Sirna Ube2c | Bioz

We use essential cookies to operate our site. With your consent, we may also use non-essential cookies to improve your user experience and to analyze website traffic. Click "Accept" to accept cookies and go directly to the site, click "Reject" to reject all but cookies strictly necessary for the functioning of this site. You can reset your cookie settings at any time by visiting your Bioz "my account" page and selecting the "reset cookie preferences" link.

Results

Images

All (5)

Santa Cruz

Shanghai GenePharma

Genechem

Sangon Biotech

OriGene

About 15 products / 16 snippets / 24 images

	86 / 100 Bioz Stars		UBE2C siRNA Santa Cruz		Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us	Visit Supplier
			Techniques Article Snippets ".. of p53 siRNA (Ambion, Austin, TX, USA and Dharmacon, Lafayette, CO, USA), 80 nM of UBE2C siRNA (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and 80 nM of E2F4 siRNA (Santa Cruz .." (see more)	× MORE IMAGES FROM THIS ARTICLE Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us 1x 2x 3x 6x Product associated with above image that matches your search query UBE2C siRNA Santa Cruz Article Snippet "" Figure Legend " " MORE IMAGES FROM THIS ARTICLE

	86 / 100 Bioz Stars		UBE2C siRNA Shanghai GenePharma		Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us	Visit Supplier
			Techniques Article Snippets ".. or SKOV3 cells were plated in six-well plates and transfected with five μM UBE2C siRNA (GenePharma, Shanghai, China) or control siRNA (GenePharma, Shanghai, China) using Lipofectamine 3000 .." (see more)	× MORE IMAGES FROM THIS ARTICLE The Expression and Role Analysis of Methylation-Regulated Differentially Expressed Gene UBE2C in Pan-Cancer, Especially for HGSOC Cancers Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us The Expression and Role Analysis of Methylation-Regulated Differentially Expressed Gene UBE2C in Pan-Cancer, Especially for HGSOC Cancers 2000 Jan 01 Product Images (7) Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us 1x 2x 3x 6x Product associated with above image that matches your search query UBE2C siRNA Shanghai GenePharma Article Snippet "A2780 or SKOV3 cells were plated in six-well plates and transfected with five μM UBE2C siRNA (GenePharma, Shanghai, China) or control siRNA (GenePharma, Shanghai, China) using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA)." Figure Legend "Figure 1 Identification of MeDEGs in HGSOC. ( A ). The intersection of the upregulated DEGs in the above four expression profiles; the red flower indicates the 995 genes that were upregulated in at least three of the expression profiling datasets. ( B ). The intersection of the downregulated DEGs in the above four expression profiles; the red flower indicates the 989 genes that were downregulated in at least three of the expression profiling datasets. ( C ). The overlap of hypermethylated DMGs and downregulated DEGs. ( D ). The overlap of hypomethylated DMGs and upregulated DEGs. ( E ). The top 47 hub genes with the highest connectivity, the color of the node indicates the connectivity in the PPI network, and the redder the color is, the greater the connectivity. ( F ). The KEGG analysis of the top 47 hub MeDEGs showed that the 47 hub genes were mainly enriched in the cell cycle pathway. ( G , H ). The GO analysis of the top 47 hub MeDEGs in biological processes (BP) showed that the 47 hub genes were mainly enriched in the cell cycle pathway; a total of 44 genes were enriched in the cell cycle pathway, including UBE2C. " MORE IMAGES FROM THIS ARTICLE Cancers The Expression and Role Analysis of Methylation-Regulated Differentially Expressed Gene UBE2C in Pan-Cancer, Especially for HGSOC

20+ more images

Identification of MeDEGs in HGSOC. ( A ). The intersection of the upregulated DEGs in the above four expression profiles; the red flower indicates the 995 genes that were upregulated in at least three of the expression profiling datasets. ( B ). The intersection of the downregulated DEGs in the above four expression profiles; the red flower indicates the 989 genes that were downregulated in at least three of the expression profiling datasets. ( C ). The overlap of hypermethylated DMGs and downregulated DEGs. ( D ). The overlap of hypomethylated DMGs and upregulated DEGs. ( E ). The top 47 hub genes with the highest connectivity, the color of the node indicates the connectivity in the PPI network, and the redder the color is, the greater the connectivity. ( F ). The KEGG analysis of the top 47 hub MeDEGs showed that the 47 hub genes were mainly enriched in the cell cycle pathway. ( G , H ). The GO analysis of the top 47 hub MeDEGs in biological processes (BP) showed that the 47 hub genes were mainly enriched in the cell cycle pathway; a total of 44 genes were enriched in the cell cycle pathway, including <t>UBE2C.</t>

Correlation analysis of <t> UBE2C </t> expression and clinicopathologic features in patients with HCC.

<t>UBE2C</t> mediates DTX sensitivity and mitotic slippage of PCa cells. A , heatmap representing the expression profiles of several mitotic genes associated with ARV7 status using the public database, specifically, the correlation between ARV7 and UBE2C was shown as the box plot. B , virus-infected C4-2 and PC-3 cells (vector or shUBE2C) were harvested for FACS analysis. C and D , virus-infected C4-2 cells or PC-3 cells were treated with DTX arrest and release as previously described, after indicated time, cells were harvested for IB. E , quantification of the multinucleated cells using the IF images acquired. F , virus-infected PC-3 cells were arrested using 10 nM DTX for 18 h, then medium was refreshed to release the cells with the presence of 10 μM MG132, after 8 h, cells were harvested for IB and IP. G , virus-infected PC-3 cells were arrested using 10 nM DTX for 18 h, then medium was refreshed to release the cells for additional 8 h before harvesting for IB and IP. H , virus-infected C4-2 and PC-3 cells were seeded in 96-well plate, treated with DTX or DMSO for 72 h before harvesting for MTT assay. I , virus-infected C4-2 cells were treated with indicated concentration of DTX for 24 h and then harvested for IB.

EXP

VIR

INFECT

PLASMID-P

MTT

EXP

PROD

IHC

	86 / 100 Bioz Stars		UBE2C shRNA Genechem		Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us	Visit Supplier
			Techniques Article Snippets "The lentiviral expression vector expressing Flag-UBE2C and UBE2C shRNA were purchased from Genechem (Shanghai, China). pLenti-Flag-N1ICD was acquired from the Public Protein/Plasmid Library .." (see more)	× MORE IMAGES FROM THIS ARTICLE The activation of the Notch signaling pathway by UBE2C promotes the proliferation and metastasis of hepatocellular carcinoma Scientific Reports Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us The activation of the Notch signaling pathway by UBE2C promotes the proliferation and metastasis of hepatocellular carcinoma Scientific Reports 2000 Jan 01 Product Images (7) Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us 1x 2x 3x 6x Product associated with above image that matches your search query UBE2C shRNA Genechem Article Snippet "The lentiviral expression vector expressing Flag-UBE2C and UBE2C shRNA were purchased from Genechem (Shanghai, China). pLenti-Flag-N1ICD was acquired from the Public Protein/Plasmid Library (Nanjing, China)." Figure Legend "Table 1 Correlation analysis of UBE2C expression and clinicopathologic features in patients with HCC." MORE IMAGES FROM THIS ARTICLE Scientific Reports The activation of the Notch signaling pathway by UBE2C promotes the proliferation and metastasis of hepatocellular carcinoma

	86 / 100 Bioz Stars		Human UBE2C siRNAs Sangon Biotech		Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us	Visit Supplier
			Techniques Article Snippets "Human UBE2C siRNAs were purchased from Sangon Biotech, Shanghai, China (sequences are listed in Table 5), and all siRNAs .." (see more)	× MORE IMAGES FROM THIS ARTICLE Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us 1x 2x 3x 6x Product associated with above image that matches your search query Human UBE2C siRNAs Sangon Biotech Article Snippet "" Figure Legend " " MORE IMAGES FROM THIS ARTICLE

	86 / 100 Bioz Stars		UBE2C small interfering RNA (siRNA) Shanghai GenePharma		Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us	Visit Supplier
			Techniques Article Snippets "UBE2C small interfering RNA (siRNA) were bought from GenePharm (Shanghai, China)." (see more)	EXP PROD IHC × MORE IMAGES FROM THIS ARTICLE UBE2C serves as a prognosis biomarker of uterine corpus endometrial carcinoma via promoting tumor migration and invasion Scientific Reports Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us UBE2C serves as a prognosis biomarker of uterine corpus endometrial carcinoma via promoting tumor migration and invasion Scientific Reports 2000 Jan 01 Product Images (6) Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us 1x 2x 3x 6x Product associated with above image that matches your search query UBE2C small interfering RNA (siRNA) Shanghai GenePharma Article Snippet "UBE2C small interfering RNA (siRNA) were bought from GenePharm (Shanghai, China)." Figure Legend "Figure 2 UBE2C mRNA expression and proteomic expression levels in UCEC. Expression of UBE2C based on sample type ( a ), individual cancer stages ( b ), histological subtypes ( c ) and patient’s race ( d ). Box plot and p-value were produced using UALCAN ( http://ualcan.path.uab.edu/index.html ). The UBE2C proteomic expression profile based on sample types ( e ), tumor grade ( f ), individual cancer stages ( g ) and tumor histology ( h ). i. IHC staining of UBE2C was produced from HPA database. " EXP PROD IHC MORE IMAGES FROM THIS ARTICLE Scientific Reports UBE2C serves as a prognosis biomarker of uterine corpus endometrial carcinoma via promoting tumor migration and invasion

	86 / 100 Bioz Stars		UBE2C-targeting siRNA sequence (GACCUGAGGUAUAAGCUCUTT) Genechem		Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us	Visit Supplier
			Techniques Article Snippets ".. FBS) for 8–12 h. shUBE2C lentivirus was generated using the UBE2C-targeting siRNA sequence (GACCUGAGGUAUAAGCUCUTT) obtained from GeneChem (Shanghai, China)." (see more)	× MORE IMAGES FROM THIS ARTICLE Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us 1x 2x 3x 6x Product associated with above image that matches your search query UBE2C-targeting siRNA sequence (GACCUGAGGUAUAAGCUCUTT) Genechem Article Snippet "" Figure Legend " " MORE IMAGES FROM THIS ARTICLE

	86 / 100 Bioz Stars		SiRNA targeting sequence: UBE2C: CCUGCAAGAAACCUACUCA Shanghai GenePharma		Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us	Visit Supplier
			Techniques Article Snippets "siRNA targeting sequence: UBE2C: CCUGCAAGAAACCUACUCA , Genepharma , N/A." (see more)	TNSF CON PLASMID-P EXP IP × MORE IMAGES FROM THIS ARTICLE The Negative Cross-Talk between SAG/RBX2/ROC2 and APC/C E3 Ligases in Regulation of Cell Cycle Progression and Drug Resistance Cell reports Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us The Negative Cross-Talk between SAG/RBX2/ROC2 and APC/C E3 Ligases in Regulation of Cell Cycle Progression and Drug Resistance Cell reports 2000 Jan 01 Product Images (2) Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us 1x 2x 3x 6x Product associated with above image that matches your search query SiRNA targeting sequence: UBE2C: CCUGCAAGAAACCUACUCA Shanghai GenePharma Article Snippet "siRNA targeting sequence: UBE2C: CCUGCAAGAAACCUACUCA , Genepharma , N/A." Figure Legend "Figure 1. (A–D) H1299 cells were transfected with siRNA targeting SAG or control siCont (A and B) or a plasmid expressing FLAG-tagged SAG or vector control (C and D) for 48 h with last 8-h treatment of 10 μM MG132 before harvesting. Cell lysates were prepared for immunoprecipitation (IP) with immunoglobulin G (IgG) control or antibodies (Abs) against UBE2C (A and C) or UBE2S (B and D), followed by immunoblot (IB) with indicated Abs. WCE, whole-cell extract. (E and F) H1299 cells were transfected with siRNA targeting APC2 or control siCont for 48 h with last-8 h treatment of 10 μM MG132 before harvesting. Cell lysates were prepared for IP with IgG control or Abs against UBE2C (E) or UBE2S (F), followed by IB with indicated Abs. (G–I) H1299 or H2170 cells were transfected with siRNA targeting SAG or control siCont for 48 h, followed by 24-h treatment of 12 uM pro-TAME (H) or 10 μM MG132 (I) in indicated samples before harvesting for IB analysis with indicated Abs. (J–L) H1299 cells were transfected with various siRNA targeting indicated mRNAs, along with control siCont for 48 h. Cell lysates were prepared for IB analysis with indicated Abs. Also see and . " TNSF CON PLASMID-P EXP IP MORE IMAGES FROM THIS ARTICLE Cell reports The Negative Cross-Talk between SAG/RBX2/ROC2 and APC/C E3 Ligases in Regulation of Cell Cycle Progression and Drug Resistance

	86 / 100 Bioz Stars		UBE2C: CCUGCAAGAAACCUACUCA Genepharma N/A siRNA targeting sequence Shanghai GenePharma		Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us	Visit Supplier
			Techniques Article Snippets "REAGENT or RESOURCE SOURCE IDENTIFIER siRNA targeting sequence: UBE2C: CCUGCAAGAAACCUACUCA Genepharma N/A siRNA targeting sequence: UBE2S: CCTCCAACTCTGTCTCTAA Genepharma N/A siRNA targeting sequence: SAG: CCTGTGGGTGAAACAGAACAA .." (see more)	× MORE IMAGES FROM THIS ARTICLE Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us 1x 2x 3x 6x Product associated with above image that matches your search query UBE2C: CCUGCAAGAAACCUACUCA Genepharma N/A siRNA targeting sequence Shanghai GenePharma Article Snippet "" Figure Legend " " MORE IMAGES FROM THIS ARTICLE

	86 / 100 Bioz Stars		Transient transfection UBE2C small interfering RNA (siRNA) Shanghai GenePharma		Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us	Visit Supplier
			Techniques Article Snippets ".. Helsinki for medical research involving humans. siRNA knockdown and transient transfection UBE2C small interfering RNA (siRNA) were bought from GenePharm (Shanghai, China)." (see more)	× MORE IMAGES FROM THIS ARTICLE Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us 1x 2x 3x 6x Product associated with above image that matches your search query Transient transfection UBE2C small interfering RNA (siRNA) Shanghai GenePharma Article Snippet "" Figure Legend " " MORE IMAGES FROM THIS ARTICLE

	86 / 100 Bioz Stars		Human UBE2C shRNA lentiviral particles Santa Cruz		Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us	Visit Supplier
			Techniques Article Snippets "For UBE2C depletion, human UBE2C shRNA lentiviral particles (sc-61742-v) were purchased from Santa Cruz Biotechnology, and UBE2C depleted cells were selected using puromycin .." (see more)	EXP VIR INFECT PLASMID-P MTT × MORE IMAGES FROM THIS ARTICLE Androgen receptor splicing variant 7 (ARV7) inhibits docetaxel sensitivity by inactivating the spindle assembly checkpoint The Journal of Biological Chemistry Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us Androgen receptor splicing variant 7 (ARV7) inhibits docetaxel sensitivity by inactivating the spindle assembly checkpoint The Journal of Biological Chemistry 2000 Jan 01 Product Images (2) Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us 1x 2x 3x 6x Product associated with above image that matches your search query Human UBE2C shRNA lentiviral particles Santa Cruz Article Snippet "For UBE2C depletion, human UBE2C shRNA lentiviral particles (sc-61742-v) were purchased from Santa Cruz Biotechnology, and UBE2C depleted cells were selected using puromycin as well." Figure Legend "Figure 5 UBE2C mediates DTX sensitivity and mitotic slippage of PCa cells. A , heatmap representing the expression profiles of several mitotic genes associated with ARV7 status using the public database, specifically, the correlation between ARV7 and UBE2C was shown as the box plot. B , virus-infected C4-2 and PC-3 cells (vector or shUBE2C) were harvested for FACS analysis. C and D , virus-infected C4-2 cells or PC-3 cells were treated with DTX arrest and release as previously described, after indicated time, cells were harvested for IB. E , quantification of the multinucleated cells using the IF images acquired. F , virus-infected PC-3 cells were arrested using 10 nM DTX for 18 h, then medium was refreshed to release the cells with the presence of 10 μM MG132, after 8 h, cells were harvested for IB and IP. G , virus-infected PC-3 cells were arrested using 10 nM DTX for 18 h, then medium was refreshed to release the cells for additional 8 h before harvesting for IB and IP. H , virus-infected C4-2 and PC-3 cells were seeded in 96-well plate, treated with DTX or DMSO for 72 h before harvesting for MTT assay. I , virus-infected C4-2 cells were treated with indicated concentration of DTX for 24 h and then harvested for IB. " EXP VIR INFECT PLASMID-P MTT MORE IMAGES FROM THIS ARTICLE The Journal of Biological Chemistry Androgen receptor splicing variant 7 (ARV7) inhibits docetaxel sensitivity by inactivating the spindle assembly checkpoint

	86 / 100 Bioz Stars		UBE2C shRNA (shUBE2C) Sangon Biotech		Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us	Visit Supplier
			Techniques Article Snippets "Abstract: Vorinostat is a histone deacetylase inhibitor (HDACi) that was demonstrated in our previous study to inhibit the proliferation, migration, and invasion of cervical cancer cells by regulating the PI3K/Akt signaling pathway.. However, ..." (see more)	× MORE IMAGES FROM THIS ARTICLE Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us 1x 2x 3x 6x Product associated with above image that matches your search query UBE2C shRNA (shUBE2C) Sangon Biotech Article Snippet "" Figure Legend " " MORE IMAGES FROM THIS ARTICLE

	93 / 100 Bioz vStars		ube2c human sirna oligo duplex OriGene		Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us	Visit Supplier
			Catalog#: SR307571 Description "UBE2C Human 3 unique 27mer siRNA duplexes 2 nmol each"	× MORE IMAGES FROM THIS ARTICLE Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us Open an account FREE Academic Industry already a user? Sign in are you a supplier? Contact us 1x 2x 3x 6x Product associated with above image that matches your search query ube2c human sirna oligo duplex OriGene Article Snippet "" Figure Legend " " MORE IMAGES FROM THIS ARTICLE