Journal: Biomedicines

Article Title: Role of Lamin A/C as Candidate Biomarker of Aggressiveness and Tumorigenicity in Glioblastoma Multiforme

doi: 10.3390/biomedicines9101343

Figure Lengend Snippet: Modulation of LMNA gene expression in GBM T98G cells. ( A ) Relative quantification (RQ) of LMNA gene in LMNA -KD (dashed) and LMNA + overexpressed (black) T98G cells as analysed by qRT-PCR. The data are reported as the level of mRNA relative to the respective transfected vector control cells and are the means + SD (n = 3). Statistical significance: LMNA + and KD vs mock **** p < 0.0001. ( B ) Top, representative western blot of the Lamin A/C protein in LMNA -KD (KD) and LMNA + T98G cells; bottom, blots densitometry as analyzed by ImageJ software. Values are averages + s.d. (n = 3), relative to mock cells (white) of three independent experiments with similar results. LMNA -KD (dashed), LMNA+ (black). GAPDH was used as loading control.). Statistical significance: LMNA + and KD vs mock ** p < 0.01. ( C ) Representative confocal images of mock, LMNA -KD (KD) and LMNA + cells. Red, Lamin A/C immunostaining; blue, DAPI. Scale bar: 10 microns.

Article Snippet: T98G human GBM cell line (KCLB Cat# 21690) was cultured in Dulbecco’s modified Eagle’s Medium (DMEM) supplemented with 10% FBS, 2mM L-glutamine and 1% penicillin/streptomycin.

Techniques: Gene Expression, Quantitative Proteomics, Quantitative RT-PCR, Transfection, Plasmid Preparation, Control, Western Blot, Software, Immunostaining

Journal: Biomedicines

Article Title: Role of Lamin A/C as Candidate Biomarker of Aggressiveness and Tumorigenicity in Glioblastoma Multiforme

doi: 10.3390/biomedicines9101343

Figure Lengend Snippet: Overexpression of LMNA gene increases GBM aggressiveness and tumorigenesis. ( A ) Graphic quantification of colonies as analyzed by a colony-forming assay, showing that LMNA overexpression increased T98G cell colonies. The data are presented as the mean ± SEM of three independent experiments. Statistical significance: LMNA + vs mock cells **** p < 0.0001; KD vs mock cells **** p < 0.0001. ( B ) Representative confocal images of mock LMNA + and LMNA -KD (KD) cells. Red, F-actin; blue, DAPI. Scale bar: 10 microns. It is worthwhile to note that F-actin fibers are more organized and increased in number in LMNA + cell clone. ( C ) Cell migration as analyzed by a wound healing assay. LMNA expression has effect on migratory capacity as LMNA overexpression clearly increases wound healing at 48 h compared to the control cells. Left panel, representative images were captured with a phase-contrast microscope (20X) at 18, 24 and 48 h after wound. Scale bar (50 µm) is the same for all the images and is shown in the right bottom image. Right panel, values of wound area (mm2) ± SEM (n = 3). mock cells (white), KD cells (dashed), LMNA + cells (black). Statistical significance: LMNA + vs Mock cells * p < 0.05, ** p < 0.01. ( D ) mock (*), LMNA + (•) and LMNA -KD cells were injected subcutaneously into the flanks of immunosuppressed mice at 10 6 cells/mouse in 200 μL of Matrigel. When a tumor mass was evident, the tumor sizes were measured, and the tumor volumes were calculated using the following formula: (a × b 2 )/2, where a and b are the long and short diameters of the tumor, respectively. Injection of KD cells did not give rise to any tumour in the mouse up to 54 days post-injection, when also mice injected with mock cells were sacrificed. The mean ± SD tumor volumes are reported (n = 6).

Article Snippet: T98G human GBM cell line (KCLB Cat# 21690) was cultured in Dulbecco’s modified Eagle’s Medium (DMEM) supplemented with 10% FBS, 2mM L-glutamine and 1% penicillin/streptomycin.

Techniques: Over Expression, Migration, Wound Healing Assay, Expressing, Control, Microscopy, Injection

Journal: Biomedicines

Article Title: Role of Lamin A/C as Candidate Biomarker of Aggressiveness and Tumorigenicity in Glioblastoma Multiforme

doi: 10.3390/biomedicines9101343

Figure Lengend Snippet: LMNA overexpression increases cell adhesion gene expression. Relative quantification (RQ) of the indicated genes in LMNA + (black) and LMNA -KD (dashed) T98G cells as analysed by qRT-PCR. The data are reported as the level of LMNA + clone mRNA relative to the LMNA -KD clone and are the means + SD (n = 3). Statistical significance: * p ≤ 0.05.

Article Snippet: T98G human GBM cell line (KCLB Cat# 21690) was cultured in Dulbecco’s modified Eagle’s Medium (DMEM) supplemented with 10% FBS, 2mM L-glutamine and 1% penicillin/streptomycin.

Techniques: Over Expression, Gene Expression, Quantitative Proteomics, Quantitative RT-PCR

Journal: Biomedicines

Article Title: Role of Lamin A/C as Candidate Biomarker of Aggressiveness and Tumorigenicity in Glioblastoma Multiforme

doi: 10.3390/biomedicines9101343

Figure Lengend Snippet: Rictor inhibition is associated with reduction of colony formation. ( A ) Top, representative western blot of the indicated proteins in CTRL and LMNA + T98G cells; bottom, blots densitometry as analyzed by ImageJ software. Values are averages + s.d. (n = 3), relative to mock cells of three independent experiments with similar results. GAPDH was used as loading control. Statistical significance: ** p < 0.01. ( B ) LMNA + clone was transfected with scrambled siRNA as control (SCR, 100 nM) or siRNA Rictor (siRic, 100 nM) and after 48 h from transfection the cells were analysed. Colony number as % of control are reported in siRic-treated (black) versus SCR-treated LMNA+ cells (gray). Statistical significance: siRictor-treated vs SCR-treated LMNA + cells, **** p < 0.0001. ( C ) Top panel, representative western blot of the indicated protein expression in LMNA + cells transfected with scrambled (SCR) and siRNA Rictor (siRic); bottom panel, blots densitometry as analyzed by ImageJ software. Values are averages + s.d. (n = 3), relative to SCR-treated cells of three independent experiments with similar results. GAPDH was used as loading control. Statistical significance: *** p < 0.001.

Article Snippet: T98G human GBM cell line (KCLB Cat# 21690) was cultured in Dulbecco’s modified Eagle’s Medium (DMEM) supplemented with 10% FBS, 2mM L-glutamine and 1% penicillin/streptomycin.

Techniques: Inhibition, Western Blot, Software, Control, Transfection, Expressing

Journal: Cell Proliferation

Article Title: Myc down‐regulation affects cyclin D1/cdk4 activity and induces apoptosis via Smac/Diablo pathway in an astrocytoma cell line

doi: 10.1111/j.1365-2184.2008.00576.x

Figure Lengend Snippet: (a) Western blot analysis of c‐Myc protein expression on both T98G and ADF cell lines. Each lane was loaded with 70 µg of proteins from cell lysate. Protein levels were quantified by densitometric analysis (TotalLab image analysis solution, version 2003) and normalized for β‐actin. The experiment was repeated three times showing similar results. (b) Growth curves of both T98G and ADF pINDneo control and pINDc‐myc As clones. pINDneo control clones were transfected with the empty vector (1, 3), and pINDc‐myc As clones (2, 4) were treated with 25 µm of ponasterone given every 24 h. At the indicated times, from day 2 (24 h after induction) to day 5 (96 h after induction), cells were harvested and counted by using the trypan blue dye exclusion test. All data are expressed as means ± standard deviation of three independent experiments with similar results. Statistical significance of data was evaluated by one‐way analysis of variance followed by Tukey post‐hoc test. (c) Representative RT‐PCR analysis of ectopic c‐myc As and endogenous c‐myc in pINDneo control and pINDc‐myc As transfected cells. Clones were exposed for 24 h to 25 µm of ponasterone. c‐myc (Hmyc 01 for ATTCTCTGCTCTCCTCGA; Hmyc02 rev TCTTGGCAGCAGGATAGT); c‐myc As (Hmyc 03 for CTCCTCGTCGCAGTAGAA; BGH rev TAGAAGGCACAGTCGAGG); β‐actin (sense GCGCGGCGTAGCCCCCGTCAG; anti‐sense CGCGGCAGGAAGCCAGGCCCC). β‐actin c‐DNA was used as an internal control. The experiment was repeated three times showing similar results.

Article Snippet: Culture conditions, transfection, treatments and cell population growth The T98G human glioblastoma cell line (glioblastoma multiforme) was cultured in RPMI 1640 (Cambrex Corp., East Rutherford, NJ, USA) and ADF (Grade IV astrocytoma) in Dulbecco's modified Eagle's medium (DMEM; Cambrex) supplemented with foetal calf serum 10% (Life Technologies, Paisley, UK), penicillin (100 μg/ml), streptomycin (100 μg/ml) and l ‐glutamine (2 m m ) at 37 °C in a 5% CO 2 /95% air atmosphere.

Techniques: Western Blot, Expressing, Control, Clone Assay, Transfection, Plasmid Preparation, Standard Deviation, Reverse Transcription Polymerase Chain Reaction

Journal: Cell Proliferation

Article Title: Myc down‐regulation affects cyclin D1/cdk4 activity and induces apoptosis via Smac/Diablo pathway in an astrocytoma cell line

doi: 10.1111/j.1365-2184.2008.00576.x

Figure Lengend Snippet: Determination of the optimal schedule of hormone treatment in both T98G and ADF pINDc‐myc As clones. Cell growth number effects in both T98G and ADF clones exposed to 5 (), 10 (), 15 (), 20 (*) and 25 µm () dosages of ponasterone given every 24 h. As control we used pINDneo () for each cell line. At the indicated times, from day 2 (24 h after induction) to day 5 (96 h after induction), cells were harvested and counted by using trypan blue dye exclusion. All data are expressed as means ± standard deviation of three independent experiments with similar results. Statistical significance of the data was evaluated by one‐way analysis of variance followed by Tukey post‐hoc test.

Article Snippet: Culture conditions, transfection, treatments and cell population growth The T98G human glioblastoma cell line (glioblastoma multiforme) was cultured in RPMI 1640 (Cambrex Corp., East Rutherford, NJ, USA) and ADF (Grade IV astrocytoma) in Dulbecco's modified Eagle's medium (DMEM; Cambrex) supplemented with foetal calf serum 10% (Life Technologies, Paisley, UK), penicillin (100 μg/ml), streptomycin (100 μg/ml) and l ‐glutamine (2 m m ) at 37 °C in a 5% CO 2 /95% air atmosphere.

Techniques: Clone Assay, Control, Standard Deviation