His-Taq Pol and 40 ng/µL of C-His/Strep MMLV-RT, (C) 30 U and 60 ng/µL, and (D) 40 U and 80 ng/µL. The mixtures were subjected to the reactions and the Ct values were plotted against the threshold cycle. Each plot represents the mean of 3 replicated Ct values with each RNA sample. The coefficient of determination (R 2 ) and the equation of the regression curve (y) were calculated and shown in each panel.

Journal: medRxiv

Article Title: R3T (Rapid Research Response Team) One-step RT-qPCR kit for COVID-19 diagnostic using in-house enzymes

doi: 10.1101/2020.07.31.20165704

Figure Lengend Snippet: Determination of the optimal proportions of Taq Pol and MMLV-RT in the one-step RT-qPCR reactions. The one-step RT-qPCR reactions were conducted using the synthetic RNAs with 10-fold serial dilutions (from 10 to 10 copies/µL) as a template with N1 or N2 primer sets (See Materials and Methods). As a control, we used (A) SuperScript III Platinum One-Step RT-qPCR kit, (B) 20 units (U) of His-Taq Pol and 40 ng/µL of C-His/Strep MMLV-RT, (C) 30 U and 60 ng/µL, and (D) 40 U and 80 ng/µL. The mixtures were subjected to the reactions and the Ct values were plotted against the threshold cycle. Each plot represents the mean of 3 replicated Ct values with each RNA sample. The coefficient of determination (R 2 ) and the equation of the regression curve (y) were calculated and shown in each panel.

Article Snippet: The PCR reactions by Taq Pol were performed in reaction buffer [20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl 2 , 200 µM dNTPs] besides various amounts of ammonium sulfate and MMLV-RT. pUC19 vector (Invitrogen) was used as a template to amplify the ampicillin resistance gene with the following primers: 5’-TTACCAATGCTTAATCAGTGAGGCACC-3’ and 5’-ATGAGTATTCAACATTTCCGTGTCGCCC-3’.

Techniques: Quantitative RT-PCR

(A) Dimers A and B produced by hpdR are combined on Regulatory binding site (RBS) and Activation Binding Site (ABS); (B) The interaction between the two dimers forms a tetramer, leading to DNA bending; (C) RNA polymerase binds to the promoter. Transcription cannot be activated because of the abnormal conformation of DNA; (D) As 3-HP exists, 3-HP binds to hpdR tetramer, protein conformation changes, DNA bending is alleviated, and transcription is activated; (E) The dose-response curve of 3-HP-induced expression Pp HpdR/P hpdH in Q1Z2; The figure shows the relationship between the concentration of the inducer and fluorescence output after 3-HP was after 3-HP was added for about 12 hours. The inducer levels were 0.0001, 0.001, 0.01, 0.1, 0.2, 0.3, 0.4, 0.5,0.6 and 0.7 g/L, respectively. The error bars indicate the standard deviations of measurements from three independent cultures; (F) The cell density of strain CS2 at concentrations of chloramphenicol (0, 17, 34, 68, 85, 102 mg/L) when no 3-HP in medium; (G) The cell density of strain CS2 when adding concentrations of 3-HP (0.5, 0.7, 1.5, 2.0, 2.5 g/L), and the starting concentration of chloramphenicol in the medium is 17 mg/L, and the control group (CK) receives no additional chloramphenicol or 3-HP.

Journal: bioRxiv

Article Title: Efficient biosynthesis of 3-hydroxypropionic acid in recombinant Escherichia coli by metabolic engineering

doi: 10.1101/2025.08.26.672340

Figure Lengend Snippet: (A) Dimers A and B produced by hpdR are combined on Regulatory binding site (RBS) and Activation Binding Site (ABS); (B) The interaction between the two dimers forms a tetramer, leading to DNA bending; (C) RNA polymerase binds to the promoter. Transcription cannot be activated because of the abnormal conformation of DNA; (D) As 3-HP exists, 3-HP binds to hpdR tetramer, protein conformation changes, DNA bending is alleviated, and transcription is activated; (E) The dose-response curve of 3-HP-induced expression Pp HpdR/P hpdH in Q1Z2; The figure shows the relationship between the concentration of the inducer and fluorescence output after 3-HP was after 3-HP was added for about 12 hours. The inducer levels were 0.0001, 0.001, 0.01, 0.1, 0.2, 0.3, 0.4, 0.5,0.6 and 0.7 g/L, respectively. The error bars indicate the standard deviations of measurements from three independent cultures; (F) The cell density of strain CS2 at concentrations of chloramphenicol (0, 17, 34, 68, 85, 102 mg/L) when no 3-HP in medium; (G) The cell density of strain CS2 when adding concentrations of 3-HP (0.5, 0.7, 1.5, 2.0, 2.5 g/L), and the starting concentration of chloramphenicol in the medium is 17 mg/L, and the control group (CK) receives no additional chloramphenicol or 3-HP.

Article Snippet: High-fidelity DNA amplification was performed using Phanta Flash Super-Fidelity DNA Polymerase, and Taq DNA Polymerase along with restriction enzymes were sourced from Vazyme (Nanjing, China) or New England Biolabs (Ipswich, USA).

Techniques: Produced, Binding Assay, Activation Assay, Expressing, Concentration Assay, Fluorescence, Control